Journal of Experimental Botany, Vol. 51, No. 343, pp. 187-196,
February 2000
© 2000 Oxford University Press
Cytodifferentiation and transformation of embryogenic callus lines derived from anther culture of wheat
Section of Plant Breeding and Biotechnology, Department of Agricultural Sciences, The Royal Veterinary and Agricultural University, Thorvaldsensvej 40, Frederiksberg DK-1871, Denmark
Received 18 March 1999; Accepted 5 October 1999
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Three types of callus tissues established from anther culture of eleven doubled haploid (DH) lines of wheat (Triticum aestivum L.) were evaluated for their ability in enhancing friable embryogenic (Type II) culture differentiation and genetic transformation. Differences between types of callus inocula were highly significant (P<0.001), suggesting that the quality of the initial callus explant is of profound importance in encouraging the proliferation of Type II cultures. Other factors found to be crucial included weekly subculture of friable embryogenic callus tissues on a maintenance medium containing 30 µM dicamba and a predominance of amino-acid nitrogen supplement. Transfer and integration of the ß-glucuronidase gene was also affected by the type of inoculum when suitable embryogenic cell cultures were transformed using silicon carbide whiskers and high velocity microprojectiles. Expression of the hygromycin phosphotransferase selectable marker gene sequence was confirmed in all the stably transformed cell lines maintained on selection media containing lethal levels of hygromycin. Comparatively, there were differences in the frequency of regenerable, transgenic clonal segments between whisker-treated and microprojectile bombarded tissues mainly as a result of the fact that cultures vortexed with whiskers were more capable of post-treatment cell proliferation and embryo differentiation than those bombarded with cDNA-coated microprojectiles. Conditions for obtaining these results are outlined and discussed in relation to the suitability of the two transformation strategies for producing transgenic cell aggregates of wheat.
Key words: Amino-acid nitrogen, cDNA-coated microprojectiles, silicon carbide whiskers, Type II cultures, Triticum aestivum
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Within the past decade, much progress has been made in the development of genetic engineering technologies for the improvement of cereal crops and grass species of economic importance. Current methodologies of gene transfer into these crops are based mainly on biolistic discharge of DNA constructs into embryogenic cells and intact explants followed by callus induction and early selection of transformed segments (Casas et al., 1993
; Weeks et al., 1993; Wan and Lemaux, 1994) or direct uptake of plasmid DNA by regenerable protoplasts (Wang et al., 1992). Although genetic modification of cereals and grass species using these approaches is more or less routine by now, however, these techniques are not only associated with abnormal growth and sterility of regenerated plants in some cases, but are also laborious and resource demanding.
One area of research in genetic transformation of the Gramineae that has attracted a lot of interest within the past three to six years has been the use of disarmed strains of Agrobacterium tumefaciens, understandably, because as with dicotyledonous species this bacterium can also transfer a defined piece of its DNA (T-DNA) to competent embryogenic tissues in monocotyledonous species; as successfully demonstrated in rice (Hiei et al., 1994; Rashid et al., 1996; Toki, 1997; Sakamoto et al., 1998), maize (Ishida et al., 1996), wheat (Cheng et al., 1997) and barley (Tingay et al., 1997; Wu et al., 1998). The Agrobacterium-mediated transformation system offers several advantages including its high degree of efficiency, transfer of relatively large segments of DNA with little rearrangement and integration of low copy numbers of genes into plant chromosomes (Ishida et al., 1996). These advantages notwithstanding, this method is currently in its infancy and would probably require the trial of a wide range of suitable vectors before it could be made routinely applicable to regenerable cells and tissues of all cereal and grass species. Another relatively simple and inexpensive plant transformation strategy, which might perhaps suit the needs of research groups in developing countries better, appears to be the silicon carbide whisker-mediated gene delivery system using embryogenic tissues and suspension cell aggregates as described for maize (Kaeppler et al., 1992; Frame et al., 1994) and for rice (Nagatani et al., 1997).
