Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Vahala, T.
Right arrow Articles by Arnold, S. v.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vahala, T.
Right arrow Articles by Arnold, S. v.
Agricola
Right arrow Articles by Vahala, T.
Right arrow Articles by Arnold, S. v.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of Experimental Botany, Vol. 52, No. 358, pp. 1111-1115, May 1, 2001
© 2001 Oxford University Press


Short Communication

Two APETALA2-like genes of Picea abies are differentially expressed during development1

Tiina Vahala2,4, Bengt Oxelman3 and Sara von Arnold2

2 Department of Forest Genetics, Uppsala Genetic Center, SLU, Box 7027, SE-75007 Uppsala, Sweden
3 Department of Systematic Botany, Evolutionary Biology Center, Uppsala University, Norbyvägen 18D, SE-752 36 Uppsala, Sweden

Received 8 May 2000; Accepted 5 November 2000

Abstract

The EREBP/AP2 gene family codes for plant specific transcription factors. The first two gymnosperm genes of this family were isolated from Picea abies and shown to be structurally related, but not orthologous, to the angiosperm AP2-like genes. The two P. abies genes are differentially expressed in different organs and may be important developmental regulators.

Key words: Norway spruce, Picea abies, transcription factors, plant development.

Introduction

Many developmental events in plants are regulated by transcription factors. A group of recently discovered plant transcription factors involved in developmental regulation are the APETALA2 (AP2)-related proteins, which belong to the large AP2/EREBP family (Riechmann and Meyerowitz, 1998Go). A common feature of these proteins is a conserved AP2 domain (Jofuku et al., 1994Go), which is involved in DNA binding (Ohme-Tagaki and Shinski, 1995Go) and may also mediate protein–protein interactions (Okamuro et al., 1997Go). The AP2 domain is present as one repeat in the EREBP subfamily and as two repeats in the AP2 subfamily.

AP2-related genes have so far been reported from three eudicotyledonous and one monocotyledonous species. The gene function is known in four cases, based on mutant phenotypes. The first characterized gene of the subfamily, AP2, was isolated from Arabidopsis thaliana (L.) (Jofuku et al., 1994Go), and is known to affect meristem and floral organ identity as well as ovule and seed coat development. Recently, it was also shown to alter the inflorescence architecture, when ectopically expressed in Petunia hybrida Vilm. (Maes et al., 1999Go). Another gene from A. thaliana, AINTEGUMENTA (ANT) (Elliott et al., 1996Go; Klucher et al., 1996Go), is required for ovule development and also plays a role in floral organ growth. In Zea mays L., an AP2-related gene Glossy15 (Gl15) (Moose and Sisco, 1996Go) regulates the identity of leaf epidermal cells during the vegetative phase change (Evans et al., 1994Go) and the gene INDETERMINATE SPIKELET1 (IDS1) controls the spikelet meristem determination affecting the number of floral meristems (Chuck et al., 1998Go).

The members of the EREBP subfamily, which is named after the first isolated genes, Ethylene Response Element Binding Proteins (Ohme-Tagaki and Shinski, 1995Go), are mainly expressed during biological or physical stress, such as pathogen attack, ethylene or ABA treatment, drought, cold or cadmium treatment, and appear to play a role in stress responses.

The AP2/EREBP gene family has a limited distribution within the different taxa. Homeobox genes and MADS-box genes, many members of which also control plant development (Chan et al., 1998Go; Riechmann and Meyerowitz, 1997Go), exist in animals and yeast as well, whereas AP2/EREBP-related genes have so far only been found in the angiosperm group of higher plants. In this paper, isolation, sequence analyses and differential expression of two AP2-related genes of a gymnosperm, Picea abies (L.) Karst. (Norway spruce), are reported.

Materials and methods

Plant material
Seeds of P. abies were surface-sterilized for 15 min in 30% hygrogen peroxide and rinsed with water. They were germinated axenically in jars containing vermiculate wetted with culture medium of Ingestad (Ingestad, 1979Go). After 5 weeks of growth, the seedlings were planted in pots having stone wool as a support and watered with a commercial nutrient solution (Wallco). During the first 6 months the seedlings were grown at 20 °C in continuous light and after this they were inwintered by gradually shortening the daylength to 8 h during a 13-week period. Samples for RNA extraction were taken during the growth in continuous light and at the end of the inwintering period.

