Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Burnett, E. C.
Right arrow Articles by Neill, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burnett, E. C.
Right arrow Articles by Neill, S. J.
Agricola
Right arrow Articles by Burnett, E. C.
Right arrow Articles by Neill, S. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of Experimental Botany, Vol. 51, No. 343, pp. 197-205, February 2000
© 2000 Oxford University Press

ABA activation of an MBP kinase in Pisum sativum epidermal peels correlates with stomatal responses to ABA

Edward C. Burnett, Radhika Desikan, Rosita C. Moser and Steven J. Neill1

Department of Biological and Biomedical Sciences, University of the West of England (UWE), Bristol, Coldharbour Lane, Bristol BS16 1QY, UK

Received 19 April 1999; Accepted 6 October 1999


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In-gel protein kinase assays using myelin basic protein (MBP) as substrate have been used to demonstrate that abscisic acid (ABA) activates an MBP kinase (AMBP kinase) in epidermal peels prepared from leaves of the Argenteum mutant of pea, Pisum sativum L. AMBP kinase has the characteristics of a mitogen-activated protein kinase (MAPK): it utilizes MBP preferentially as an artificial substrate, it is rapidly and transiently activated, it is of the appropriate size (molecular weight c. 45 kDa), requires tyrosine phosphorylation for activity and is tyrosine phosphorylated upon activation. Reverse transcription-PCR was used to generate a previously-cloned MAPK from guard cells, epidermis and mesophyll and immunoblotting using an antibody raised against a mammalian MAPK detected MAPK-related proteins, including one of 45 kDa, in epidermal peels, mesophyll and guard cells. Inhibition of AMBP kinase activation by PD98059, a specific inhibitor of MAPK kinase, and thus MAPK activation, correlated with PD98059-inhibition of ABA-induced stomatal closure and dehydrin gene expression, suggesting that ABA effects in pea epidermal peels require MAPK activation. AMBP kinase was not activated by ABA in guard cells isolated by enzyme treatment. However, a protein kinase of c. 43 kDa was activated by ABA in isolated guard cells, but not in mesophyll or epidermal tissue.

Key words: Abscisic acid, ABA, guard cells, mitogen activated protein kinases, MAPKs, PD98059, tyrosine phosphorylation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The hormone abscisic acid (ABA) induces a myriad of cellular responses in plants via complex signal transduction cascades, leading to tolerance towards various stresses, including cold, drought and salinity (Leung and Giraudat, 1998Go). Stomatal guard cells represent specific target cells for ABA with well-characterized membrane responses as well as nuclear ones involving gene expression (Leung and Giraudat, 1998Go). Reversible protein phosphorylation is a central process regulating ABA-induced stomatal responses (Esser et al., 1997Go), and specific protein kinases have been shown to be activated by ABA in Vicia faba guard cell protoplasts (Li and Assman, 1996Go; Mori and Muto, 1997Go).

Mitogen-activated protein kinase (MAPK)-based signalling cascades are ubiquitous components of all eukaryotic cells (Hirt, 1997Go; Mizoguchi et al., 1997Go). MAPKs are serine/threonine protein kinases that phosphorylate a range of substrates to activate various cellular responses, including gene expression and membrane transport, in different cells (Cohen, 1997Go; Hirt, 1997Go). MAPKs are themselves activated via dual phosphorylation on threonine and tyrosine residues by MAPK kinases (MAPKKs) which in turn are activated via phosphorylation by MAPKK kinases (MAPKKKs). A large number of these enzymes have already been identified in plants and it seems very likely that they transduce responses to many external signals, including plant hormones (Hirt, 1997Go; Mizoguchi et al., 1997Go).

Using epidermal peels from the Argenteum mutant of Pisum sativum, previous work in this laboratory has shown that protein phosphorylation and dephosphorylation are necessary events for ABA-induced stomatal closure and dehydrin gene expression (Hey et al., 1997Go). This report provides evidence that ABA activates a MAPK-like enzyme in pea epidermal peels, and that epidermis and guard cells contain both mRNA and protein corresponding to a previously isolated pea gene encoding a potential MAPK. In addition, data are presented to correlate activation and inhibition of the ABA-activated epidermal MAPK with stomatal responses to ABA.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Preparation of plant material
Epidermal peels, mesophyll tissue and isolated guard cells were prepared from leaves of the Argenteum mutant of pea, Pisum sativum L., and treated with ABA as described previously (Hey et al., 1997Go). PD98059 (Calbiochem-Novabiochem, Nottingham, UK) was made up as a stock solution (1.8x10-2 M) in dimethylsulphoxide (DMSO) before addition to incubation solutions. Controls contained equivalent amounts of DMSO.

Stomatal assays
Stomatal opening and closing was monitored as described previously (Hey et al., 1997Go). Measurements of stomatal aperture, following opening or closing in response to various treatments, were made by analysis of unstained epidermal strips, with a light microscope under bright-field illumination. Stomatal apertures were compared with an eyepiece graticule which was calibrated with a 100x10 µm slide micrometer scale. Experiments were repeated several times on different occasions with different plants. Cell viability was assessed by staining with fluorescein diacetate (Hey et al., 1997Go).

To monitor stomatal opening, epidermal strips were prepared from the underside of fully expanded leaves of mature plants which had been kept in the dark overnight. Several leaves were peeled and the epidermal strips pooled in MES buffer (0.01 M MES-KOH, pH 6.15; 0.05 M KCl). The strips were then removed to one of a range of treatment solutions in Petri dishes. The stomata were induced to open by incubation in bright light (c. 300 µmol m-2 s-1 PAR) for 2 h, beyond which time no further changes in stomatal aperture could be detected. The apertures of ten randomly chosen stomata were measured on five epidermal peels and the mean stomatal apertures calculated. To monitor stomatal closure, stomata were firstly opened fully by floating epidermal strips on MES buffer in the light (as above). Stomata were taken to be fully open when stomatal apertures no longer increased under these conditions. Once the stomata were fully open, the epidermal strips were transferred to one of a range of incubation solutions in Petri dishes and incubated in the light for 2 h. After this time no further changes in stomatal apertures could be detected and the final stomatal apertures were recorded.

