Journal of Experimental Botany, Vol. 51, No. 352, pp. 1789-1797,
November 1, 2000
© 2000 Oxford University Press
Original Papers |
Isolation of three distinct CycD3 genes expressed during fruit development in tomato1
The Horticulture and Food Research Institute of New Zealand Ltd., Mt. Albert Research Centre, Private Bag 92169, Auckland, New Zealand
Received 7 March 2000; Accepted 26 June 2000
| Abstract |
|---|
|
|
|---|
Tomato (Lycopersicon esculentum Mill.) is an important fruit crop world-wide and a model for studying fruit development. As determined using flow cytometry, fruit growth was characterized by high cell division activity in tomato during the first week after anthesis and followed by endoreduplications (DNA replication without cell divisions). D-type cyclins are considered to be important parts of the signal transduction for stimulation of DNA replication and cell division. To study the function of D cyclins in fruit development, full-length cDNA clones for three D cyclin genes were isolated from young tomato fruit. They were classified as D3 cyclins by sequence similarities and a phylogenetic analysis and named as LeCycD3;1, LeCycD3;2 and LeCycD3;3. The deduced amino acid sequences for LeCycD3;13 contained a retinoblastoma-binding motif and a PEST-destruction motif. Pollination and fertilization were followed by a high increase in the transcript levels of LeCycD3;13 in young fruit. Using in situ hybridization, high expression of LeCycD3;3 was detected in the vascular tissue of young fruit suggesting a role in vascular development. The D3 cyclins are probably involved in transducing the signals leading to fruit growth by cell divisions. Distinct differences were detected in their temporal and spatial expression patterns suggesting that they play different roles in fruit development as well as in the development of other plant organs.
Key words: Cell cycle, cyclin, fruit development, Lycopersicon esculentum.
| Introduction |
|---|
|
|
|---|
The growth of a fruit after anthesis starts by stimulation of cell divisions in the tissues forming the fruit flesh (reviewed by Coombe, 1976
Complexes containing cyclins and cyclin-dependent protein kinases (CDK) play a central role in the regulation of cell-cycle progression in eukaryotes such as yeast (reviewed by Forsburg and Nurse, 1991
; Nasmyth, 1996
) and animals (reviewed by Norbury and Nurse, 1992
). The binding of cyclin to the CDK is necessary for protein kinase activity and for determining target specificity (Morgan, 1995
; Nigg, 1995
). The cyclins share the presence of the relatively conserved cyclin box of about 100 amino acids, which is responsible for CDK binding and activation, and they are classified according to sequence identities and activity during the cell cycle. Many cyclins are used to control different stages of cell-cycle progression and oscillating gene transcription and protein breakdown mainly controls their activity. In animals, mitotic A- and B-type cyclins are needed for progression through G2 and for mitosis. In addition, cyclin A is essential for S phase. Important regulators of G1 progression and G1 to S transition are the cyclins D1, D2, D3, and E (Sherr, 1993
, 1994
). D-type cyclins induce CDK activity after stimulation by growth factors and transduce extracellular signals for stimulation of cell division.
Over 60 cyclin cDNA clones have been isolated from a number of plants (reviewed by Renaudin et al., 1996
). Most of these are related to the mitotic A- and B-type cyclins. The G1 cyclins are less conserved than the mitotic cyclins and complementation of yeast G1 cyclin mutants were initially used to isolate three D cyclins from Arabidopsis (Soni et al., 1995
) and one from Medicago sativa (Dahl et al., 1995
). These plant sequences have recently been utilized for the isolation of D cyclin clones from pea (Shimizu and Mori, 1998
), tobacco (Sorrell et al., 1999
) and Chenopodium (Fountain et al., 1999
). A D-type cyclin has also been isolated through its interaction with Cdc2 in a two-hybrid screen (De Veylder et al., 1999
). In agreement with the hypothesis that plant D cyclins are involved in transducing growth signals into the cell cycle, Arabidopsis CycD3 seems to transduce the cytokinin activation of the cell cycle at the G1S transition (Riou-Khamlichi et al., 1999
), and Arabidopsis CycD2 and CycD4 expression is induced by carbon source (Fuerst et al., 1996
; De Veylder et al., 1999
). Plant D cyclins have been shown to be able to bind retinoblastoma-related proteins (Ach et al., 1997
; Huntley et al., 1998
; Nakagami et al., 1999
) and also together with Cdc2 phosphorylate a Rb-related protein (Nakagami et al., 1999
). This suggests that plant D cyclins may act in the control of G1S by phosphorylation of Rb-related proteins as previously shown in animals.