Embryogenic suspension cultures of the P. abies cell line 95:88:22 were initiated and maintained as described previously (Egertsdotter and von Arnold, 1993Go). Somatic embryos were matured on ABA-containing medium for 8 weeks, desiccated for 4 weeks and then germinated to obtain plantlets (Bozhkov and von Arnold, 1998Go).

Female and male cone buds were collected from a large wild-growing Norway spruce tree before pollination in May 1998 and needles from the same tree were collected in August 1998.

Gene isolation and sequence analysis
Total RNA was extracted from 7-week-old seedlings of P. abies (Chang et al., 1993Go). cDNA was synthesized using 5 µg total RNA, 500 ng primer (GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTTV) and 15 U M-MuLV reverse transcriptase in a 20 µl reaction. The cDNA template obtained was amplified with the Expand High Fidelity PCR System (Boehringer Mannheim) using the degenerate PCR primers (5'-CAGTAYMGMGGYGTYACNTT and 5'-CRAAGTTGGTNACNGCNTCYT), which were derived from conserved sequences in the AP2 domains of A. thaliana AP2 and Z. mays Gl15. To obtain fragments covering the missing parts of cDNA of the discovered gene, 3'- and 5'-RACE (rapid amplification of cDNA ends) was performed using the primer GACTCGAGTCGACATCGA and different gene specific primers. The amplified DNA fragments were cloned in the pGEM-T vector (Promega) and sequenced using the ABI377 automatic sequencer (Perkin Elmer). The results were analysed with programs Factura, AutoAssembler and MacVector.

Phylogenetic analysis was done to compare the two P. abies genes with nine structurally related angiosperm genes, ANT (from A. thaliana, accession number U40256), AP2 (A. thaliana, U12546), Gl15 (Z. mays, U41466), HAP2 (Hyacinthus orientalis, AF134116), IDS1 (Z. mays, AF048900), PHAP2A (P. hybrida, AF132001), PHAP2B (P. hybrida, AF132002), RAP2.7 (A. thaliana, AF003100), and ZMMHCF1 (Z. mays, Z47554). The amino acid and the nucleotide sequences in the regions covering the two AP2 domain repeats and the linker between them were aligned in MacVector and analysed using the minimum evolution optimality criterion in PAUP* (Swofford, 2000Go). Distances among DNA sequences were transformed according to the HKY85 model (Hasegawa et al., 1985Go), allowing rates to vary among sites following a gamma distribution with shape parameter set to 0.5. The tree-bisection-reconnection (TBR) swapping algorithm was performed on initial trees obtained by three random stepwise additions. For bootstrapping, 1000 pseudoreplicates were performed.

RT-PCR
Total RNA was prepared from different organs and cell cultures as above and treated with DNaseI. Then the first cDNA strand was synthesized as described above. The volume of the samples was adjusted to 50 µl and 1 µl was used in 25 µl PCR reactions with 32 cycles. Gene specific primers 5'-CTATTCGGGTTTTCATTCAG and 5'-AAGAGGGAACTTCACATGAC were used to detect the expression of PaAP2L1, and for detection of the PaAP2L2 transcript the gene specific primers 5'-ATGGCGATGTTCTCTCGTCA and 5'-GTTTGTGTTTCATGGCGTCT were used. The templates were also amplified with the primers 5'- CAGGATGTTGTCCACAGTGA and 5'-ACTCATGCTCCAGAGCACTA, specific for the P. abies cdc2 gene (Kvarnheden et al., 1995Go), as a control for the template quality. The PCR reactions were repeated at least twice with reproducible results.