RNA blot analysis
Total RNA was isolated from treated epidermal peels and subjected to RNA blot analysis using a [{alpha}-32P]-labelled dehydrin cDNA probe as described previously (Hey et al., 1997Go). Equivalent RNA loadings were monitored by UV analysis and ethidium bromide staining of gels. Blots were stripped and rehybridized with a labelled probe representing a membrane intrinsic protein (MIP) constitutively expressed in guard cells (EC Burnett and SJ Neill, unpublished data).

Reverse transcription-PCR (RT-PCR) and cloning
Messenger RNA was isolated from guard cells and mesophyll tissue as described previously (Hey et al., 1997Go) and used as a template for RT-PCR. Primers for the PCR were designed against specific sequences in the pea MAPK cDNA D5/PsMAPK (Stafstrom et al., 1993Go; Popping et al., 1996Go) and used to generate the predicted 720 bp fragment: sense primer (5' CGTGAAATCAAGCTCGTTCGCC 3') and antisense primer (5' CAAGTAAGGGTGTGCCAGTGCA 3'). Reverse transcription was performed by incubating 20 µl reactions containing 1 µg RNA, 1xfirst strand buffer (GibcoBRL, Paisley, UK), 0.5 µg random primers (Promega, Southampton, UK), 2.5 mM each of dATP, dCTP, dGTP, and dTTP (Pharmacia, St Albans, UK), 10 mM DTT, 20 units of RNasin (Promega) and 200 units of SuperScript II reverse transcriptase (GibcoBRL) at 42 °C for 40 min. PCR conditions were as follows: 1 cycle at 94 °C, 3 min, followed by 35 cycles at 94 °C for 45 s denaturing temperature, 55 °C for 1 min annealing temperature and 72 °C for 1 min extension temperature, followed by an additional 1 cycle at 72 °C for 5 min. Each PCR reaction (50 µl) contained 1xPCR buffer (10 mM TRIS-HCl, pH 8.8, 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100), 0.1 mM each of dATP, dCTP, dGTP, and dTTP, 2 units of Dynazyme II DNA polymerase (Flowgen, Lichfield, UK) and 200 pmol each sense and antisense primer. Negative controls used equivalent amounts of RNA not subjected to reverse transcription.

PCR products were separated by agarose electrophoresis and purified using a Qiaex II kit (Qiagen Ltd, West Sussex, UK). One µl of the resuspended DNA was used to clone the PCR products into the linearized vector pCRII (Invitrogen, San Diego, USA). Cloned fragments were sequenced by PCR-cycle sequencing (Perkin-Elmer, New Jersey, USA).

Protein extraction
Epidermal peels, mesophyll tissue and isolated guard cells were incubated with buffer or ABA at the indicated concentrations and times, and frozen in liquid nitrogen. Frozen material was ground with a mortar and pestle under liquid nitrogen, followed by homogenization at 4 °C with 2 vols of protein extraction buffer (100 mM HEPES, pH 7.5, 5 mM EDTA, 5 mM EGTA, 10 mM DTT, 10 mM Na3VO4, 10 mM NaF, 50 mM {alpha}-glycerophosphate, 1 mM PMSF, 5 µg ml-1 aprotinin, and 5 µg ml-1 leupeptin). The ground slurry was then centrifuged in a microcentrifuge (13 000 rpm, 20 min, 4 °C). Aliquots of the supernatants were put into clean tubes, snap frozen in liquid nitrogen and stored at -80 °C for later use. Protein concentrations were estimated using the Bradford assay (Bradford, 1976Go).

In-gel protein kinase assays
Three µg of protein extracts were electrophoresed on 10% SDS-polyacrylamide gels embedded with either 0.5 mg ml-1 myelin basic protein (MBP from bovine brain; Sigma, Poole, UK), dephosphorylated casein (1 mg ml-1; Sigma) or histone (1 mg ml-1; type III S-S, Sigma) in the resolving gel as substrates for the kinase. Pre-stained molecular weight markers (New England Biolabs, Herts, UK) were used as standards. After electrophoresis at 100 V for 2 h, SDS was removed from the gel by washing the gel with 100 ml of washing buffer (25 mM TRIS-HCl, pH 7.5, 0.5 mM DTT, 0.1 mM Na3VO4, 5 mM NaF, 0.5 mg ml-1 BSA, and 0.1% Triton X-100) three times for 30 min each at room temperature with gentle shaking. The proteins were then denatured by incubating the gel in 100 ml of denaturation buffer (6 M guanidine-HCl, 50 mM TRIS-HCl, pH 8, 5 mM 2-mercaptoethanol) for 1 h at room temperature. Proteins were subsequently renatured overnight at 4 °C in 200 ml of renaturation buffer (25 mM TRIS-HCl, pH 8, 1 mM DTT, 0.1 mM Na3VO4, and 5 mM NaF) with at least three changes of the buffer. The gel was then incubated at room temperature in 30 ml of reaction buffer (25 mM TRIS-HCl, pH 8, 2 mM EGTA, 12 mM MgCl2, 1 mM DTT, and 0.1 mM Na3VO4) for 30 min. Phosphorylation was performed for 1 h at room temperature in 15 ml of the same reaction buffer supplemented with 50 µM ATP (Sigma, UK) and 50 µCi [{gamma}-32P] ATP (specific activity: 3000 Ci mmol-1; Amersham, Little Chalfont, UK). Unincorporated radioactivity was subsequently removed by washing the gel for 5–6 h at room temperature with several changes of 5% (w/v) trichloroacetic acid and 1% (w/v) sodium pyrophosphate. The gel was dried onto Whatman 3MM paper and subjected to autoradiography.