The important connection between plant development and cell division/cell expansion is very complex and poorly understood (see for example Hemerly et al., 1999
). To understand better the molecular regulation of the cell division and cell expansion phases of fruit development, full-length clones for three D3 cyclin genes from tomato have been isolated and characterized increasing the number of known D3 cyclins in plants. These results suggest that the three D3 cyclin genes have different functions in plant development and show that they are expressed during both the cell division and cell expansion/endoreduplication phases of fruit development.
| Materials and methods |
|---|
|
|
|---|
Plant material
Tomato plants (Lycopersicon esculentum Mill., cv. UC82B) were grown under greenhouse conditions. Flowers were tagged at anthesis and the fruit collected at specific time points after anthesis.
PCR amplification of cyclin gene fragments
To isolate cyclin D3 cDNA from tomato, two degenerate PCR primers were designed based on the sequences VNAHYGF and KYVFEAK of the cyclin box. These regions are strictly conserved between cyclin D3 from Arabidopsis thaliana (Soni et al., 1995
) and cycMs4 from Medicago sativa (Dahl et al., 1995
).
The primers, fwd: 5' TGTGTTGTCGAC/GT(C/G/T) AA (C/T)GC(A/C/T)CA(C/T)TA(C/T)GG(A/C/G/T)TT 3' rev: 5' TGTGTTGCGGCCGC/TT(A/G/T)GC(C/T)TC(A/G) AA(A/G/C)AC(A/G)TA(C/T)TT 3', are 288- and 144-fold degenerate, respectively. Restriction sites for Sal I and Not I were included in the primers to facilitate cloning. Double-stranded cDNA (1 ng) from young tomato fruit was used as template for the PCR, which consisted of initial denaturing (5 min at 94 °C), 5 cycles (1 min at 94 °C, 2 min at 42 °C, and 3 min at 72 °C), 30 cycles (1 min at 94 °C, 1 min at 50 °C and 3 min at 72 °C) and a final extension of 7 min at 72 °C. The obtained fragments were cloned into Bluescript SK (+/-) (Stratagene, La Jolla, CA, USA).
To isolate a partial cyclin B1 cDNA from tomato, primers based on Ntcyc29 (Nicta;CycB1;2) from Nicotiana tabacum (Setiady et al., 1995
) were used. The primers, fwd: 5' TGT-GTTGTCGACGCTAGGAGCAAGGCTGCCTG 3' and rev: 5' TGTGTTGCGGCCGCTAAGGTGTTGGGACTGTTAA 3', were designed to amplify a fragment corresponding to bp 412911 of Ntcyc29. Restriction sites for Sal I and Not I were included in the primers to facilitate cloning. Double-stranded cDNA (2 ng) from young tomato fruit was used as template for the PCR, which consisted of initial denaturing (4 min at 94 °C), 5 cycles (1 min at 94 °C, 1 min at 50 °C and 2 min at 72 °C), 30 cycles (1 min at 94 °C, 1 min at 54 °C and 2 min at 72 °C) and a final extension of 7 min at 72 °C.
cDNA library construction and screening
Total RNA was isolated from 07-d-old tomato fruit using TRIZOL reagent (Life Technologies, Gaithersburg, MD, USA). Poly(A)+ RNA was enriched by two rounds of column purification (mRNA Purification Kit, Pharmacia, Uppsala, Sweden). A cDNA library was constructed in
Uni-ZAP XR vector as described in the instruction manual (Stratagene). 2x105 phage colonies were screened on Hybond-N+ filters (Amersham, England) by standard procedures (Sambrook et al., 1989
). A 32P-labelled probe was generated from the cloned D-cyclin fragment by random priming using the RTS RadPrime DNA Labeling System (Life Technologies). DNA inserts from positive clones were excised according to the protocol from the manufacturer.