Typically for the cereal crops, highly totipotent cell cultures are often derived from friable embryogenic (Type II) callus tissues. Unfortunately, in most of these crops, and especially wheat, Type II cultures occur at low frequencies and/or are difficult to establish and maintain. However, it has been possible to overcome these obstacles by demonstrating that highly regenerable cell cultures capable of producing green plantlets can be established quite consistently from anther culture-derived friable embryogenic callus tissues of wheat (Brisibe et al., 1997).
In the current study, these earlier observations have been extended such that a more detailed analysis of the role of initial callus inoculum and other key nutritional and in vitro parameters in controlling consistent proliferation of friable embryogenic cultures is provided. Furthermore, the best conditions for inducing these types of cultures were combined in a culture medium and used to evaluate the relative efficiencies of silicon carbide whisker- and microprojectile bombardment-mediated gene delivery systems for the analysis of transgene expression in embryogenic callus lines derived from anther culture of wheat.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Plant material and anther culture
Unless specifically stated, plant material consisted of five spring and six winter types of doubled haploid (DH) lines previously derived by means of anther culture from the hybrid between the French winter line ‘Benoist’ and the Mexican spring variety ‘Ciano’. Both parental lines are known to possess a high capacity for green plantlet regeneration in wheat anther culture (Tuvesson et al., 1989
). The eleven lines are seed offspring selected from 50 spontaneously chromosome doubled haploids from the cross, and are used in this study because of their capacity for consistent regeneration of green plantlets in anther culture.
Cultivation of the donor plants and anther culture procedures were as described in detail previously (Brisibe et al., 1997). Briefly, anthers dissected from sterilized spikelets were plated directly in disposable plastic Petri dishes containing 190–2 basal medium (Wang and Hu, 1984) supplemented with 1.5 mg l-1 2,4-D, 0.1 mg l-1 kinetin and 10% maltose. The pH was adjusted to 6.0 prior to the addition of 0.2% Gelrite (Kelco, San Diego, USA) and autoclaving. All Petri dishes were sealed with household polyethylene film and treated with heat shock at 33 °C for the first 3 d of culture. Subsequently, the cultures were transferred to a growth chamber and maintained at 28±1 °C for about 4 months. During this period, especially within the first 4–10 weeks, three morphologically distinct primary tissue types were induced: (i) poly-embryoids (group of multiple embryoids derived from microspores), (ii) compact and hard callus containing many small, prominent embryo-like structures, and (iii) pale yellow, soft and friable callus sometimes embedded in a mucilaginous matrix.
Establishment and maintenance of friable embryogenic cultures
Each of the three types of cell lines described above was tested as inoculum for the establishment of friable embryogenic cultures. In the standard procedure, Type II culture proliferation was promoted routinely by transferring pale yellow, soft and friable callus initially onto a standard friable callus proliferation medium containing General basal salts (see details in Brisibe et al., 1997), 30 µM dicamba, 1 g l-1 casein hydrolysate, 0.5 mg l-1 choline chloride, 4% (w/v) sucrose, 2% (w/v) sorbitol; at pH 6.0 and semi-solidified with 0.2% Gelrite. After some preliminary evaluations, modifications to this standard culture medium were made in order to allow further experiments to investigate the effects of in vitro condition and nutritional parameters on cytodifferentiation and long-term maintenance of friable, embryogenic competence in the cultures.
Transformation protocols
Silicon carbide whisker- and microprojectile bombardment-mediated gene delivery systems were evaluated using: (i) friable, early embryogenic callus tissues, (ii) compact and hard callus containing many small, prominent embryo-like structures and (iii) embryogenic suspension cells (Brisibe et al., 1997) according to standard published procedures (Kaeppler et al., 1992; Nagatani et al., 1997; Wan and Lemaux, 1994).