In vitro treatment of protein extracts with protein tyrosine phosphatase
For protein tyrosine phosphatase treatment, 3 µg of protein extracts from ABA-treated epidermal peels were isolated as described above and incubated with 5U of protein tyrosine phosphatase ß (Upstate Biotechnology Inc., NY, USA) in phosphatase buffer (25 mM HEPES, pH 7.2, 50 mM NaCl, 5 mM DTT, 2.5 mM EDTA, and 100 µg ml-1 BSA) at 30 °C for 30 min. The samples were subsequently denatured and in-gel assays performed as described above.

Immunoprecipitation and in vitro kinase activity assay
Ten µg of protein extracts were incubated with shaking for 2 h at 4 °C with 5 µg of anti-phosphotyrosine monoclonal antibody 4G10 (Upstate Biotechnology Inc., USA) in immunoprecipitation buffer (20 mM TRIS, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM Na3VO4, 1 mM NaF, 10 mM {alpha}-glycerophosphate, 5 µg ml-1 aprotinin, 5 µg ml-1 leupeptin, 1 mM PMSF, and 0.5% Triton-X 100). About 30 µl packed volume of protein G sepharose (Sigma, UK) was added and incubated for a further 2 h. The sepharose bead–protein complexes were pelleted by gentle centrifugation (1000 rpm), and subsequently washed twice in wash buffer (20 mM TRIS, pH 7.5, 5 mM EDTA, 100 mM NaCl, 1% Triton-X 100) and once in kinase assay buffer (25 mM TRIS, pH 7.5, 5 mM MgCl2, 1 mM EGTA, 1 mM DTT, 0.1 mM Na3VO4). Following washing, in vitro kinase activity assay of the immunoprecipitated proteins was perfomed in 15 µl of kinase buffer containing 0.5 mg ml-1 MBP, 2 µCi [{gamma}-32P] ATP, and 0.1 mM ATP at room temperature for 30 min. The reaction was stopped by the addition of SDS sample loading buffer; the samples were then denatured and electrophoresed on a 15% SDS-polyacrylamide gel. The gel was subsequently stained in Coomassie Blue to confirm equal protein loading, destained in 14% methanol, 10% acetic acid, and then dried and subjected to autoradiography.

Western analysis
Crude protein extracts from epidermal peels, mesophyll tissue or isolated guard cells treated with or without ABA were isolated as described above, fractionated by SDS-PAGE and transferred to nitrocellulose as described previously (Desikan et al., 1996Go). Membranes were hybridized with an anti-ERK1 antibody (Santa Cruz Biotechnology, California, USA) and hybridization detected using an ECL Western blotting detection kit (Amersham, UK).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
ABA induces the activation of an MBP kinase in epidermal peels
To determine the presence of MAP kinases in epidermal peels, in-gel assays were performed on protein extracts from epidermal peels treated with ABA, using myelin basic protein (MBP) as a substrate. Treatment with ABA at 10-4 M resulted in the rapid and transient activation of a protein kinase of c. 45 kDa (Fig. 1Go). This kinase was activated rapidly within 2 min of treatment with ABA; activation occurred maximally between 5–10 min, and decreased within 30 min. Control treatments with buffer alone had no effect on the activation of this kinase (Fig. 1). In-gel assays performed using either no substrate, or casein and histone as substrates, demonstrated that this ABA-activated kinase possessed no significant auto-, casein-, or histone-phosphorylating activity (data not shown).



View larger version (84K):
[in this window]
[in a new window]
 
Fig. 1 ABA activates an MBP kinase in epidermal peels of pea. Epidermal peels were incubated in buffer (C; 5 min) or 10-4 M ABA for 2–30 min, proteins extracted and protein kinase activity analysed via in-gel assay with MBP as artificial substrate. Molecular weight markers (in kDa) are indicated on the left. Experiments were repeated twice; representative data from one experiment are shown.

 
To demonstrate the dose-dependency for ABA-induced activation of this MBP kinase (subsequently termed AMBP kinase), epidermal peels were treated with increasing concentrations of ABA (10-6 M to 10-4 M) for 5 min, and protein extracts subjected to in-gel kinase assay. The data in Fig. 2Go show that at 10-6 M ABA induced a slight increase, and at 10-5 M and 10-4 M, greater increases in the activation of AMBP kinase.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 2. Dose-response for ABA activation of AMBP kinase. Epidermal peels were incubated for 5 min in various concentrations of ABA prior to protein extraction and in-gel assay. C=control (buffer). Molecular weight markers (in kDa) are indicated on the left. Experiments were repeated twice; representative data from one experiment are shown.

 

Epidermal peels contain proteins immunologically related to MAP kinases
To demonstrate the presence of MAPK-related proteins, and to determine whether ABA altered the amount of such proteins, protein extracts from epidermal peels incubated in buffer or 10-4 M ABA for 5 min were subjected to Western analysis (Fig. 3Go), using an anti-ERK1 antibody previously shown to react with plant MAPKs (Knetsch et al., 1996Go; Wilson et al., 1998Go). The antibody recognized three proteins of c. 45, 49 and 51 kDa in both control-treated and ABA-treated epidermal peels. This result demonstrated that treatment with ABA did not alter the levels of anti-ERK1-reactive proteins in epidermal peels.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 3. Epidermal peels contain MAPK-like proteins. Proteins were extracted from buffer (control)- and ABA-treated epidermal peels and immunoblotted with an anti-ERK1 antibody. Molecular weights (in kDa) are indicated on the left. Experiments were repeated at least three times; representative data from one experiment are shown.