Southern blot analysis
Genomic DNA was isolated from leaves of tomato, tobacco (Nicotiana tabacum) or petunia (Petunia hybrida) using minor modifications of the CTAB protocol (Doyle and Doyle, 1990
). 10 µg of DNA was digested with the appropriate restriction enzymes, subjected to electrophoresis in a 0.8% agarose gel, transferred to a Nytran Plus nylon filter (Schleicher and Schuell, Dassel, Germany) and hybridized at 65 °C according to standard procedures (Sambrook et al., 1989
). Probes were prepared by isolation of fragments from plasmid clones and 32P-labelled as described above. The filters were washed twice for 10 min with 2x SSC (1x SSC: 0.15 M NaCl, 15 mM trisodium citrate, pH 7.0), 0.1% sodium dodecyl sulphate (SDS) at 65 °C; and finally for 20 min with 2x SSC, 0.1% SDS (low stringency), or 0.5x SSC, 0.1% SDS (high stringency) at 65 °C. The filters were exposed to X-ray film (Kodak X-OMAT AR) between intensifying screens or analysed by a PhosphorImager (Molecular Dynamics, Sunnyvale, CA, USA).
Northern blot analysis
Tomato fruit was harvested at defined time points after anthesis. Plant material was frozen in liquid nitrogen and used immediately or stored at -70 °C. Total RNA from tomato vegetative parts, flowers and fruit up to 2 weeks after anthesis was isolated using TRIZOL reagent. Another method was used to isolate total RNA from 3- and 6-week-old fruit (López-Gómez and Gómez-Lim, 1992
). Total RNA (10 or 20 µg per sample) was subjected to electrophoresis in formaldehyde-agarose gels and transferred to Nytran Plus nylon filters (Schleicher and Schuell) according to standard procedures (Sambrook et al., 1989
). Hybridization of the Northern blot filters was performed as described above for the Southern blot filters. Hybridization signals were quantified from the blots using a PhosphorImager (Molecular Dynamics). The amount of RNA in each sample was determined by hybridization of the filters with an apple 18S rRNA probe (Simon and Weeden, 1992
). The quantified data were equalized by normalizing to the amount of rRNA.
In situ hybridization
Tomato fruit at 6 d after anthesis and flower peduncle were fixed and embedded. The methods used for digoxigenin labelling of RNA probes, tissue preparation and in situ hybridization were mainly as described in Jackson (Jackson, 1992
). The probe region was the same as for the northern and Southern blot hybridizations. The LeCycD3;3 probe consisted of bp 11149.
Sequence analysis
DNA sequences were determined by the dideoxynucleotide method with dye terminators on an Applied Biosystems 373 DNA sequencer (University of Auckland, New Zealand). The complete sequences of full-length clones were determined on both strands by generation of deletions with restriction enzymes or by use of synthetic oligonucleotides. DNA sequence data were assembled and analysed with the GCG package (version 9; Genetics Computer Group, Madison, WI). Multiple sequence alignments for phylogenetic analysis were produced using CLUSTAL W 1.74. Parsimony analysis was accomplished using PAUP 3.1s (Swofford, 1993
). Gaps were treated as missing data. Possible PEST-destruction sequences were identified using the PEST-find programme (Rechsteiner and Rogers, 1996
).
Flow cytometry
Nuclei from tomato fruit cells were isolated and prepared as described before (O'Brien et al., 1996
). The relative DNA content was determined by cytometric analysis using an EPICS Elite ESP flow cytometer (Coulter Electronics, Hialeah, Florida, USA) with the 488 nm line of an argon laser. For each sample the DNA content of at least 10 000 nuclei was determined.
