Journal of Experimental Botany, Vol. 51, No. 345, pp. 817-821,
April 2000
© 2000 Oxford University Press
Short Communication |
Differential expression of invertase genes in internal and external phloem tissues of potato (Solanum tuberosum L.)
Department of Cell and Molecular Genetics, Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK
Received 6 August 1999; Accepted 11 November 1999
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResults and discussionReferences |
|---|
The cloning of promoter sequences of two invertase genes from potato (Solanum tuberosum L.) is described. Histochemical analysis of series of reporter transgenic lines reveals phloem-expression from both promoters, with one expressed preferentially in internal phloem and the other in external phloem of stem vascular bundles.
Key words: Promoter, source-sink, vascular bundle.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionReferences |
|---|
Assimilated carbon, in most plants in the form of sucrose, is exported from sites of photosynthesis (source tissues) to sites of utilization (sink tissues). Provision of carbon and energy is only achieved following cleavage of the disaccharide, in which invertase (EC 3.2.1.26), by directly hydrolysing sucrose to glucose and fructose, is believed to play a key role (Tymowska-Lalanne and Kreis, 1998
). Invertase enzymes are classified according to their pH optima (acid and alkaline) and cellular localization (apoplastic or vacuolar and cytoplasmic, respectively). Those enzymes associated with the cell wall are considered to be pivotal to numerous metabolic processes including the control of assimilate partitioning )Roitsch, 1999). Genes and cDNAs encoding apoplastic invertases have now been cloned and characterized from a variety of plants and are often found as multigene families (Tymowska-Lalanne and Kreis, 1998).
In potato, the organization of two genes for potato invertases which encode putative apoplastic enzymes have recently been described (Maddison et al., 1999). The expression patterns of both genes have been characterized by biochemical assay and histochemical analysis of transgenic plants expressing fusions of their promoter sequences to the uidA gene (GUS). One gene is expressed specifically in pollen, the second in pollen, other floral tissues and notably at axial nodes in both stem and root. These expression patterns are consistent with roles for invertases both in vegetative and sexual growth cycles. Previously, two cDNA clones derived from leaf mRNA that encode putative apoplastic enzymes have also been described (Hedley et al., 1993, 1994). Biochemical assay of their expression indicated a role for these enzymes primarily in leaf and stem. Here, the cloning of promoter sequences for these two genes represented by cDNA clones are described, and their expression patterns using promoter-reporter gene fusions in transgenic plants further analysed.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionReferences |
|---|
Promoter cloning
All general recombinant DNA manipulations and sub-clonings were conducted using methodologies essentially as detailed in Sambrook et al. (Sambrook et al., 1989
). In order to acquire 5' sequence of the genes represented by each cDNA, direct PCR was applied, using standard genomic PCR conditions based on Saiki et al. (Saiki et al., 1988), followed by an inverse PCR (IPCR) approach using nested primers (Guerineau and Waugh, 1993). Genomic DNA was isolated from cv. Cara essentially as described by Dellaporta et al. (Dellaporta et al., 1983) and used as a template for direct PCR, using primers based on known invertase sequences from exons I (forward primer sequences: CCAGGGTTGCAATCTACAAGCACGG and CCATGTTGATGTTAGCAAGGTCCAT for invCD111 and invCD141, respectively) and exons III (reverse sequence primers: GTCGGTTGAAACTGAATGGGCCCAA and GCCCCATATCGCTCCCTTTGGGTTG for invCD111 and invCD141, respectively). Amplified fragments were cloned, sequenced and confirmed as being derived from the relevant cDNA. Two nested sets of unique primers derived from the novel intron I sequences (for invCD111: GTTAATGTAGTATACTATTGTAC and AGTGATTTCAAGTTCGACTTG followed by AAATGGATAACTTAAATCGTAC and TAAAGATGGACACGTAATGTAC; for invCD141: GAGCAAATACATATTTCAAGAC and GAAATCAACTAAGTAGGTATAC then ATTGAGATATAAACATAGCATG and TTCAGAACTCAATTACTAATAC) were next used in IPCR on cv. Cara DNA, which had been circularized by EcoRI-digestion and re-ligation. This generated further products which were cloned and sequenced. At each stage an overlap of approximately 200 bp of identical sequence between the newly-generated and existing sequence confirmed the identity of their origin. Relevant nucleotide sequences will appear under accession numbers X95280 and X95281 in the EMBL nucleotide sequence database. For sub-cloning into the expression vector (pBI101.3; Clontech, Palo Alto) the cloned promoter sequences, from bp 9–922 for invCD111 and bp 28–1424 for invCD141,were re-amplified using primers containing BamHI and HinDIII sites. After BamHI and HinDIII digestion these promoter sequences were cloned upstream of the uidA gene of pBI101.3 to yield plasmids pCD1 (invCD111 promoter) and pCD4 (invCD141 promoter).