Plasmids
Plasmids pAHC25, pDM803 and PORCEHyg were purified using a QIAGEN Plasmid Maxi Kit (QIAGEN Inc., Chatworth, CA, USA). The plasmid pAHC25 (Christensen et al., 1992) contains the uidA reporter gene encoding the enzyme ß-glucuronidase and a selectable bar gene encoding the enzyme phosphinothricin acetyltransferase which inactivates phosphinothricin, the active ingredient in the non-selective herbicides bialaphos and BastaTM. Plasmid pDM803 (McElroy et al., 1990) consists of the uidA gene under the control of the Act1 promoter and bar gene under the control of Ubi-1 promoter, while plasmid PORCEHyg (Hensgens et al., 1993) consists of the uidA gene under the control of the GOS 2 promoter and hph gene, encoding the enzyme hygromycin phosphotransferase which enhances resistance to hygromycin B, under the control of the CaMV 35S promoter.
Selection of transformed tissues
Immediately after vortexing or bombardment, cells were carefully removed and resuspended in the standard callus proliferation medium supplemented with all the additives (except 
-glutamine and -asparagine in the case of cell lines treated with pAHC25 and pDM803) and 0.25 M each of sorbitol and mannitol, respectively. After about a week in liquid medium (without the selective antibiotic agent), cells were vacuum-filtered onto sterile filter papers and transferred to a fresh callus proliferation medium (as above) containing either 15 mg l-1 hygromycin or 20 mg l-1 Basta, depending on the plasmid construct. Cells were subcultured weekly onto fresh selection medium. Subsequently, at monthly intervals embryogenic aggregates showing vigorous growth were separated from necrotic tissue segments and cultured on selection medium containing 30 and 60 mg l-1 hygromycin or 50 and 100 mg l-1 Basta, respectively. Resistant cell clumps were isolated after 10–12 weeks of continuous selection and maintained as individual embryogenic cell lines on semi-solid medium containing either 60 mg l-1 hygromycin or 100 mg l-1 Basta.
Histochemical GUS analysis
ß-glucuronidase (GUS) expression in transformed cell aggregates was performed at 3, 14, 28, and 42 d after vortexing or bombardment (according to Jefferson et al., 1987) with an addition of 20% (v/v) methanol in the reaction buffer to eliminate the effect of endogenous GUS activity. Transient and stable gene expression was quantified by counting the number of blue spots per sample under a binocular microscope.
Reverse transcription–polymerase chain reaction amplification (RT-PCR)
Preliminary studies indicated that hygromycin B was a more severe selective antibiotic agent, allowing virtually no escapes. Consequently, molecular evaluation designed to confirm transgenesis in this study was undertaken with hygromycin-resistant cell cultures.
Total RNA was isolated from both the stably transformed and non-transformed callus lines by using the TRIzol reagent system (Life Technologies, Gaithersburg, MD, USA). Ribonucleic acids were reverse transcribed and first strand cDNA synthesis performed with 1 µg of total RNA in 10 µl reactions, using SuperScriptTM II RNase H–ReverseTranscriptase according to the protocol of the manufacturers (Life Technologies, Gaithersburg, MD, USA). In subsequent analyses, 1 µl aliquots from each of the samples were then selectively amplified in 25 µl PCR reactions using the following primer sequences: (i) 5' GCTGGGGCGTCGGTTTCCACTATCCG 3' and (ii) 5' CGCATAACAGCGGTCATTGACTGGAGC 3' to amplify the internal hygromycin phosphotransferase fragment. As a precaution against possible contamination from genomic DNA, RT reactions were set up directly for PCR analyses without the reverse transcriptase enzyme and evaluated as control experiments.
Cytological observations
Cell viability was estimated (according to the method of Huang et al., 1986) by staining fresh tissue samples in two fluorescent dyes: fluorescein diacetate, which fluoresces green for living cells, and propidium iodide, which reveals the nuclei of dead cells by an intense red fluorescence.