| Results |
|---|
|
|
|---|
Cell divisions and endoreduplications follow induction of fruit growth
To characterize the cell division activity during early fruit development, the nuclear DNA contents were determined in young fruit of the tomato cultivar UC82B using flow cytometry (Fig. 1
|
Isolation of tomato cDNA for D3 cyclins
A DNA fragment of 243 bp was produced by PCR of cDNA from young tomato fruit, and the deduced amino acid sequence of the fragment showed high similarity to plant D3 cyclins. The cloned PCR fragment was used to screen a library corresponding to the same tissue, and three different cyclin genes were identified among 160 positive clones: Lyces;CycD3;1 (or LeCycD3;1), Lyces;CycD3;2 (or LeCycD3;2) and Lyces;CycD3;3 (or LeCycD3;3). The initial PCR fragment was completely identical to part of LeCycD3;2. The inserts of the longest clones for LeCycD3;1, LeCycD3;2 and LeCycD3;3 were 1518 bp, 1460 and 1449 bp in length, respectively, and contained open reading frames encoding putative proteins with 359, 364 and 336 amino acids (Fig. 2
). In-frame stop codons were present upstream of the first methionine codons in all cases indicating that these clones contain the full coding sequences. The deduced amino acid sequences of LeCycD3;13 had similar predicted molecular weight, around 40 000, with a predicted pI of around 4.8. Alternative poly-adenylation sites were detected for LeCycD3;1 and LeCycD3;2 (not shown).
|
The predicted amino acid sequences of the tomato cyclins were 4751% identical to each other over the entire length, 4861% to the published D3 cyclins from Arabidopsis and alfalfa, and 2831% to Arabidopsis CycD2 and CycD1. Besides the presence of a cyclin box, the predicted proteins of LeCycD3;13 displayed two characteristic structural elements of D cyclins. Firstly, the motif LxCxE, which binds to retinoblastoma-related proteins (Sherr, 1993
Phylogeny and genome organization of D3 cyclin genes
A phylogenetic analysis based on the amino acid sequences of cyclin boxes (corresponding to amino acid 89 to 194 in LeCycD3;1) confirmed their identity as D3 cyclins (Fig. 3a
), and showed that the D cyclins from plants, animals and yeast have a common origin separate from the A- and B-cyclins. The monophyletic origin of plant D cyclins also showed that the diversification of D cyclin families in plants, animals and yeast has occurred independently. A phylogenetic analysis using the complete amino acid sequences of plant D3 cyclins strongly suggested that tomato LeCycD3;1 and tobacco NtCycD3;2, and tomato LeCycD3;2 and tobacco NtCycD3;1 are orthologues (Fig. 3b
).
|
Southern blot experiments showed that the three D3 cyclin genes are present as single copy genes in the tomato genome, while a LeCycD3;1 probe containing the conserved cyclin box detected approximately four genes at low stringency (not shown).
Differential expression of D3 cyclin genes during plant development
High expression levels of the three D3 cyclins, and a histone H4 gene as a marker for DNA replication (Brandstädter et al., 1994
), were detected in tissues containing dividing cells, such as vegetative buds, flower buds, young fruit, young roots, and young leaves (Fig. 4
). Transcripts for LeCycD3;13 and histone H4 were also observed in seedlings and mature leaves. The relative abundance of transcripts in different tissues varied between the D3 cyclin genes. LeCycD3;2 and histone H4 were equally highly expressed in vegetative shoots, flower buds, young fruit, and young leaves, while LeCycD3;1 was preferentially expressed in young fruit, and LeCycD3;3 at lower levels in fruit compared with vegetative shoots, flower buds and young leaves. The different expression patterns of the three D cyclins suggest that they are developmentally regulated and that they have different roles in the control of cell-cycle progression. The transcript size of 1.5 kb for LeCycD3;13 corresponded well with those of the clone inserts.
|
The expression of D3 cyclin genes is up-regulated after fertilization
The expression of LeCycD3;13, a tomato B1 cyclin homologue (Lyces;CycB1;1 or LeCycB1;1), and histone H4 was rapidly stimulated in ovaries after pollination/fertilization (Fig. 5
). As soon as 1 d after anthesis (1 DPA), the transcript levels of LeCycD3;1, LeCycD3;2 and histone H4 had increased significantly. The transcript levels of the D3 cyclin genes, the B1 cyclin gene, as well as that of histone H4, peaked at 3 DPA, then gradually decreased but was still easily detectable at 14 DPA. The expression of LeCycD3;13 and histone H4 was still detectable at 3 weeks after anthesis in whole fruit and in the pericarp (not shown). After prolonged exposure, expression of all D3 cyclin genes could also be observed at the breaker stage of fruit development 6 weeks after anthesis. There were distinct differences in the expression levels of the three D-cyclin genes in ovaries and young fruit. The transcript levels of LeCycD3;1, similar to LeCycB1;1 and histone H4, were stimulated by fruit set, with a more than a 5-fold difference from anthesis to 3 DPA. LeCycD3;3 transcripts were abundant pre-anthesis, dropped to anthesis, were slowly stimulated by fruit set and then decreased to a low level. The LeCycD3;2 transcript level was more constant with a 3-fold increase from anthesis to 3 DPA.