 

AMBP kinase is tyrosine phosphorylated
An important characteristic of MAPKs which distinguishes them from other protein kinases is that their activation is dependent upon tyrosine phosphorylation. To investigate the possibility that AMBP kinase requires tyrosine phosphorylation for its activity, protein extracts from epidermal peels treated with ABA were incubated with protein tyrosine phosphatase prior to in-gel kinase assay. Such treatment reduced the MBP phosphorylating activity of AMBP kinase (Fig. 4AGo; c. 50% reduction as determined by scanning densitometry). To demonstrate directly that AMBP kinase is tyrosine phosphorylated during activation, protein extracts from treated epidermal peels were immunoprecipitated with the specific anti-phosphotyrosine monoclonal antibody 4G10, which has been used by other workers to identify MAPKs in plants (Zhang and Klessig, 1997Go). The resulting immunocomplexes were then assayed for in vitro kinase activity by using MBP and {gamma}-32P-ATP as substrates, and subsequently analysing the phosphorylated MBP using SDS-PAGE. As shown in Fig. 4B, treatment with ABA resulted in an increase in immunoprecipitated tyrosine phosphorylated-MBP kinase activity, compared to control treatments with buffer alone.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4 AMBP kinase requires tyrosine phosphorylation for activity and is tyrosine phosphorylated during activation. (A) Extracts were analysed via in-gel assay with MBP as substrate. 1, control (buffer); 2, 10-4 M ABA, 5 min; 3, 10-4 M ABA, 5 min, extract treated with protein tyrosine phosphatase prior to in-gel assay. (B) Extracts were immunoprecipitated with the anti-phosphotyrosine antibody, 4G10, prior to in vitro MBP kinase assay. 1, control (buffer); 2, 10-4 M ABA, 5 min; 3, 10 min pre-treatment with 10-4 M PD98059 then 10-4 M ABA, 5 min. Experiments were repeated twice; representative data from one experiment are shown.

 
A novel approach was used to investigate further whether AMBP kinase might be related to a MAP kinase, by assessing the effects of a highly specific inhibitor of mammalian MAPKK (and therefore MAPK) activation, PD98059 (Cohen, 1997Go), on ABA-induced MBP kinase activation. Epidermal peels were pre-treated with PD98059 (10-4 M for 10 min), followed by treatment with ABA for 5 min. Protein extracts from these treatments were then subjected to immunoprecipitation using 4G10 followed by in vitro MBP kinase assay, as described above. Pre-treatment of epidermal peels with PD98059 substantially reduced the activation of AMBP kinase, as determined by 4G10-immunoprecipitation and MBP kinase assay, compared to ABA treatment alone (Fig. 4B). To demonstrate that PD98059 had no effect on the activity of AMBP kinase, as opposed to its activation, protein extracts from ABA-treated epidermal peels were fractionated on MBP-embedded gels and the gels subsequently incubated in PD98059 (10-4 M) prior to kinase assay. These experiments revealed that PD98059 had no effect on the activity of AMBP kinase; control treatments using the general serine/threonine protein kinase inhibitor K-252a completely abolished its activity (data not shown).

Effects of an inhibitor of MAPK activation on ABA-induced changes in stomatal aperture
Previous work has shown that ABA-induced stomatal closure and inhibition of opening are mediated via protein phosphorylation (Hey et al., 1997Go). To investigate any role for MAPKs in ABA-induced stomatal movements, the effects of the MAPKK inhibitor, PD98059, were determined. Incubation of epidermal peels in 10-4 M ABA prevented opening of pre-closed stomata following illumination and resulted in the closure of stomata previously opened in the light (Fig. 5A, BGo). Treatment with 10-4 M PD98059 substantially inhibited both ABA-inhibition of opening and ABA-induced closure (Fig. 5A, B). The effects of PD98059 were also ABA-specific, in that incubation in PD98059 alone did not retard light-induced opening, induce stomatal closure (Fig. 5A, B) or inhibit dark-induced closure (data not shown). The concentration of PD98059 used in these experiments did not affect the viability of guard cells and other epidermal cells (data not shown).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5. PD98059 inhibits ABA-inhibition of stomatal opening and induction of stomatal closure in epidermal peels of P. sativum Argenteum. Pre-closed stomata were allowed to open for 2 h in the light (A) or pre-opened stomata induced to close for 2 h (B). (A) Dark, buffer only (B); light, buffer only (L); light+10-4 M PD98059 (L+PD); light+10-4 M ABA (L+A); light+ABA+PD98059 (L+A+PD). (B) Buffer only (B); buffer+PD98059 (B+PD); buffer+ABA (B+A); buffer+ABA+PD98059 (B+A+PD). Data represent the mean±SE of 50 measurements from a single representative experiment (repeated four times).

 

ABA-induced dehydrin gene expression is inhibited by an inhibitor of MAPK activation
Previous work has also shown that ABA induces the accumulation of dehydrin mRNA in epidermal peels, and that this effect requires protein phosphorylation (Hey et al., 1997Go). Consequently, the effects of PD98059 on ABA-induced dehydrin mRNA accumulation were assessed (Fig. 6Go). At the lower concentrations, PD98059 had little effect, but incubation in 10-4 M PD98059 dramatically reduced ABA-induced dehydrin gene expression (Fig. 6). To confirm that the effects of PD98059 on ABA-induced dehydrin gene expression were specific, the blot was rehybridized with a clone representing a constitutively expressed non-ABA-regulated major intrinsic protein (MIP; EC Burnett and SJ Neill, unpublished results): PD98059 had no effect on the expression of this gene (Fig. 6).



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 6. PD98059 inhibits ABA-induced dehydrin mRNA accumulation in epidermal peels. Isolated epidermis was extracted immediately (frozen), or incubated for 30 min in buffer+DMSO (buffer); 10-5 M ABA or 10-5 M ABA+PD98059 at increasing concentrations (10-7 to 10-4 M). Extracted RNA was hybridized to a 32P-labelled dehydrin cDNA probe (DEH) and the blots then stripped and re-probed with a non-ABA-regulated clone (MIP). Experiments were repeated twice; representative data from one experiment are shown.

 

Pea epidermal peels, mesophyll tissue and guard cells express a MAPK gene, and contain proteins immunologically related to MAPKs
A gene encoding a potential MAPK, D5/PsMAPK, has previously been cloned from axillary buds of pea (Strafstrom et al., 1993). To establish that pea leaf cells also express this gene, RT-PCR with primers designed against PsMAPK sequence was used to clone PsMAPK from isolated guard cells and mesophyll tissue. Messenger RNA from both tissues was used as the template and in both cases generated a 720 bp PCR product; negative controls with no template or with the RT step omitted gave no PCR products (data not shown). These two PCR products were cloned and sequenced to confirm 100% homology to the published D5/PsMAPK sequence. RT-PCR on RNA isolated from epidermal peels also generated the 720 bp product.