Data analysis
Treatments in the friable callus proliferation and embryogenesis studies were repeated six times with each treatment consisting of 18–24 Petri dishes. The number of dishes expressed as a percentage of the total showing friable embryogenic competence after 24 weeks of culture for each treatment was used as a response parameter. Data given are mean values for all the experiments and were analysed by a simple one-way analysis of variance.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Differentiation and characterization of friable embryogenic cultures
An analysis of variance comparing competence of the primary tissue types derived from each of the 11 DH-lines as inocula for the establishment of friable embryogenic cultures is presented in Table 1
. There were highly significant differences (P<0.001) between the three types of inocula in their capacity for formation of Type II cultures. In contrast, differences observed among the DH-lines tested against their interactions with inocula were not significant. Of the three types of inocula (Fig. 1a, b, c) used, pale yellow and friable callus was the most suitable choice, since a fast-growing and yellowish friable callus at the early stages of embryogenesis was obtained predominantly (ranging from 54–100%) only from this type of inoculum for all wheat lines within 2–3 weeks of maintenance on the standard friable callus proliferation medium.
|
|
Among the possible explanations for the inability of polyembryoids and compact and hard callus tissues to produce Type II cultures was the type and concentration of auxin and nutrient combinations used in this experiment. To verify this, the response of the three types of callus inocula in differentiating friable, early embryogenic cultures was re-examined in two independent experiments using a factorial arrangement of four levels of three auxins (dicamba, 2,4-dichlorophenoxyacetic acid and naphthaleneacetic acid), sucrose (at 30, 60, 90, and 120 g l-1) and four DH-lines on the standard friable callus proliferation medium. No significant difference was observed for either type or concentration of auxins and levels of sucrose (data not shown). All three auxins supported the proliferation of Type II cultures from pale yellow, soft and friable callus quite easily, even though dicamba appeared to be considerably more effective than either 2,4-D or NAA in sustaining long-term growth of embryogenic cultures.
Analysis of variance of a second study designed to evaluate the effect of different types of auxins and inocula also indicated a highly significant (P<0.001) role due to the effect of callus tissues used (Table 2). All the three auxins either were ineffective in inducing the desired Type II cultures at all from polyembryoids or did so only sparingly from the compact and hard callus tissues after many subcultures and strict selection of friable embryogenic segments.
|
Regulation of long-term friable embryogenic competence
Standardization of in vitro culture and medium parameters in a second series of optimization experiments demonstrated that the growth rate of friable cultures and long-term maintenance of embryogenic competence could be improved significantly when callus lines were subcultured at short intervals on semi-solid General basal medium supplemented with 30 µM dicamba and high concentrations of amino-acid nitrogen.
Relative to the other regimes, subculture frequencies at 7–10-d intervals were preferable because they accounted for more than 95% of the total callus lines capable of long-term friability and embryogenic competence (Table 3). When subcultured at 7–10-d intervals, growth rate of callus lines from most DH-lines were greatly improved, often leading to the formation of highly homogenous friable cultures only 2–4 weeks after establishment. Friable, early embryogenic callus lines were maintained using this subculture regime for over 16 months without any apparent loss of friability and embryogenic competence.
|
Prolonged maintenance of Type II cultures without subculture on to fresh medium had a highly negative effect on callus friability and long-term embryogenic competence. In several experiments, cultures maintained for 21 d or more on the same medium gradually became more extensively differentiated, assuming the morphology of the typical compact callus tissue from which multiple green shoots were readily regenerated.
Regardless of their specific actions, virtually all the individual amino acids used in this study supported the proliferation of friable embryogenic cultures, albeit to significantly varying degrees. Under the experimental conditions reported in the present study using two DH-lines, -glutamine was clearly the most effective amino acid with a threshold concentration of 0.5 g l-1 and 2–3.5 g l-1 being optimal after 24 weekly subcultures. For the subsequent regeneration of green plantlets, again cultures maintained on media with -glutamine, -asparagine, and -proline were more productive (Fig. 2).
|
—) BxC 46; and plantlet differentiation (—
—) BxC 25; (—Friability and long-term embryogenic competence of Type II cultures maintained on medium containing different levels of the six amino acids combined in a 6x6 factorial design were compared with optimum levels of each of the individual amino acids as well as casein hydrolysate. After several evaluations the data obtained revealed that a medium containing a mixture of 0.0025 M each of
-alanine, -aspartic acid and -serine and 0.005 M each of -asparagine, -glutamine and -proline in combination proved to be the most effective nutritional modification.