|
In contrast, the tomato homologue of 21D7 nuclear antigen from carrot, a putative 26S proteasome subunit (Smith et al., 1997
Localization of cyclin expression
In situ hybridization was used to detect the localization of LeCycD3;3 expression in 6-d-old fruit. The results from the Northern blot experiments (Fig. 5
) had shown that at this time point, the transcript levels of the D3 cyclin genes and the B1 cyclin gene were still elevated compared to anthesis, but had decreased from their peaks at 3 DPA. LeCycD3;3 showed a weak signal in the placenta proximal to the seeds (Fig. 6b
), and a stronger hybridization in the vascular tissue of placenta and pericarp (Fig. 6b
, c), and of flower peduncle (Fig. 6d
). The signal appeared to be in parenchyma and companion cells, but not in xylem vessels.
|
| Discussion |
|---|
|
|
|---|
cDNA clones have been isolated from young tomato fruit, representing three new genes with high similarity to previously isolated D3 cyclins from Arabidopsis (Soni et al., 1995
A phylogenetic analysis of cyclin boxes from a range of cyclins confirmed that these three tomato genes can be classified as D3 cyclins and also showed that the D cyclins from plants, animals and yeast have a common origin. Among the D cyclins, plant D cyclins formed a monophyletic clade suggesting the diversification of the D cyclin gene family to have occurred after the split between the plant, fungal and animal lineages. The genome of the ancestral organizm may have contained a very limited number of G1- and mitotic cyclin genes, which independently have been duplicated in the different lineages during evolution.
These Southern blot experiments suggested that there were four gene copies for D3 cyclins in tomato. Data from tobacco and petunia showed that other Solanaceae species also contained these three CycD3 genes in two or more copies (not shown). A Southern blot analysis that has been performed with Arabidopsis (Soni et al., 1995
) further supports the idea that there is a small family of D3 cyclin genes in dicotyledonous plants.
The tomato D3 cyclin genes, as histone H4, were expressed throughout the plant, but with a preference for tissues with high levels of cell division, such as vegetative buds, flower buds, young fruit, young roots, and young leaves. The comparison of transcript levels for LeCycD3;13 in a range of tissues and during early fruit development showed that they were differently regulated suggesting them to have different functions. As visible in the in situ hybridization experiments, LeCycD3;3 showed high transcript levels in vascular tissue of young fruit and flower peduncle. This may reflect a specific role in the development of vascular tissue similar to CycD4;1 of Arabidopsis (De Veylder et al., 1999
). Different expression patterns have been detected for two D3 cyclins in Antirrhinum (Doonan, 1998
), with one gene expressed in all proliferating cells in the shoot, and the other D3 cyclin gene expressed in a subset of proliferating cells, as well as in tobacco with differential accumulation during the cell cycle for two tobacco D3 cyclins (Sorrell et al., 1999
). The level of redundancy between the different plant D3-type cyclins and their specific functions remains to be determined.
The temporary resting stage at anthesis is broken by pollination and fruit growth is started by an initial phase of high cell division activity directly followed by endoreduplications and cell expansion. As soon as 1 d after anthesis there was a significant increase in transcript levels of LeCycD3;1 and 2, as well as histone H4, indicating that pollination/fertilization induces a rapid stimulation of cell-cycle gene expression. Recently, also the transcripts of two CDK genes were found to accumulate during the early phase of cell division in tomato fruit (Joubès et al., 1999
). The transcript levels for the three D3 cyclin genes, cyclin B1, and histone H4 peaked at 3 DPA coinciding with the period of intense cell division activity in the pericarp (Gillaspy et al., 1993
).