It has also been reported that the D5 protein (predicted molecular weight c. 45kDa) was recognized by antibodies raised against the ERK class of mammalian MAPKs (Strafstrom et al., 1993), which would be in agreement with the in-gel MBP kinase and Western data in Figs 1, 2 and 3, which provide evidence for an ABA-activated MAPK with a molecular weight of c. 45 kDa. Western analysis using the anti-ERK1 antibody was repeated on protein extracts from mesophyll and isolated guard cells as well as on extracts from epidermal peels (Fig. 7Go). Mesophyll extracts contained the same three proteins, at molecular weights of c. 45, 49 and 51 kDa, as did epidermal extracts. However, the guard cell extract appeared to be missing the 49 kDa band, and in addition there was an extra, weak band at c. 43 kDa (Fig. 7Go). The two lower molecular weight bands apparent in guard cell extracts were also visible in epidermal and mesophyll extracts after longer exposure times (data not shown).



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 7. Pea leaf cells contain MAPK-like proteins. Protein extracts from epidermal peels (E), mesophyll tissue (M) and isolated guard cells (G) were immunoblotted with an anti-ERK1 antibody. Molecular weights (in kDa) are indicated on the right. Experiments were repeated twice; representative data from one experiment are shown.

 

ABA activates a 45 kDa MBP kinase in mesophyll cells and epidermal peels but not in isolated guard cells
Because RT-PCR generated PsMAPK from guard cells and mesophyll cells, and immunoprobing with the anti-ERK antibody detected a 45 kDa protein in all extracts, in-gel MBP kinase assays were performed on protein extracts from mesophyll and isolated guard cells (Fig. 8Go). ABA clearly activated an MBP kinase in mesophyll cells with the same molecular weight (c. 45 kDa) as AMBP kinase in epidermal peels; this kinase was not activated in isolated guard cells. However, another MBP kinase, with a molecular weight of c. 43 kDa, potentially corresponding to the extra 43 kDa band immunodetected in guard cell extracts (Fig. 7), was activated by ABA in guard cells. Careful inspection of autoradiographs of in-gel MBP-kinase assays of epidermal peel extracts revealed that this 43 kDa activity was also present, but at lower levels than the 45 kDa band. To assess whether this 43 kDa kinase had any characteristics of MAP kinases similar to AMBP kinase, guard cell extracts were subjected to 4G10 immunoprecipitation followed by in vitro MBP kinase assay (Fig. 9Go). Although some activity was precipitated by 4G10, there was no increase after ABA treatment, in contrast to the mesophyll extract, suggesting that although this 43 kDa kinase can utilize MBP as a substrate, it is not tyrosine phosphorylated and unlikely, therefore, to be a MAP kinase.



View larger version (77K):
[in this window]
[in a new window]
 
Fig. 8. ABA activates AMBP kinase in epidermal peels and mesophyll but not in isolated guard cells. Protein extracts from cells incubated for 5 min in buffer or 10-4 M ABA were analysed via in-gel assay with MBP as substrate. Molecular weights (in kDa) are indicated on the left. Experiments were repeated twice; representative data from one experiment are shown.

 


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 9. The ABA-activated MBP kinase in mesophyll cells but not guard cells is tyrosine phosphorylated. Protein extracts from buffer- or ABA-treated tissues were immunoprecipitated with the anti-phosphotyrosine antibody 4G10 and then analysed using an in vitro MBP kinase assay. Experiments were repeated twice; representative data from one experiment are shown.

 


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In recent years numerous studies have reported the involvement of MAPKs in plant responses to various stresses (Hirt, 1997Go; Mizoguchi et al., 1997Go). However, considering the large number of plant MAPKs that have now been cloned (Kultz, 1998Go), there is only limited data demonstrating the effects of hormones, in particular ABA, on MAPK activation. The activation of a MAPK enzyme by auxin in tobacco suspension cultures was described (Mizoguchi et al., 1994Go), and recent work has demonstrated that a specific MAPK cascade can actually suppress auxin effects on gene expression (Kovtun et al., 1998Go). It was found that gibberellin regulated the expression of a MAPK homologue in oat aleurone (Huttly and Phillips, 1995Go), although no effect of GA3 on MAPK activity in aleurone cells from barley were observed (Knetsch et al., 1996Go). On the other hand, these authors did report that in this tissue ABA induces rapid activation of a MAPK related to mammalian MAPKs, and that such activation was correlated with ABA-induced RAB16 gene expression (Knetsch et al., 1996Go).

The data in this report demonstrate that ABA induces the rapid and transient activation of an MBP-kinase, AMBP kinase, in epidermal peels prepared from pea leaves, at concentrations within the physiological range at which ABA induces membrane and nuclear responses, and at which ABA is found in epidermal tissues (Hey et al., 1997Go). AMBP kinase possesses those characteristics that would be expected of a MAP kinase: it utilizes MBP preferentially as an artificial substrate, is of the appropriate molecular weight (c. 45 kDa) for known MAPKs (Kultz, 1998Go), it is rapidly and transiently activated, it is tyrosine phosphorylated during activation and appears to require such tyrosine phosphorylation for its catalytic activity.