Plant growth
Potato (Solanum tuberosum L. cv. Desirée) plants were grown in a controlled environment with a 16/8 h light/dark cycle with corresponding temperatures of 16/12 °C and constant 60% relative humidity.
Plant transformation
Potato transformation was effected as detailed (Hulme et al., 1992) using Agrobacterium tumefaciens LBA4404 containing plasmid pCD1 or pCD4 as donor, and leaf material from tissue culture-grown plantlets as explant tissue.
Histochemical assays of expression
The method of Jefferson et al. was used for ß-glucuronidase (GUS) assay (Jefferson et al., 1987). The pH of assay solutions was monitored before and after assay. GUS-stained tissue sections were subsequently stained with 0.01% aniline blue in 0.07% phosphate buffer pH 7.5 if required.
|
Results and discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionReferences |
|---|
Cloning of invertase gene promoters
Direct PCR from genomic DNA revealed the structure of the 5' end, from exon I to exon III (Fig. 1
) of both invertase genes represented initially as cDNA sequences. Both contain a long intron I (1741 and 2398 bp for invCD111 and invCD141, respectively) which show 44% similarity overall, while the 100 bp at the 5' ends of each are 52% similar. This region may be important to the splicing of the 9 bp mini-exon (Bournay et al., 1996) found in these genes and characteristic of all but one plant invertase gene sequenced to date. The introns II of both genes are of typical size (122 and 105 bp for invCD111 and invCD141, respectively) for plant invertase genes, and are 50–60% similar in sequence, if minor mismatch is allowed. As described previously (Hedley et al., 1994) the derived amino acid sequences clearly place these enzymes in the class of apoplastic invertases most closely related to a similar tobacco enzyme and then to two further potato enzymes.
|
EcoRI sites present within intron I of both genes served as cutting and re-ligation sites for the IPCR protocol which generated 913 bp and 1418 bp upstream of the start codons of invCD111 and invCD141, respectively (Fig. 1
). The start codon of invcd111 lies at +19 bp relative to its transcription start point which was determined by 5'-RACE (results not shown). The transcription start point is preceded at -35 bp by a canonical TATA box region. A similar analysis for invCD141 yielded a RACE product of identical protein-coding sequence to the gene, but with some sequence differences in the promoter region. This may represent an allelic variant of this gene in tetraploid potato, but this was not pursued further. Sequence searches of the invCD141 promoter indicate a strong potential TATA box region 85 bp upsteam of the start codon—this is consistent with a transcription start point at -50 bp, as was experimentally determined for the allelic variant. Other notable sequence features include a (TA)20 repeat at -270 bp and a R22TR17tract at -390 bp in the invCD111 promoter. No similar sequences were detected in the invCD141 promoter.
|
Generation and histochemical analysis of transgenic potato containing promoter-GUS fusions
Previous biochemical analyses of expression from these two genes, based on RT-PCR of various tissues, indicated expression of both in stem and leaf tissue of potato (Hedley et al., 1993
, 1994). Furthermore, in terms of photoassimilate partitioning, a differential expression pattern was detected with invCD111 expression primarily, but not exclusively, associated with major sink tissues and invCD141 expression with source tissues. To confirm and localize the expression of both genes their promoters were sub-cloned into GUS-reporter constructs. A series of transgenic potato lines was generated by Agrobacterium-mediated transformation for each construct. PCR and Southern hybridization (results not shown) were used to confirm the generation of 21 independent lines containing the invCD111 promoter-GUS fusion and 15 independent lines containing the invCD141 promoter-GUS fusion. All transgenic lines were taken to maturity in the glasshouse to form tubers and further plants grown from these tubers after a three month period of storage at 4 °C to break dormancy. From these plants a wide range of tissue samples were harvested for GUS histochemical analysis. GUS staining was conserved in location across individual members of each series, but exhibited variable intensity, possibly indicating position and dosage effects.