Plant hormones are likely to be involved in triggering fruit set. Both gibberellins and cytokinins levels peak during fertilization (Gillaspy et al., 1993
), and several gibberellin synthesis genes were shown to be upregulated in young fruit compared with temporal low levels during anthesis (Rebers et al., 1999
). The cyclin genes may be involved in transducing the hormonal signals leading to fruit growth by cell divisions.
The continued expression of histone H4 and the cyclins in the later stages of fruit development may be because of a low level of cell division and/or because of an association with the detected endoreduplications. Histone H2A has earlier been observed to be expressed in both cells undergoing cell division and endoreduplication during tomato plant development (Koning et al., 1991
).
The PEST sequences of the D3 cyclins suggests that they are targeted for ubiquitin-mediated destruction by the 26S proteosome. The 21D7 nuclear antigen from carrot has been demonstrated to be a part of the 26S proteosome and has been suggested to participate in the control of cell division by regulating the activity or specificity of the 26S proteosome (Smith et al., 1997
). However, the transcript level of the tomato 21D7 gene homologue remained relatively constant during early fruit development showing no correlation with the transcript levels of the D3 cyclin genes or histone H4. The constant levels of 21D7 mRNA probably reflects the fact that it has more functions besides proteolysis of cell-cycle regulatory proteins or that its activity is regulated post-transcriptionally.
In summary, three members of the CycD3 family of tomato have been isolated and characterized. Previously, only two members of this gene family had been identified from a given plant species. The expression of these genes was correlated with tissues with high cell division activity. However, the three CycD3 genes were differentially expressed in different tissues and during plant development suggesting them to have different functions. Further studies are now needed to specify the possible functions of the D3 cyclins in the regulation of cell division, endoreduplication and even more widely in plant development.
| Acknowledgments |
|---|
The authors thank J Brandstädter at Universität zu Köln for the kind gift of the tomato histone H4 clone, J Doonan for helpful discussions and J Valkonen for critical discussions and comments on the manuscript. Financial support for this work was obtained from the New Zealand Foundation of Research, Science and Technology (CO6817).
| Notes |
|---|
1 The nucleotide sequence data reported appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession numbers: Lyces;CycD3;1 (AJ002588), Lyces;CycD3;2 (AJ002589), Lyces;CycD3;3 (AJ002590), and Lyces;CycB1;1 (AJ011108).
2 To whom correspondence should be addressed at: Department of Plant Biology, Swedish University of Agricultural Sciences, Box 7080, 750 07 Uppsala, Sweden. Fax: +46 18 673392. E-mail: Anders.Kvarnheden{at}vbiol.slu.se ![]()
| References |
|---|
|
|
|---|
Ach RA, Durfee T, Miller AB, Taranto P, Hanley-Bowdoin L, Zambryski PC, Gruissem W.1997. RRB1 and RRB2 encode maize retinoblastoma-related proteins that interact with a plant D-type cyclin and geminivirus replication protein. Molecular and Cellular Biology 17,50775086.[Abstract]
Bergervoet JHW, Verhoeven HA, Gilissen LJW, Bino RJ.1996. High amounts of nuclear DNA in tomato (Lycopersicon esculentum Mill.) pericarp. Plant Science 116, 141145.
Brandstädter J, Roßbach C, Theres K.1994. The pattern of histone H4 expression in the tomato shoot apex changes during development. Planta 192, 6974.[Web of Science][Medline]
Coombe BG.1976. The development of fleshy fruits. Annual Review of Plant Physiology 27, 207228.[Web of Science]
Dahl M, Meskiene I, Bögre L, Ha DTC, Swoboda I, Hubmann R, Hirt H, Heberle-Bors E.1995. The D-type alfalfa cyclin gene cycMs4 complements G1 cyclin-deficient yeast and is induced in the G1 phase of the cell cycle. The Plant Cell 7, 18471857.[Abstract]
Day IS, Reddy ASN, Golovkin M.1996. Isolation of a new mitotic-like cyclin from Arabidopsis: complementation of a yeast cyclin mutant with a plant cyclin. Plant Molecular Biology 30, 565575.[Web of Science][Medline]
De Veylder L, de Almeida Engler J, Burssens S, Manevski A, Lescure B, Van Montagu M, Engler G, Inzé D.1999. A new D-type cyclin of Arabidopsis thaliana expressed during lateral root primordia formation. Planta 208, 453462.[Web of Science][Medline]
Doonan JH.1998. Cell division during floral morphogenesis in Antirrhinum majus. In: Francis D, Dudits D, Inzé D, eds. Plant cell division. Great Britain: Portland Press, 207222.
