Journal of Experimental Botany, Vol. 52, No. 360, pp. 1417-1425,
July 1, 2001
© 2001 Oxford University Press
Original Papers |
Arabidopsis thaliana ecotype Cvi shows an increased tolerance to photo-oxidative stress and contains a new chloroplastic copper/zinc superoxide dismutase isoenzyme
Departamento de Biología Vegetal, Facultad de Biología, Universidad de Alcalá, 28871-Madrid, Spain
Received 20 September 2000; Accepted 26 February 2001
| Abstract |
|---|
|
|
|---|
A new chloroplastic Cu/Zn-superoxide dismutase (SOD) isoenzyme was identified in Arabidopsis thaliana ecotype Cvi. Genetic analyses indicated that the new isoenzyme was encoded by a Cvi-specific allele of Csd2 that was named Csd2-2. Paraquat treatments of A. thaliana ecotypes Ler and Cvi resulted in higher levels of chloroplastic Cu/Zn-SOD activity in Cvi, suggesting that the Cvi isoenzyme has a higher stability and/or turnover rate than the Ler variant under photo-oxidative conditions. In addition, Cvi showed a higher tolerance to paraquat treatments. Hybrid plant populations expressing Csd2-2 also exhibited an increased tolerance, suggesting that the Cvi isoenzyme is one of the factors that contribute to a better fitness in photo-oxidative stress conditions.
Key words: Arabidopsis thaliana Cvi, chloroplast, Cu/Zn-superoxide dismutase, photo-oxidative stress.
| Introduction |
|---|
|
|
|---|
Plants are continually exposed to environmental fluctuations that lead to oxidative stress. Part of the damage caused by conditions such as intense light, drought, temperature stress, air pollutants etc. is associated with oxidative damage at the cellular level. The direct cause of oxidative stress is an increase in the production of reactive oxygen species (ROS). ROS are formed mainly in chloroplasts where, even in non-stressful conditions, light harvesting and electron transport lead to the formation of singlet oxygen and superoxide anion radical (Levine, 1999
To improve the tolerance to environmental oxidative stress it is essential to have an extensive knowledge of the components of the plant antioxidative system, their roles and relative contributions to the response to different oxidative stress situations. Plant cells contain a number of enzymatic and non-enzymatic ROS detoxifying agents that are distributed in most cellular compartments and have been well characterized (Bowler et al., 1992
; Casano et al., 1994
). Special attention has been given to superoxide dismutases (SOD, EC 1.15.1.1), which are key elements of the protective system since they catalyse the dismutation of superoxide radical to O2 and H2O2, a reaction that constitutes the first cellular defence against many oxidative stress situations (Bowler et al., 1994
). Plant cells contain three SOD types that differ in their metal ligands: Mn-, Fe- and Cu/Zn-SODs. Mn-SODs are located in mitochondria, Fe-SODs are in chloroplasts and Cu/Zn-SODs have been found in both cytosol and chloroplasts (reviewed in Bowler et al., 1994
). SOD activity has been reported to increase in response to stress conditions such as high irradiance, low temperature, air pollutants, etc. (Tsang et al., 1991
; Scandalios, 1993
). The importance of SODs in plant response to oxidative stress has been analysed using transgenic plants overexpressing Sod genes. This approach has yielded plants with enhanced resistance to oxidative stress, suggesting that SOD activity is an important factor in plant tolerance to such stress conditions (reviewed in Holmberg and Bülow, 1998
).
An alternative approach to study the plant antioxidative system would be to characterize plants from particular climatic regions. By comparing the results obtained with plants adapted to different environmental conditions, it would be possible to assess the importance of the different components of their antioxidative system in the response to particular oxidative stress conditions. The availability of Arabidopsis thaliana (L.) Heynh. ecotypes from distant regions of the world provides an easy experimental system for such an approach. A. thaliana was originally isolated in northern Europe (Rédei, 1992
), a region belonging to the temperate bioclimatic zone where the spring average monthly precipitation is around 100 mm, the annual global radiation is 300400x108 kJ ha-1 and average spring temperatures range from 221 °C (Schultz, 1995
; The Washington Post historical weather database in www.weatherpost.com). Ecotypes such as Ler, that have been traditionally used for genetic studies, come from that region. There are, however, many accessions in the seed banks that were collected in other geographical regions. Among them, the ecotype Cvi, from the Cape Verde islands, represents the accession that was isolated in the region closest to the ecuator (Lobin, 1983
). The Cape Verde islands are located in the tropical bioclimatic zone. Their situation in the Atlantic ocean, separated from the continent, gives rise to specific ecological conditions, so that Cape Verde is included in the Macaronesian floristic region, together with the Azores, Madeira and Canary islands (Takhtajan, 1986
). Cape Verde is the driest area of the region, with an average monthly precipitation around 9.4 mm during the rainy season. Average temperatures in that period range from 2328 °C, and the annual global radiation is around 700x108 kJ ha-1 (Schultz, 1995
; The Washington Post historical weather database in www.weatherpost.com). In short, Cvi, compared to Ler, is adapted to drier conditions, higher temperatures and higher irradiance levels. Not surprisingly, the response of Ler and Cvi to stress factors such as ozone or freezing has been reported to be different, and genetic approaches to determine the bases for these differences are in progress in several research groups (Alonso-Blanco and Koornneef, 2000
, and references therein; Rao et al., 2000
).