Results and discussion

Using RT-PCR amplification and RACE, cDNA sequences have been isolated corresponding to two earlier uncharacterized genes of P. abies, Norway spruce. In the first PCR amplification degenerate primers were used that correspond to conserved regions of the A. thaliana AP2 gene and the Z. mays Gl15 gene. The DNA fragment amplified from P. abies contained a sequence highly homologous to the AP2 domain region of these previously published genes. Next, a fragment covering most of the AP2 domain region and the whole cDNA sequence downstream from it was isolated with 3'-RACE. When 5'-RACE was used to obtain the remaining part of the gene, a fragment corresponding to another AP2-related P. abies gene was first isolated. This fragment was probably amplified because the gene specific primers used in the first RACE reactions were located in the region that is highly conserved among the different members of the gene family. In the following RACE experiments, where gene specific primers located in less conserved regions of the two genes were used, the missing 5'- and 3'-regions were obtained.

For both of the genes, the RACE reactions yielded two overlapping fragments, but the overlap was mainly in the highly conserved region. To verify that the two fragments in each case originated from the same transcript, PCR primers corresponding to sequences in the untranslated 5'- and 3'-regions of the genes were designed. Using these primers, cDNA fragments covering the complete coding regions and most of the untranslated regions of both genes were amplified. They were then cloned and analysed to confirm the sequences.

The cDNA fragments obtained for the two genes contain one open reading frame each, one of 1593 bp and the other of 1899 bp, and they can code for proteins with calculated molecular weights of 58583 and 70253, respectively. The amino acid sequences show similarity to proteins of the AP2 subfamily of the AP2/EREBP family (Riechmann and Meyerowitz, 1998Go) (Fig. 1Go), the previously characterized members of which are plant transcription factors. The isolated genes were named PaAP2L1 (Picea abies APETALA2-LIKE 1) and PaAP2L2.



View larger version (115K):
[in this window]
[in a new window]
 
Fig. 1. (A–D) Alignment of amino acids in conserved regions of AP2-related proteins. (A) The AP2 domain-linker region, the two AP2 domain repeats underlined. (B–D) Conserved motifs found in other parts of the proteins. Identical amino acids are shaded in dark grey and chemically similar amino acids in light grey. (E) Simplified structure of AP2-related proteins. The shaded boxes A–D correspond to the conserved regions aligned in Fig. 1AGo–DGo, respectively. In each protein, the conserved elements are separated from each other and from the polypeptide ends by different numbers of amino acids, as shown in the white boxes.

 
Most conservation between PaAP2L1, PaAP2L2 and other APETALA2-like proteins is seen in the two repeats of the putative DNA-binding AP2 domain and in the linker region between them (Fig. 1AGo), and a putative nuclear localization signal is found in a typical position N-terminal of the AP2 domain. Outside these regions there is little conservation between the proteins, but three common amino acid motifs can be identified in several AP2-like proteins (Fig. 1BGo–DGo). One of them (Fig. 1BGo) is located between the amino terminus and the AP2 domain region and the other two (Fig. 1CGo, DGo) are between the AP2 domain and the carboxy terminus. The exact positions of the three conserved motifs differ between the proteins (Fig. 1EGo), but one of them is in all cases near the carboxy terminus of the second AP2 domain repeat. The functions of these motifs are not known, but they may be important for either the transcription activation capacity or the structure of the proteins. As the homology between PaAP2L1, PaAP2L2 and the known angiosperm genes is low outside the AP2 domain-linker region, the isolated P. abies genes cannot be regarded as orthologues of any known genes and their exact functions cannot be predicted from their sequences.