Delivery of plasmid DNA into embryogenic cell aggregates
With conditions optimized for friable embryogenic cell proliferation and maintenance, several experiments were undertaken to enhance the frequencies of uidA expression in silicon carbide whisker-vortexed and microprojectile bombarded cell aggregates. GUS activity was detected in all the three types of DNA-treated tissue samples, irrespective of the mode of gene delivery (Fig. 1d, e). No background blue spots were observed in control experiments where embryogenic cells were vortexed with silicon carbide whiskers or bombarded with gold particles without plasmid DNA.
Table 4 summarizes the results of eight independent transformation events designed to compare performance of the two DNA delivery methods and all three kinds of cell types with respect to their gene expression frequencies. Microprojectile bombardment clearly induced higher levels of transient gene expression (3 d after gene delivery), as indicated by the frequency of embryogenic cell clusters with blue spots, compared to vortexing with silicon carbide whiskers. However, this higher frequency of GUS expression in transient assays of bombarded tissues resulted in approximately 6–10-fold less effective stable gene expression compared with the whisker-vortexed cells, where only about a 4–6-fold reduction was observed at 28 d after gene delivery (Table 4).
|
The mean number of blue cells also varied among the three types of embryogenic cultures. Under identical treatment conditions, a higher percentage of tissues with transient and stable GUS activity was obtained from the friable embryogenic callus tissues and suspension cell aggregates than from compact and hard callus tissues (Table 4).
Cell proliferation and embryogenic development of transformed tissues
Considerable variation was also observed between the two plant transformation approaches and three cell types evaluated concerning post-treatment cell differentiation. Cell viability, quantified after staining with fluorescein diacetate and propidium iodide, indicated that over 90% of the vortexed and bombarded callus tissues were viable immediately after treatment. However, as illustrated in Fig. 3, cell viability dropped to less than 75% for tissues vortexed with silicon carbide whiskers and 50% for bombarded tissues about 6 weeks after gene delivery.
|
compact and hard callus tissues; 
suspension cell aggregates).The percentage of stably transformed callus clones capable of inducing embryos on antibiotic-containing selection media (Fig. 1f) was evaluated after 2 months of culture. These results, illustrated in Fig. 4
, show that while between 28% and 64% of the silicon carbide whisker-treated antibiotic resistant cells were capable of developing embryogenic structures during this period, the corresponding values for the bombarded cell aggregates were only about 15–36%.
|
Molecular evaluation of stably transformed callus lines
Wheat embryogenic callus tissues were very sensitive to hygromycin. Non-transformed cells exposed to concentrations greater than 60 mg l-1 for more than 2 weeks of culture were severely inhibited and stopped further growth and development. Integration of the hygromycin phosphotransferase selectable marker gene sequence was confirmed by RT-PCR analysis, which indicated that the gene was expressed in all embryogenic cell lines that survived for up to 3 months on medium containing this lethal dose of hygromycin (Fig. 5).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Recent reports have revealed new avenues for exploiting regenerable embryogenic cell cultures as targets for particle bombardment, silicon carbide whiskers, and Agrobacterium-mediated transformation systems in barley (Wan and Lemaux, 1994
; Tingay et al., 1997; Wu et al., 1998), rice (Hiei et al., 1994; Rashid et al., 1996; Nagatani et al., 1997), and maize (Walters et al., 1992; Frame et al., 1994; Ishida et al., 1996). In maize and some other cereal species where friable embryogenic cultures have been reported, immature zygotic embryos have been the most commonly utilized explants. In wheat, however, such explants, at best only produce compact callus tissues that are difficult to convert to friable embryogenic cultures capable of producing large numbers of regenerants. Aside from this the appearance of highly embryogenic, friable tissues is unpredictable and requires many subculture passages (Yang et al., 1991). This often leads to either a total loss of totipotency or of capacity to regenerate green plantlets before suitable cultures are obtained (Vasil et al., 1990). Recently, an alternative culture system was described that allows efficient green plantlet regeneration from anther culture-derived cells of wheat (Brisibe et al., 1997). In further addressing this idea, the present results confirmed these earlier findings and also demonstrate that while the type of primary callus inoculum appeared to be the most critical factor affecting their initial establishment, frequency of subculture intervals, and especially a predominance of amino acid nitrogen in the medium had a strong influence on both friable callus tissue differentiation and long-term embryogenic competence.