The molecular identity of AMBP kinase remains to be determined. However, a MAPK gene, D5/PsMAPK, has previously been cloned from pea axillary buds (Stafstrom et al., 1993Go). RT-PCR was used to clone this gene from guard cells and mesophyll cells. Recombinant D5 has a molecular weight of c. 45 kDa and is recognized by antibodies raised against mammalian ERKs (Stafstrom et al., 1993Go). Pea leaf cells contain several proteins that are similarly recognized by an anti-ERK1 antibody that has previously been shown to recognize an ABA-activated MAPK, and other proteins, in barley aleurone (Knetsch et al., 1996Go). One of these, present in extracts from isolated guard cells, epidermal peels and mesophyll tissue, has a molecular weight of c. 45 kDa, the same size as AMBP kinase and D5/PsMAPK. It is possible, therefore, that AMBP kinase is D5/PsMAPK. However, based on immunological data presented in this report with the anti-ERK antibody, and molecular studies with Arabidopsis thaliana (Mizoguchi et al., 1997Go), it is likely that pea cells contain several related MAPK enzymes, and unequivocal identification will require the use of specific antibodies recognizing only the D5/PsMAPK protein. From inhibitor work with several species, including pea (Hey et al., 1997Go), it is clear that ABA effects on stomata are mediated by a number of protein kinases. It was independently demonstrated that ABA activates a 48 kDa protein kinase in V. faba guard cell protoplasts (Li and Assman, 1996Go; Mori and Muto, 1997Go). The AMBP kinase characterized in the present work is unlikely to be related to the V. faba ABA-activated protein kinase as both studies provided evidence that this latter kinase was not a MAPK. Moreover, it is possible that the activities characterized (Li and Assman, 1996Go; Mori and Muto, 1997Go) actually represent different protein kinases despite their apparent similarity, as there are a number of differences in the properties reported in the two studies. In fact, Mori and Muto also detected several MBP kinases in V. faba guard cell protoplasts (Mori and Muto, 1997Go), and presented some data suggesting that both a 46 and 49 kDa MBP kinase might represent MAPKs; it is possible, therefore, that these are related to AMBP kinase.

A functional role has not yet been ascribed to PsMAPK. However, PsMAPK could partially complement the hog1 mutant of yeast (Popping et al., 1996Go); HOG1 is a yeast MAPK activated during the glycerol response to osmotic stress (Waskiewicz and Cooper, 1995Go). Furthermore, induction and activation of a tobacco pollen MAPK, p45Ntf4, which has >90% homology with PsMAPK, are sensitive to the hydration status of the tissue (Wilson et al., 1997Go). In pea epidermal tissue, AMBP kinase activity is induced rapidly by ABA, with kinetics consistent with a role in the mediation of ABA effects on stomatal movements. A novel and highly specific inhibitor of MAPKK, and therefore MAPK, activation, PD98059, which has already made a substantial contibution to defining physiological roles for mammalian MAPKs (Cohen, 1997Go), was used to probe the physiological functions of AMBP kinase in pea epidermis. In mammalian cells, the effects of PD98059 are highly specific, in that it binds to, and thus prevents the activation of, the non-phosphorylated form of a sub-set of MAPKKs that normally phosphorylate, and thereby activate, the MAPK/ERK sub-set of MAPKs (Alessi et al., 1995Go). Given the high degree of evolutionary conservation of MAPK-based signalling cascades (Kultz, 1998Go), including MAPKKs (Jouannic et al., 1996Go; Mizoguchi et al., 1997Go; Morris et al., 199Go7), amongst eukaryotic cells, it is possible that PD98059 has similar effects in plant cells. The data presented here suggest that PD98059 inhibited ABA-induced activation of AMBP kinase by inhibiting its tyrosine phosphorylation (Fig. 4). It did not inhibit directly the tyrosine phosphorylated, active form of AMBP kinase, unlike the general serine/threonine kinase inhibitor K-252a. These observations are in accordance with the mode of action of PD98059 in mammalian cells (Alessi et al., 1995Go). PD98059 specifically inhibited ABA responses: it reduced ABA effects on stomatal closure and inhibition of stomatal opening, whilst having no effect on light- and dark-regulated stomatal movements (Fig. 5). In addition, at 10-4 M PD98059 inhibited ABA-induced accumulation of dehydrin mRNA, whilst having no effect on the transcription of a non-ABA-regulated MIP gene (Fig. 6). Such correlation between the biochemical and physiological and molecular effects of ABA suggests that activation of a MAPK cascade is involved in mediating ABA effects in epidermal peels. That ABA responses are not completely inhibited by PD98059 would be consistent with redundancy in ABA signalling, in that ABA activates more than one intracellular signalling pathway.

When isolated guard cells were challenged with ABA, the 45 kDa AMBP kinase was not activated, although activation was clearly evident in epidermal peels and mesophyll cells (Fig. 8). These data can be interpreted in several ways. One suggestion might be that the abundance of AMBP kinase in guard cell extracts is too low to permit detection by in-gel assay: unequivocal identification of the 45 kDa protein reactive with the anti-ERK antibody will, as stated previously, require the use of antibodies that detect only PsMAPK. Another might be that the enzyme treatment used to isolate guard cells affects them in some way, for example by activating tyrosine phosphatases, such that AMBP kinase activity in guard cell extracts is reduced below the level of detection. Alternatively, it may be that AMBP kinase is active in epidermal cells and mesophyll tissue, but not in guard cells. If so, this would imply that either stomatal movements in some way require AMBP kinase activation in epidermal cells, for example, histochemical staining demonstrates that potassium ions accumulate in and dissipate from non-guard cell epidermal cells during stomatal closing and opening (EC Burnett and SJ Neill, unpublished results), or that the effects of PD98059 on ABA-induced AMBP kinase activation and stomatal closure are entirely coincidental.