A phylogenetic analysis was based on the amino acid sequences in the AP2 domain-linker region (aligned in Fig. 1AGo) of PaAP2L1 and PaAP2L2 and the angiosperm proteins related to them (Fig. 2AGo). Of the analysed proteins, PaAP2L1 appears most closely related to A. thaliana AP2 (Jofuku et al., 1994Go) and P. hybrida PHAP2A (Maes et al., 2001Go), which is also supported by their partial similarity in the non-conserved regions of the proteins (not shown). PaAP2L2 groups in this analysis with A. thaliana RAP2.7 (Okamuro et al., 1997Go), the function of which is unknown. However, PaAP2L2 appears more closely related to the group PaAP2L1/AP2/PHAP2A and the Z. mays genes IDS1 and Gl15 appear more related to each other, when the analysis is based on nucleotide sequences instead of amino acids (Fig. 2BGo). The fact that genes from the same species are more related according to the nucleotide analysis than the corresponding proteins according to amino acid analysis may depend on saturation of nucleotide substitutions along branches, different codon preferences in the different species, or that the amino acid sequences have been subjected to parallel evolution owing to their putatively related functions, even if they are coded by genes with different evolutionary histories. There is presumably strong selection pressure against amino acid substitutions that would alter the DNA binding capacity of the proteins.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Phylogenetic trees of the AP2-subfamily based on (A) the amino acid sequences and (B) the nucleotide sequences in the AP2 domain-linker region aligned in Fig. 1AGo. Bootstrap values over 50% are shown by the branches.

 
The presence of the PaAP2L1 and PaAP2L2 transcripts in different types of organs and cell cultures of P. abies was studied using RT-PCR. The expression patterns of the two genes were found to differ from each other (Fig. 3Go). Expression of PaAP2L1 was seen in female cone buds, needles and stems, and it was also weakly detectable in male cone buds, but not in roots or embryogenic cell cultures. The PaAP2L1 transcript also appeared in somatic embryos after 1 d of germination and became more abundant after 8 d. PaAP2L2 transcripts were detected universally in vegetative organs (needles, stems and roots), in cell cultures and during somatic embryo germination, but the expression appeared weaker in either type of cone bud.



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 3. Detection of PaAP2L1 and PaAP2L2 transcripts by RT-PCR in needles (1), stems (2) and roots (3) of P. abies plantlets during the first growth season, in needles of 10-month-old inwintered plants (4), in needles of an adult tree (5), in female (6) and male (7) cone buds, in proliferating embryogenic cultures (8), in maturing somatic embryos (9), and in germinating somatic embryos after 1 d (10) and 8 d (11). Lane 12 shows negative controls for the PCR reactions and the lowest panel shows the expression of a reference gene, cdc2.

 
However, the detection of PaAP2L1 and PaAP2L2 expression in different organs or at different developmental stages is not sufficient for drawing conclusions on their functions in these organs. Gene expression or at least function may be localized to certain cell or tissue types and the genes may also be subject to post-transcriptional regulation and/or their products may require post-translational modifications or interaction with other factors to have an activity. Studies with other members of the AP2/EREBP family have shown that gene expression does not always correlate with a detectable function (Jofuku et al., 1994Go; Klucher et al., 1996Go; Chuck et al., 1998Go; Liu et al., 1998Go).

This is the first time that AP2/EREBP-like genes, earlier known only in angiosperms, have been reported in gymnosperms, which extends their presence to another, phylogenetically distant group of higher plants. Although the role of PaAP2L1 and PaAP2L2 is not known, their structural relationship with angiosperm genes controlling development and their differential expression patterns suggest that they are involved in regulating some developmental process(es) in P. abies and that the two genes have different functions.

Acknowledgments

This work was supported by the Swedish Council for Forestry and Agricultural Research and by the Nilsson-Ehle Foundation. We are grateful to Dr Steven Footitt for the cDNA samples from embryogenic cell cultures.

Notes

1 The nucleotide sequences reported here will appear in the GenBank, EMBL and DDBJ databases under the accession numbers AF253970 (PaAP2L1) and AF253971 (PaAP2L2). Back

4 To whom correspondence should be addressed. Fax: +46 18 673279. E-mail: Tiina.Vahala{at}sgen.slu.se Back

References

Bozhkov P, von Arnold S. 1998. Polyethylene glycol promotes maturation but inhibits further development of Picea abies somatic embryos. Physiologia Plantarum 104, 211–224.

Chan RL, Gago GM, Palena CM, Gonzalez DH. 1998. Homeoboxes in plant development. Biochimica et Biophysica Acta 1442, 1–19.[Medline]

Chang S, Puryear J, Cairney J. 1993. A simple and efficient method for isolating RNA from pine trees. Plant Molecular Biology Reporter 11, 113–116.