The reported effects of amino acid supplementation on proliferation of Type II cultures varies and seem to depend on the plant species. For example, while it has been demonstrated in maize that the frequency of friable embryogenic callus production can be influenced by increasing the level of -proline in the medium (Armstrong and Green, 1985), comparative data in the current study does support this observation for wheat also, although to a marginally lesser degree than was observed in the earlier study. These results indicate that an amino acid complex containing 0.0025 M each of -alanine, -aspartic acid and -serine and 0.005 M each of -asparagine, -glutamine and -proline in combination gave a better response than each of these amino acids tested alone at optimum concentrations. On an individual basis, -glutamine is the preferred source of amino-acid nitrogen for Type II culture proliferation and maintenance of long-term embryogenic competence in wheat as it enhanced these parameters much better than any of the other amino acid sources evaluated. While the importance of -proline in stimulating friable callus tissue differentiation in cell cultures of maize (Armstrong and Green, 1985) and -glutamine in wheat (as shown by the results reported in this study) is quite well established, the reasons for the differences observed in the two studies are not clearly understood. It is possible this may be related to variations in endogenous levels of the two amino acids during in situ embryogenesis in these two plant species. In fact, developing zygotic embryos of maize have been reported to contain a high concentration of free proline (cited in Armstrong and Green, 1985). In contrast, amino acid analysis in wheat showed that glutamine alone accounted for almost 50% of the free amino acid content of endosperm cavity sap from developing wheat grains (Fisher and Macnicol, 1986). These variations in endogenous amino acid levels notwithstanding, it is reasonable to suggest that proline- and glutamine-elicited friable embryogenic cell proliferation may be on account of their pivotal roles in nitrogen metabolism (Britikov et al., 1970; Padgett and Leonard 1996).
An interesting feature of the data presented here is the observation that transformation frequency could be affected by the type of callus tissues used. These results strongly suggest that friable embryogenic callus tissues and suspension cell aggregates derived therefrom, produced a higher gene transfer efficiency and are more likely to undergo post-transformation cell proliferation and embryogenic growth than compact and hard callus tissues. The differences in gene transfer efficiencies between the three cell types could, in part, be attributed to variations in cell aggregate sizes and composition between them, which consequently may have had some influence on silicon carbide whisker and gold particle penetration into plant cells. Regarding the differences in post-treatment cell proliferation and embryogenic competence, these may be ascribed not only to the varying capacity of the respective cell lines to proliferate after transformation, but perhaps also to the actual number of recipient cells in each embryogenic aggregate that are capable of undergoing subsequent post-treatment division and embryo formation. Although not excluding other possibilities such as a progressive methylation of the uidA gene, the failure of the high transient gene expression levels in bombarded tissues to be translated into efficient stable integrative, transformation events may be interpreted on account of the fact that plasmid DNA-coated microprojectiles are delivered under high gaseous pressures, which may cause quite severe physical traumas resulting in loss of cell viability (Russell et al., 1992; Kausch et al., 1995) and survival of most bombarded callus tissues. Relatedly, it is suspected that the higher morphogenetic capacity observed with the silicon carbide whisker-treated transgenic cell lines might be a consequence of the use of a less injurious gene delivery method, which does not seem adversely to compromise cell survival and/or regeneration potential of the treated tissues.