Although AMBP kinase is not activated in isolated guard cells, an MBP kinase of c. 43 kDa was clearly present and its activity was increased by ABA (Fig. 8). This kinase has not been characterized in detail but, although it phosphorylates MBP in vitro, its activation was not clearly associated with tyrosine phosphorylation (Fig. 9), and it is unlikely, therefore, to be a MAP kinase. On the other hand, it may be related to the ABA-activated guard cell protein kinase(s) characterized in V. faba guard cell protoplasts (Li and Assman, 1996Go; Mori and Muto, 1997Go). The 43 kDa kinase was detectable in epidermal extracts (epidermal peels contain guard cells), although it was considerably less active than AMBP kinase, and may well be guard cell-specific, corresponding to the 43 kDa protein recognized by the anti-ERK antibody only in extracts of isolated guard cells (Fig. 6). Using RT-PCR, several different PCR products from guard cells that are related to protein kinases have been generated (EC Burnett and SJ Neill, unpublished results); analysis of full-length clones may facilitate identification of the ABA-activated guard cell kinase. Elucidation of the physiological roles of AMBP kinase and other guard cell kinases will not be a simple task. Transgenic plants in which expression of such kinases is specifically altered in guard cells, and generation of antibodies directed specifically against activated and non-activated forms of these kinases combined with in situ immunochemistry may help to address this issue.


    Notes
 
1 To whom correspondence should be addressed. Fax: +44 117 9763871. E-mail:Steven.Neill{at}uwe.ac.uk Back


    Abbreviations
 
ABA, abscisic acid; DMSO, dimethylsulphoxide; ERK extracellular signal-regulated protein kinase; MAPK, mitogen-activated protein kinase; MAPKK, MAPK kinase; MBP kinase, myelin basic protein kinase; membrane intrinsic protein; RT-PCR, reverse transcription-polymerase chain reaction.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Alessi DR, Cuenda A, Cohen P, Dudley DT, Saltiel AR. 1995. PD098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. Journal of Biological Chemistry 270, 27489–27494.[Abstract/Free Full Text]

Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Analytical Biochemistry 72, 248–254.[Web of Science][Medline]

Cohen P. 1997. The search for physiological substrates of MAP and SAP kinases in mammalian cells. Trends in Cell Biology 7, 353–361.

Desikan R, Coffey M, Hancock JT, Neill SJ. 1996. Generation of active oxygen in elicited cells of Arabidopsis thaliana is mediated by a NADPH oxidase-like enzyme. FEBS Letters 382, 213–217.[Web of Science][Medline]

Esser JE, Liao Y-J, Schroeder JI. 1997. Characterisation of ion channel modulator effects on ABA- and malate-induced stomatal movements: strong regulation by kinase and phosphatase inhibitors, and relative insensitivity to mastoparans. Journal of Experimental Botany 48, 539–550.

Hey SJ, Bacon A, Burnett E, Neill SJ. 1997. Abscisic acid signal transduction in epidermal cells of Pisum sativum L. Argenteum: both dehydrin mRNA accumulation and stomatal responses require protein phosphorylation and dephosphorylation. Planta 202, 85–92.

Hirt H. 1997. Multiple roles of MAP kinases in plant signal transduction. Trends in Plant Science 2, 11–15.[Web of Science]

Huttly AK, Phillips AL. 1995. Gibberellin-regulated expression in oat aleurone cells of two kinases that show homology to MAP kinase and a ribosomal protein kinase. Plant Molecular Biology 27, 1043–1052.[Web of Science][Medline]

Jouannic S, Hamal A, Kreis M, Henry Y. 1996. Molecular cloning of an Arabidopsis thaliana MAP kinase kinase-related cDNA (accession No. Y0794 PGR96–098). Plant Physiology 112, 1397.[Medline]

Knetsch MLW, Wang M, Snaar-Jagalska BE, Heimovaara-Dijkstra S. 1996. Abscisic acid induces mitogen-activated protein kinase activation in barley aleurone protoplasts. The Plant Cell 8, 1061–1067.[Abstract]

Kovtun Y, Chiu W-L, Zeng, Sheen J. 1998. Suppression of auxin signal transduction by a MAPK cascade in higher plants. Nature 395, 716–720.[Medline]

Kultz D. 1998. Phylogenetic and functional classification of mitogen-and stress-activated protein kinases. Journal of Molecular Evolution 46, 571–588.[Web of Science][Medline]

Leung J, Giraudat J. 1998. Abscisic acid signal transduction. Annual Review of Plant Physiology and Plant Molecular Biology 49, 199–222.[Web of Science]

Li JL, Assman SM. 1996. An abscisic acid-activated and calcium-independent protein kinase from guard cells of fava bean. The Plant Cell 8, 2359–2368.[Abstract]

Mizoguchi T, Gotoh Y, Nishida E, Yamaguchi-Shinozaki K, Hayashida N, Isawaki T, Kamada H, Shinozaki K. 1994. Characterisation of two cDNAs that encode MAP kinase homologues in Arabidopsis thaliana and analysis of the possible role of auxin in activating such kinase activation in cultured cells. The Plant Journal 5, 111–122.[Web of Science][Medline]

Mizoguchi T, Ichimura K, Shinozaki K. 1997. Environmental stress response in plants: the role of mitogen-activated protein kinases. Trends in Biotechnology 15, 15–19.[Web of Science][Medline]

Mori IC, Muto S. 1997. Abscisic acid activates a 48-kilodalton protein kinase in guard cell protoplasts. Plant Physiology 113, 833–839.[Abstract]

Morris PC, Guerrier D, Leung J, Giraudat J. 1997. Cloning and characterisation of MEK1, an Arabidopsis gene encoding a homologue of MAP kinase kinase. Plant Molecular Biology 35, 1057–1064.[Web of Science][Medline]

Popping B, Gibbons T, Watson MD. 1996. The Pisum sativum MAP kinase homologue (PsMAPK) rescues the Saccharomyces cerevisiae hog1 deletion mutant under conditions of high osmotic stress. Plant Molecular Biology 31, 355–363.[Web of Science][Medline]

Stafstrom JP, Altschuler M, Anderson DH. 1993. Molecular cloning and expression of a MAP kinase homologue from pea. Plant Molecular Biology 22, 83–90.[Medline]

Waskiewicz AJ, Cooper JA. 1995. Mitogen and stress response pathways: MAP kinase cascades and phosphatase regulation in mammals and yeast. Current Opinion in Cell Biology 7, 798–805.[Web of Science][Medline]

Wilson C, Voronin V, Touraev A, Vicente O, Heberle-Bors E. 1997. A developmentally regulated MAP kinase activated by hydration in tobacco pollen. The Plant Cell 9, 2093–2100.[Abstract]

Wilson C, Pfosser M, Jonak C, Hirt H, Heberle-Bors E, Vicente O. 1998. Evidence for the activation of a MAP kinase upon phosphate-induced cell cycle re-entry in tobacco cells. Physiologia Plantarum 102, 532–538.