Chuck G, Meeley RB, Hake S. 1998. The control of maize spikelet meristem fate by the APETALA2-like gene indeterminate spikelet1. Genes and Development 12, 1145–1154.[Abstract/Free Full Text]

Egertsdotter U, von Arnold S. 1993. Classification of embryogenic cell-lines of Picea abies as regards protoplast isolation and culture. Journal of Plant Physiology 141, 222–229.

Elliott RC, Betzner AS, Huttner E, Oakes MP, Tucker WQJ, Gerentes D, Perez P, Smyth DR. 1996. AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth. The Plant Cell 8, 155–168.[Abstract]

Evans MMS, Passas HJ, Poethig RS. 1994. Heterochronic effects of Glossy15 mutation on epidermal-cell identity in maize. Development 120, 1971–1981.[Abstract]

Hasegawa M, Kishino M, Yano T. 1985. Dating the human-ape split by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22, 160–174.[ISI][Medline]

Ingestad T. 1979. Mineral nutrient requirements of Pinus silvestris and Picea abies seedlings. Physiologia Plantarum 45, 373–380.

Jofuku KD, den Boer BGW, Van Montagu M, Okamuro JK. 1994. Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. The Plant Cell 6, 1211–1225.[Abstract]

Klucher KM, Chow H, Reiser L, Fischer RL. 1996. The AINTEGUMENTA gene of Arabidopsis required for ovule and female gametophyte development is related to the floral homeotic gene APETALA2. The Plant Cell 8, 137–153.[Abstract]

Kvarnheden A, Tandre K, Engström P. 1995. A cdc2 homologue and closely related processed retropseudogenes from Norway spruce. Plant Molecular Biology 27, 391–403.[ISI][Medline]

Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. 1998. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. The Plant Cell 10, 1391–1406.[Abstract/Free Full Text]

Maes T, Van de Steene N, Zethof J, Karimi M, D'Hauw M, Mares G, Van Montagu M, Gerats T. 2001. Petunia Ap2-like genes and their role in flower and seed development. The Plant Cell 13, 229–244.[Abstract/Free Full Text]

Maes T, Van Montagu M, Gerats T. 1999. The inflorescence architecture of Petunia hybrida is modified by the Arabidopsis thaliana Ap2 gene. Developmental Genetics 25, 199–208.[ISI][Medline]

Moose SP, Sisco PH. 1996. Glossy15, an APETALA2-like gene from maize that regulates leaf epidermal cell identity. Genes and Development 10, 3018–3027.[Abstract/Free Full Text]

Ohme-Tagaki M, Shinski H. 1995. Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. The Plant Cell 7, 173–182.[Abstract]

Okamuro JK, Caster B, Villarroel R, Van Montagu M, Jofuku KD. 1997. The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis. Proceedings of the National Academy of Sciences, USA 94, 7076–7081.[Abstract/Free Full Text]

Riechmann JL, Meyerowitz EM. 1997. MADS domain proteins in plant development. Biological Chemistry 378, 1079–1101.

Riechmann JL, Meyerowitz EM. 1998. The AP2/EREBP family of plant transcription factors. Biological Chemistry 379, 633–646.[ISI][Medline]

Swofford DL. 2000. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4.0b4a. Sinauer Associates, Sunderland, Massachusetts.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol Biol EvolHome page
S. Kim, P. S. Soltis, K. Wall, and D. E. Soltis
Phylogeny and Domain Evolution in the APETALA2-like Gene Family
Mol. Biol. Evol., January 1, 2006; 23(1): 107 - 120.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
E. Magnani, K. Sjolander, and S. Hake
From Endonucleases to Transcription Factors: Evolution of the AP2 DNA Binding Domain in Plants
PLANT CELL, September 1, 2004; 16(9): 2265 - 2277.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Vahala, T.
Right arrow Articles by Arnold, S. v.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vahala, T.
Right arrow Articles by Arnold, S. v.
Agricola
Right arrow Articles by Vahala, T.
Right arrow Articles by Arnold, S. v.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?