Doyle JJ, Doyle JL.1990. Isolation of plant DNA from fresh tissue. Focus 12, 1315.
Ferreira P, Hemerly A, Engler JD, Bergounioux C, Burssens S, Van Montagu M, Engler G, Inzé D.1994. Three discrete classes of Arabidopsis cyclins are expressed during different intervals of the cell cycle. Proceedings of the National Academy of Sciences, USA 91, 1131311317.
Forsburg SL, Nurse P.1991. Cell cycle regulation in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe. Annual Review of Cell Biology7, 227256.[Web of Science]
Fountain MD, Murray JAH, Beck E.1999. Nucleotide sequence of a cDNA encoding a cyclin D3 protein (Accession No. AJ011776) from suspension-cultured photoautotrophic Chenopodium rubrum L. cells. Plant Physiology 119, 363.
Fuerst RAUA, Soni R, Murray JAH, Lindsey K.1996. Modulation of cyclin transcript levels in cultured cells of Arabidopsis thaliana. Plant Physiology 112, 10231033.[Abstract]
Gillaspy G, Ben-David H, Gruissem W.1993. Fruits: a developmental perspective. The Plant Cell 5, 14391451.
Glotzer M, Murray AW, Kirschner MW.1991. Cyclin is degraded by the ubiquitin pathway. Nature349, 132138.[Medline]
Hemerly A, Bergounioux C, Van Montagu M, Inzé D, Ferreira P.1992. Genes regulating the plant cell cycle: isolation of a mitotic-like cyclin from Arabidopsis thaliana. Proceedings of the National Academy of Sciences, USA 89, 32953299.
Hemerly AS, Ferreira PCG, Van Montagu M, Inzé D.1999. Cell cycle control and plant morphogenesis: is there an essential link? BioEssays 21, 2937.
Huntley R, Healy S, Freeman D, et al. 1998. The maize retinoblastoma protein homologue ZmRb-1 is regulated during leaf development and displays conserved interactions with G1/S regulators and plant cyclin D (CycD) proteins. Plant Molecular Biology 37,155169.[Web of Science][Medline]
Jackson D.1992. In situ hybridization in plants. In: Gurr SJ, McPherson M, Bowles DJ, eds. Molecular plant pathology: a practical approach. Great Britain: IRL Press, 163174.
Joubès J, Phan T-H, Just D, Rothan C, Bergounioux C, Raymond P, Chevalier C.1999. Molecular and biochemical characterization of the involvement of cyclin-dependent kinase A during the early development of tomato fruit. Plant Physiology 121, 857869.
Koning AJ, Tanimoto EY, Kiehne K, Rost T, Comai L.1991. Cell-specific expression of plant histone H2A genes. The Plant Cell 3, 657665.
López-Gómez R, Gómez-Lim MA.1992. A method for extracting intact RNA fromfruits rich in polysaccharides using ripe mango mesocarp. HortScience 27, 440442.
Morgan DO.1995. Principles of CDK regulation. Nature 374, 131134.[Medline]
Nakagami H, Sekine M, Murakami H, Shinmyo A.1999. Tobacco retinoblastoma-related protein phosphorylated by a distinct cyclin-dependent kinase complex with Cdc2/cyclin D in vitro. The Plant Journal 18, 243252.[Web of Science][Medline]
Nash R, Tokiwa G, Anand S, Erickson K, Futcher AB.1988. The WHI+ gene of Saccharomyces cerevisiae tethers cell division to cell size and is a cyclin homolog. The EMBO Journal 7, 43354346.[Web of Science][Medline]
Nasmyth K.1996. At the heart of the budding yeast cell cycle. Trends in Genetics 12, 405412.[Web of Science][Medline]
Nigg EA.1995. Cyclin-dependent protein kinases: key regulators of the eukaryotic cell cycle. BioEssays 17, 471480.[Web of Science][Medline]
Norbury C, Nurse P.1992. Animal cell cycles and their control. Annual Review of Biochemistry 61, 441470.[Web of Science][Medline]
OBrien IEW, Smith DR, Gardner RC, Murray BJ.1996. Flow cytometric determination of genomic size in Pinus. Plant Science 115, 9199.