Of even greater interest and significance drawn from the current results is the realisation that the stably transformed callus clones were established from anther culture-derived embryogenic cultures of doubled haploid lines of wheat, previously tested and known to possess an efficient capacity for green plantlet regeneration (Brisibe et al., 1997). Given the practical utility of anther or microspore derived doubled haploid techniques, especially in the light of a recent study demonstrating Agrobacterium-mediated transformation of wheat cells (Cheng et al., 1997), it is attractive to speculate that our current and earlier findings (Brisibe et al., 1997) would provide useful tools for future genetic transformation studies where large numbers of independent transgenics are required for the production of recombinant homozygous plants with agronomically important transgenes. Such genetically modified plants can subsequently be backcrossed with normal cultivars having good genetic backgrounds and the transgenes introgressed into conventional breeding programmes for further improvement of this globally important cereal crop.
|
Acknowledgments |
|---|
This research was supported by an operating grant from the Danish Veterinary and Agricultural Research Council. The award of visiting research fellowships to EA Brisibe and A Gajdosova under the Visiting Scientists Fellowship (DANVIS) Programme of the Danish Research Academy are gratefully acknowledged. We are also thankful to Mr B Kastrup, Ms B Henriksen, Ms H Faarup and Ms BW Jensen for technical assistance.
|
Notes |
|---|
1 Present address and to whom correspondence should be addressed. Laboratory of Plant Molecular Biology, BioScience Center, Nagoya University, Nagoya 464–8601, Japan. Fax: +81 52 792 3616. E-mail:bridges{at}gld.mmtr.or.jp
2 Permanent address: Institute of Plant Genetics, Slovak Academy of Sciences, Nitra, Slovakia.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Armstrong CL, Green CE. 1985. Establishment and maintenance of friable, embryogenic maize callus and the involvement of
-proline. Planta 164, 207–214.Brisibe EA, Olesen A, Andersen SB. 1997. Characterization of anther culture-derived cell suspensions exclusively regenerating green plantlets in wheat (Triticum aestivum L.). Euphytica 93, 321–329.
Britikov EA, Schrauwen J, Linskens HF. 1970. Proline as a source of nitrogen in plant metabolism. Acta Botanica Neerlandica 19, 515–520.
Casas AM, Kononowicz AK, Zehr B, Tomes DT, Axtell JD, Butler LG, Bressan RA, Hasegawa PM. 1993. Transgenic sorghum plants via microprojectile bombardment. Proceedings of the National Academcy of Sciences, USA 90, 11212–11216.
Cheng M, Fry JE, Pang S, Zhou H, Hironaka CM, Duncan DR, Conner TW, Wan Y. Genetic transformation of wheat mediated by Agrobacterium tumefaciens. Plant Physiology 115, 971–980.
Christensen AH, Sharrock RA, Quail PH. 1992. Maize polyubiquitin genes: structure, thermal pertubation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Molecular Biology 18, 675–689.[Web of Science][Medline]
Fisher DB, Macnicol PK. 1986. Amino acid composition along the transport pathway during grain filling in wheat. Plant Physiology 82, 1019–1023.
Frame BR, Drayton PR, Bagnall SV, Lewnau CJ, Bullock WP, Wilson HM, Dunwell JM, Thompson JA, Wang K. 1994. Production of fertile transgenic maize plants by silicon carbide whisker-mediated transformation. The Plant Journal 6, 941–948.
Hensgens LAM, De Bakker EPHM, Van Os-Ruygrok EP, Rueb S, Van de Mark F, Van der Maas HM, Van der Veen S, Kooman-Gersmann M, Hart L, Schilperoort RA. 1999. Transient and stable expression of gusA fusions with rice genes in rice, barley and perennial ryegrass. Plant Molecular Biology 23, 643–669.
Hiei Y, Ohta S, Komari T, Kumashiro T. 1994. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T- DNA. The Plant Journal 6, 271–282.[Web of Science][Medline]
Huang C-N, Cornejo ML, Bush DS, Jones RL. 1986. Estimating viability of plant protoplasts using double and single staining. Protoplasma 135, 80–87.