Expression from both promoters can be seen in longitudinal section of stem tissues associated with the vascular traces and extending into the petiole (Fig. 2a, b) of the imparipinnate leaf of potato, with no expression detected in other parts of the leaf. In crude cross-sections of the stem (Fig. 2c, d) expression from both promoters is primarily localized to the three major and three minor vascular bundles of the stem and associated vascular tissues. Within each transgenic line some indication of differential staining is evident, with the invCD111 promoter activity giving more intense staining of the outer region of the bundles, while the inner regions were more intensely stained by expression from the invCD141 promoter. This difference was confirmed by controlled staining of fine cross-sections (Fig. 2e, f).
Sequential staining of fine cross-sections of stems for GUS activity (Fig. 2g, i), and with aniline blue (Fig. 2h, j) to reveal callose-containing xylem tissue, allowed detailed localization of promoter activity within individual vascular bundles. GUS expression from the invCD111 promoter could be ascribed to the outer phloem tissues of the vascular bundle (Fig. 2g) while invCD141 promoter expression was evident primarily in the inner phloem tissues (Fig. 2i). In these, and the previous sections, the low level of GUS activity also seen in the opposite tissue may result from GUS diffusion between outer and inner phloem vessels which are known to be interconnected by phloem anastomoses in the Solanaceae (Zamski and Tsivion, 1977).
Association of acid invertase gene expression with vascular tissues has been noted previously in other plants. Tissue prints for invertase protein in barley and pea leaves revealed a strong preferential localization in vascular tissues (Kingston-Smith and Pollock, 1996), while a further study of a wound-inducible invertase gene in pea showed abundant expression in the phloem of wounded stem sections (Zhang et al., 1996). An acid invertase gene promoter from carrot was observed to drive GUS expression in the major leaf veins of 3-week-old tobacco seedlings (Ramloch-Lorenz et al., 1993). The other sucrose-cleaving enzyme in plants, sucrose synthase, has also, in some studies, been associated with vascular tissues (Martin et al, 1993; Fu and Park, 1995): in leaves of Arabidopsis, in tubers and basal tissues of axillary buds of potato, and in roots of both plants. Expression of both sucrose synthase and a sucrose transporter have also been noted in companion cells of the sieve element–companion cell complex of maize and citrus (Nolte and Koch, 1993) and tobacco (Kuhn et al., 1997).
|
A range of sequence elements have been implicated in governing phloem-specific expression patterns from promoters of these and other genes (Yin et al., 1997
). The most prevalent of these elements in the two invertase promoters, with locations as detailed in Table 1, are those of the ASL box and GATA motif types. These, and a third element, the BoxII motif, may act synergistically to promote phloems-specific expression. The invertase promoters contain several C4 repeats, the central core of BoxII, but none are bracketed by the CCA/TGG repeat characteristic of this motif. Further dissection of these promoters will be required to confirm the elements determining phloem-specificity, and to determine whether these or other elements govern the differential expression observed in internal and external phloem. Further insights into the physiological roles played by the enzymes expressed from the genes these promoters control will require both enzyme-specific localization tools and transgenic manipulation of function. The association by histochemistry of invCD111 expression with outer phloem, which is the major route for the transfer of photoassimilate to sink organs, is consistent with the previous result, obtained from biochemical investigation, which indicated strong invCD111 expression in sink tissues.
|
Acknowledgments |
|---|
We thank Alison Roberts and Karl Oparka for help with photomicroscopy and useful discussions. This work was supported by grant-in-aid from the Scottish Executive Rural Affairs Department and by a BBSRC Research Studentship to AM.
|
Notes |
|---|
1 Present address: Institute of Biological Sciences, University of Wales Aberystwyth, Aberystwyth, Ceredigion SY23 3DA, UK.
2 To whom correspondence should be addressed. Fax: +44 1382 568503. E-mail:gmachr{at}scri.sari.ac.uk
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionReferences |
|---|
Bournay A-S, Hedley PE, Maddison A, Waugh R, Machray GC.1996. Exon skipping induced by cold stress in a potato invertase gene transcript. Nucleic Acids Research 24, 2347–2351.
Brears T, Walker EL, Coruzzi GM.1991. A promoter sequence involved in cell-specific expression of the pea glutamine synthetase GS3A gene in organs of transgenic tobacco and alfalfa. The Plant Journal 1, 235–244.[Web of Science][Medline]
Dellaporta SJ, Wood J, Hicks JB.1983. A plant DNA minipreparation: version II. Plant Molecular Biology Reporter 1, 19–21.