Zhang S, Klessig DF. 1997. Salicylic acid activates a 48 kD MAP kinase in tobacco. The Plant Cell 9, 809–824.[Abstract]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Exp BotHome page
F. Lin, H. Ding, J. Wang, H. Zhang, A. Zhang, Y. Zhang, M. Tan, W. Dong, and M. Jiang
Positive feedback regulation of maize NADPH oxidase by mitogen-activated protein kinase cascade in abscisic acid signalling
J. Exp. Bot., July 10, 2009; (2009) erp157v1.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Pitzschke and H. Hirt
Disentangling the Complexity of Mitogen-Activated Protein Kinases and Reactive Oxygen Species Signaling
Plant Physiology, February 1, 2009; 149(2): 606 - 615.
[Full Text] [PDF]


Home page
J Exp BotHome page
Y. Xing, W. Jia, and J. Zhang
AtMEK1 mediates stress-induced gene expression of CAT1 catalase by triggering H2O2 production in Arabidopsis
J. Exp. Bot., August 28, 2007; (2007) erm144v1.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Pitzschke and H. Hirt
Mitogen-Activated Protein Kinases and Reactive Oxygen Species Signaling in Plants
Plant Physiology, June 1, 2006; 141(2): 351 - 356.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Zhang, M. Jiang, J. Zhang, M. Tan, and X. Hu
Mitogen-Activated Protein Kinase Is Involved in Abscisic Acid-Induced Antioxidant Defense and Acts Downstream of Reactive Oxygen Species Production in Leaves of Maize Plants
Plant Physiology, June 1, 2006; 141(2): 475 - 487.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
X.-C. Yu, M.-J. Li, G.-F. Gao, H.-Z. Feng, X.-Q. Geng, C.-C. Peng, S.-Y. Zhu, X.-J. Wang, Y.-Y. Shen, and D.-P. Zhang
Abscisic Acid Stimulates a Calcium-Dependent Protein Kinase in Grape Berry
Plant Physiology, February 1, 2006; 140(2): 558 - 579.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. A. C. MacRobbie
From the Cover: Osmotic effects on vacuolar ion release in guard cells
PNAS, January 24, 2006; 103(4): 1135 - 1140.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
M. Baier, E. Stroher, and K.-J. Dietz
The Acceptor Availability at Photosystem I and ABA Control Nuclear Expression of 2-Cys Peroxiredoxin-A in Arabidopsis thaliana
Plant Cell Physiol., August 15, 2004; 45(8): 997 - 1006.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
R. Desikan, M.-K. Cheung, J. Bright, D. Henson, J. T. Hancock, and S. J. Neill
ABA, hydrogen peroxide and nitric oxide signalling in stomatal guard cells
J. Exp. Bot., January 2, 2004; 55(395): 205 - 212.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
N. N. Gushwa, D. Hayashi, A. Kemper, B. Abram, J. E. Taylor, J. Upton, C. F. Tay, S. Fiedler, S. Pullen, L. P. Miller, et al.
Thermotolerant Guard Cell Protoplasts of Tree Tobacco Do Not Require Exogenous Hormones to Survive in Culture and Are Blocked from Reentering the Cell Cycle at the G1-to-S Transition
Plant Physiology, August 1, 2003; 132(4): 1925 - 1940.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
I. E. Moshkov, G. V. Novikova, L. A.J. Mur, A. R. Smith, and M. A. Hall
Ethylene Rapidly Up-Regulates the Activities of Both Monomeric GTP-Binding Proteins and Protein Kinase(s) in Epicotyls of Pea
Plant Physiology, April 1, 2003; 131(4): 1718 - 1726.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
L. Xiong and Y. Yang
Disease Resistance and Abiotic Stress Tolerance in Rice Are Inversely Modulated by an Abscisic Acid-Inducible Mitogen-Activated Protein Kinase
PLANT CELL, March 1, 2003; 15(3): 745 - 759.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Luan
Tyrosine phosphorylation in plant cell signaling
PNAS, September 3, 2002; 99(18): 11567 - 11569.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. A. C. MacRobbie
From the Cover: Evidence for a role for protein tyrosine phosphatase in the control of ion release from the guard cell vacuole in stomatal closure
PNAS, September 3, 2002; 99(18): 11963 - 11968.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
R. R. Finkelstein, S. S. L. Gampala, and C. D. Rock
Abscisic Acid Signaling in Seeds and Seedlings
PLANT CELL, May 1, 2002; 14(90001): S15 - 45.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
S. J. Neill, R. Desikan, A. Clarke, and J. T. Hancock
Nitric Oxide Is a Novel Component of Abscisic Acid Signaling in Stomatal Guard Cells
Plant Physiology, January 1, 2002; 128(1): 13 - 16.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
R. Desikan, J. T. Hancock, K. Ichimura, K. Shinozaki, and S. J. Neill
Harpin Induces Activation of the Arabidopsis Mitogen-Activated Protein Kinases AtMPK4 and AtMPK6
Plant Physiology, August 1, 2001; 126(4): 1579 - 1587.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
E. M. Gonzalez, L. Galvez, and C. Arrese-Igor
Abscisic acid induces a decline in nitrogen fixation that involves leghaemoglobin, but is independent of sucrose synthase activity
J. Exp. Bot., February 1, 2001; 52(355): 285 - 293.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Burnett, E. C.
Right arrow Articles by Neill, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burnett, E. C.
Right arrow Articles by Neill, S. J.
Agricola
Right arrow Articles by Burnett, E. C.
Right arrow Articles by Neill, S. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?