Ishida Y, Saito H, Ohta S, Hiei Y, Komari T, Kumashiro T. 1996. High efficiency transformation of maize (Zea mays L.) mediated by Agrobacterium tumefaciens. Nature Biotechnology 14, 745–750.[Web of Science][Medline]
Jefferson RA, Kavanagh TA, Bevan MW. 1987. GUS fusion: ß-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO Journal 6, 3901–3907.[Web of Science][Medline]
Kaeppler HF, Somers DA, Rines HW, Cockburn AF. 1992. Silicon carbide fiber-mediated stable transformation of plant cells. Theoretical and Applied Genetics 84, 560–566.
Kausch AP, Adams TR, Mangano M, Zachwieja SJ, Gordon-Kamm W, Daines R, Willets NG, Chambers SA, Adams W, Anderson A, Williams G, Haines G. 1995. Effects of microprojectile bombardment on embryogenic suspension cell cultures of maize (Zea mays L) used for genetic transformation. Planta 196, 501–509.
McElroy D, Zhang W, Wu R. 1990. Isolation of an efficient actin promoter for use in rice transformation. The Plant Cell 2, 163–171.
Nagatani N, Honda H, Shimada T, Kobayashi T. 1997. DNA delivery into rice cells and transformation using silicon carbide whiskers. Biotechnology Techniques 11, 471–473.
Padgett PE, Leonard RT. 1996. Free amino acid levels and the regulation of nitrate uptake in maize cell suspension cultures. Journal of Experimental Botany 47, 871–883.
Rashid H, Yokoi S, Toriyama K, Hinata K. 1996. Transgenic plant production mediated by Agrobacterium in Indica rice. Plant Cell Reports 15, 727–730.
Russell JA, Roy MK, Sanford JC. 1992. Physical trauma and tungsten toxicity reduce the efficiency of biolistic transformation. Plant Physiology 98, 1050–1056.
Sakamoto A, Alia, Murata N. 1998. Metabolic engineering of rice leading to biosynthesis of glycinebetaine and tolerance to salt and cold. Plant Molecular Biology 38, 1011–1019.[Web of Science][Medline]
Tingay S, McElroy D, Kalla R, Fieg S, Wang M, Thorton S, Brettell R. 1997. Agrobacterium tumefaciens-mediated barley transformation. The Plant Journal 11, 1369–1376.
Toki S. 1997. Rapid and efficient Agrobacterium-mediated transformation in rice. Plant Molecular Biology Reporter 15, 16–21.
Tuvesson IKD, Pedersen S, Andersen SB.1989. Nuclear genes affecting albinism in wheat (Triticum aestivum L.) anther culture. Theoretical and Applied Genetics 78, 879–883.
Vasil V, Redway F, Vasil IK. 1990. Regeneration of plants from embryogenic suspension culture protoplasts of wheat (Triticum aestivum L.). Bio/Technology 8, 429–433.
Walters DA, Vetsch CS, Potts DE, Lundquist RC.1992. Transformation and inheritance of a hygromycin phosphotransferase gene in maize plants. Plant Molecular Biology 18, 189–200.[Web of Science][Medline]
Wan Y, Lemaux P. 1994. Generation of large numbers of independently transformed fertile barley plants. Plant Physiology 104, 37–48.[Abstract]
Wang X, Hu H. 1984. The effect of potato II medium for triticale anther culture. Plant Science Letters 36, 237–239.
Wang ZY, Takamizo T, Iglesias VA, Osusky M, Nagel J, Potrykus I, Spangenberg G. Transgenic plants of tall fescue (Festuca arundinacea Schreb.) obtained by direct gene transfer to protoplasts. Bio/Technology 10, 691–696.
Weeks JT, Anderson OD, Blechl AE. 1993. Rapid production of multiple independent lines of fertile transgenic wheat (Triticum aestivum). Plant Physiology 102, 1077–1084.[Abstract]
Wu H, McCormac AC, Elliot MC, Chen D-F. 1998. Agrobacterium-mediated stable transformation of cell suspension cultures of barley (Hordeum vulgare). Plant Cell, Tissue and& Organ Culture 54, 161–171.
Yang YM, He DG, Scott KJ. 1991. Establishment of embryogenic suspension cultures of wheat by continuous callus selection. Australian Journal of Plant Physiology 18, 445–452.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||