DeWitt ND, Harper JF, Sussman MR.1991. Evidence for a plasma membrane proton pump in phloem vells of higher plants. The Plant Journal 1, 121–128.[Web of Science][Medline]
Fu H, Park WD.1995. Sink- and vascular-associated sucrose synthase functions are encoded by different gene classes in potato. The Plant Cell 7, 1369–1385.[Abstract]
Guerineau F, Waugh R.1993. The U6 small nuclear RNA gene family of potato. Plant Molecular Biology 22, 807–818.[Web of Science][Medline]
Hedley PE, Machray GC, Davies HV, Burch L, Waugh R.1993. cDNA cloning and expression of a potato (Solanum tuberosum) invertase. Plant Molecular Biology 22, 917–922.[Web of Science][Medline]
Hedley PE, Machray GC, Davies HV, Burch L, Waugh R.1994. Potato (Solanum tuberosum) invertase-encoding cDNAs and their differential expression. Gene 145, 211–214.[Web of Science][Medline]
Hulme JS, Higgins ES, Shields R.1992. An efficient genotype-independent method for regeneration of potato plants from leaf tissue. Plant Cell, Tissue and Organ Culture 31, 161–167.
Jefferson RA, Kavanagh TA, Bevan MW.1987. GUS fusions: ß-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO Journal 6, 3910–3907.
Kingston-Smith AH, Pollock CJ.1996. Tissue level localization of acid invertase in leaves: an hypothesis for the regulation of carbon export. New Phytologist 134, 423–432.
Kuhn C, Franceschi VR, Schulz A, Lemoine R, Frommer W.1997. Macromolecular trafficking indicated by localization and turnover of sucrose transporters in enucleate sieve elements. Science 275, 1298–1300.
Maddison AL, Hedley PE, Meyer RC, Aziz N, Davidson D, Machray GC.1999. Expression of tandem invertase genes supports sexual and vegetative growth cycles in potato. Plant Molecular Biology (in press).
Martin T, Frommer WB, Salanoubat M, Willmitzer L.1993. Expression of an Arabidopsis sucrose synthase gene indicates a role in metabolization of sucrose both during phloem loading and in sink organs. The Plant Journal 4, 367–377.[Web of Science][Medline]
Nolte KD, Koch KE.1993. Companion-cell specific localization of sucrose synthase in zones of phloem loading and unloading. Plant Physiology 101, 899–905.[Abstract]
Ramloch-Lorenz K, Knudsen S, Sturm A.1993. Molecular characterisation of the gene for carrot cell wall ß-fructosidase. The Plant Journal 4, 545–554.[Web of Science][Medline]
Roitsch T.1999. Source–sink regulation by sugar and stress. Current Opinions in Plant Biology 2, 198–206.[Web of Science][Medline]
Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA.1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487–491.
Sambrook J, Fritsch EF, Maniatis T.1989. Molecular cloning. a laboratory manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Tymowska-Lalanne Z, Kreis M.1998. The plant invertases: physiology, biochemistry and molecular biology. Advances Botanical Research 28, 70–117.
Yang NS, Russell D.1990. Maize sucrose synthase-1 promoter directs phloem cell-specific expression of GUS gene in transgenic tobacco plants. Proceedings of the National Academy of Sciences, USA 87, 4144–4148.
Yin Y, Chen L, Beachy R.1997. Promoter elements required for phloem-specific gene expression from the RTBV promoter in rice. The Plant Journal 12, 1179–1188.[Web of Science][Medline]
Zamski E, Tsivion Y.1977. Translocation in plants possessing supernumerary phloem. Journal of Experimental Botany 102, 117–126.
Zhang L, Cohn NS, Mitchell JP.1996. Induction of a pea cell wall invertase gene by wounding and its localized expression in phloem. Plant Physiology 112, 1111–1117.[Abstract]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  R. K. Proels and T. Roitsch Extracellular invertase LIN6 of tomato: a pivotal enzyme for integration of metabolic, hormonal, and stress signals is regulated by a diurnal rhythm J. Exp. Bot., April 1, 2009; 60(6): 1555 - 1567. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C Doering-Saad, H. Newbury, C. Couldridge, J. Bale, and J Pritchard A phloem-enriched cDNA library from Ricinus: insights into phloem function J. Exp. Bot., September 1, 2006; 57(12): 3183 - 3193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Quilliam, P. J. Swarbrick, J. D. Scholes, and S. A. Rolfe Imaging photosynthesis in wounded leaves of Arabidopsis thaliana J. Exp. Bot., January 1, 2006; 57(1): 55 - 69. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-T. CHEN and T. L. SETTER Response of Potato Tuber Cell Division and Growth to Shade and Elevated CO2 Ann. Bot., February 1, 2003; 91(3): 373 - 381. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||