Rebers M, Kaneta T, Kawaide H, Yamaguchi S, Yang Y-Y, Imai R, Sekimoto H, Kamiya Y.1999. Regulation of gibberellin biosynthesis genes during flower and early fruit development of tomato. The Plant Journal 17, 241250.[Web of Science][Medline]
Rechsteiner M, Rogers SW.1996. PEST sequences and regulation by proteolysis. Trends in Biochemical Sciences 21, 267271.[Web of Science][Medline]
Renaudin J-P, Doonan JH, Freeman D, et al. 1996. Plant cyclins: a unified nomenclature for plant A-, B- and D-type cyclins based on sequence organization. Plant Molecular Biology 32,10031018.[Web of Science][Medline]
Riou-Khamlichi C, Huntley R, Jacqmard A, Murray JAH.1999. Cytokinin activation of Arabidopsis cell division through a D-type cyclin. Science 283, 15411544.
Sambrook J, Fritsch EF, Maniatis T.1989. Molecular cloning: a laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Setiady YY, Sekine M, Hariguchi N, Yamamoto T, Kouchi H, Shinmyo A.1995. Tobacco mitotic cylins: cloning, characterization, gene expression and functional assay. The Plant Journal 8, 949957.[Web of Science][Medline]
Sherr CJ.1993. Mammalian G1 cyclins. Cell 73, 10591065.[Web of Science][Medline]
Sherr CJ.1994. G1 phase progression: cycling on cue. Cell 79, 551555.[Web of Science][Medline]
Shimizu S, Mori H.1998. Analysis of cycles of dormancy and growth in pea axillary buds based on mRNA accumulation patterns of cell cycle-related genes. Plant and Cell Physiology 39, 255262.
Simon CJ, Weeden NF.1992. Molecular analysis and cloning of Malus ribosomal DNA. Journal of the American Society for Horticultural Science 117, 164168.
Smith MW, Ito M, Miyawaki M, Sato S, Yoshikawa Y, Wada S, Maki H, Nakagawa H, Komamine A.1997. Plant 21D7 protein, a nuclear antigen associated with cell division, is a component of the 26S proteasome. Plant Physiology 113, 281291.[Abstract]
Smulders MJM, Rus-Kortekaas W, Gilissen LJW.1994. Development of polysomaty during differentiation in diploid and tetraploid tomato (Lycopersicon esculentum) plants. Plant Science 97, 5360.
Soni R, Carmichael JP, Shah ZH, Murray JAH.1995. A family of cyclin D homologs from plants differentially controlled by growth regulators and containing the conserved retinoblastoma protein interaction motif. The Plant Cell 7, 85103.[Abstract]
Sorrell DA, Combettes B, Chaubet-Gigot N, Gigot C, Murray JAH.1999. Distinct cyclin D genes show mitotic accumulation or constant levels of transcripts in tobacco bright yellow-2 cells. Plant Physiology 119, 343352.
Swofford DL.1993. PAUP: Phylogenetic Analysis Using Parsimony, version 3. 1s. Champaign: Illinois Natural History Survey.
Traas J, Hülskamp M, Gendreau E, Höfte H.1998. Endoreduplication and development: rule without dividing. Current Opinion in Plant Biology 1, 498503.[Web of Science][Medline]
Xiong Y, Connolly T, Futcher B, Beach D.1991. Human D-type cyclin. Cell 65, 691699.[Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
F. Q. Fu, W. H. Mao, K. Shi, Y. H. Zhou, T. Asami, and J. Q. Yu A role of brassinosteroids in early fruit development in cucumber J. Exp. Bot., June 1, 2008; 59(9): 2299 - 2308. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, J.-Q. Yu, Q.-J. Ye, Z.-J. Zhu, and Z.-J. Guo Expression of CycD3 is transiently increased by pollination and N-(2-chloro-4-pyridyl)-N'-phenylurea in ovaries of Lagenaria leucantha J. Exp. Bot., April 1, 2003; 54(385): 1245 - 1251. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