The different levels of freezing tolerance in Ler and Cvi suggest that their antioxidative systems might be adapted to different kinds of stress. Indeed, the sequence of the Csd2 gene, which encodes a chloroplastic Cu/Zn-SOD in A. thaliana ecotype Col (Kliebenstein et al., 1998
), is different in Ler and Cvi (Abarca et al., 1999
). In this report, a new chloroplastic Cu/Zn-SOD isoenzyme is described that is encoded by a Cvi-specific Csd2 allele. Ecotype Cvi and two hybrid plant populations expressing this allele show an increased tolerance to paraquat treatments, suggesting that chloroplastic Cu/Zn-SOD activity is one of the factors that contribute to a better fitness in photo-oxidative stress conditions.
| Materials and methods |
|---|
|
|
|---|
Plant material and growth conditions
Arabidopsis thaliana (L.) Heynh. ecotypes Columbia (Col), Landsberg erecta (Ler) and Cape Verdi Islands (Cvi) were provided by JM Martínez-Zapater (CIT-INIA, Spain). Seeds were stratified at 4 °C for 4 d on vermiculite:sphagnum (1 : 1, v:v) and then transferred to a growth chamber at 23 °C with a light/dark regime of 16/8 h. Light intensity was 100 µE m-2 s-1. Plants were irrigated with mineral nutrient solution (Haughn and Somerville, 1986
SOD activity assays
Whole leaf extracts were prepared as follows: leaves were homogenized (approximately 2 ml of homogenization buffer g-1 of fresh leaves) in 0.1 M potassium phosphate buffer pH 7.0; 1 mM EDTA; 1% polyvinylpyrrolidone; 0.1% Triton X-100; 15% glycerol; 0.1 M phenylmethanesulphonyl fluoride; 0.05% ß-mercaptoethanol (v/v). The mixture was centrifuged at 10 000 g for 5 min. For SOD activity assays, 40100 µg protein samples were fractionated by native PAGE at 4 °C, in 12% acrylamide gels containing 10% glycerol. Activity was detected in gels by the photochemical nitro-blue tetrazolium staining method (Beauchamp and Fridovich, 1971
). Inhibitor studies to identify the different kinds of SOD isoforms were as described earlier (Kanematsu and Asada, 1990
). For quantification of relative activities, chloroplastic Cu/Zn-SOD isoforms were separated from cytosolic Cu/Zn-SOD in 1016% acrylamide gradient gels. Activities were quantified with a digital image analyser (UVP Easy, Cambridge, UK) and expressed as percentages of the values obtained in control samples. In all cases, activities were quantified within the linear range of detection. Statistical significance of SOD activity variations was determined by analysis of variance of results from linear regression analyses.
DNA analysis
Total DNA was extracted from leaves as described previously (Doyle and Doyle, 1990
). For Csd2 polymorphism detection, a 0.64 kbp DNA fragment containing a region of the Csd2 genomic sequence was amplified with primers D2-6 (ACAATAGTGGACAATCAGGTT) and D2-2 (GACAAGATCAACACAGTAGAC), and digested with HindIII. When Ler genomic DNA was used as a template, two fragments of 0.55 and 0.09 kbp were obtained. When the template DNA was from Cvi, the digestion yielded three fragments of 0.35, 0.20 and 0.09 kbp. A weak 0.29 kbp band that was sometimes observed in Cvi samples corresponded to a partially digested fragment.
Photo-oxidative stress treatments
All treatments were carried out using plants in the vegetative growth phase. Low temperature incubations were performed at 4 °C under the light/dark regime of the growth chamber, and were timed so that treated plants were always collected at the end of the light period. For high light intensity treatments, plants were transferred to constant illumination at 200 µE m-2 s-1.
For foliar paraquat applications, 50100 plants were sprayed with 014 µM paraquat solutions in 0.01% Tween-20 and transferred to continuous high light (200 µE m-2 s-1) for 24 h. Plants were subsequently returned to standard growth conditions in the growth chamber, where they were maintained for a further 7 d. During that time, seriously affected plants became completely dry and surviving plants developed new leaves.
For the in vitro paraquat tolerance test, plants were cut at the crown and placed in Petri dishes containing 0400 nM paraquat in 0.01% Tween-20, so that all the leaves were in contact with the liquid. Dishes were placed under continuous high light (200 µE m-2 s-1) for 24 h. After the treatments, chlorophylls were extracted in 95% ethanol at 4 °C in the dark and quantified as described earlier (Lichtenthaler, 1987
). Chlorophyll contents were referred to fresh weight and expressed as percentages of the values obtained for uncut, untreated plants. Alternatively, treated plants were collected and used to extract RNA for expression studies or to evaluate SOD activity. Control experiments were performed to ensure that cutting the plants did not cause increases in Csd2 expression or SOD activity levels.
RNA extraction and Northern blot analysis
Total RNA was obtained by phenol/SDS extraction and LiCl precipitation (Ausubel et al., 1990
). RNA was fractionated in formaldehyde gels, transferred to Zeta-Probe nylon membranes (BioRad) and hybridized following standard procedures (Sambrook et al., 1989
). Digoxigenin probe labelling and detection were performed according to the protocol provided by the manufacturer (Roche Molecular Biochemicals). For hybridizations with Csd2, a 0.75 kpb cDNA fragment from Ler containing the complete open reading frame of Csd2-1 was PCR-amplified with primers D2-1 (CGTCCGCTCATTTCCTCCAA) and D2-2 (see above). To detect Pal1 transcripts, a 1.0 kb DNA fragment containing part of the coding region (Leyva et al., 1995
) was amplified and used as a probe. Relative transcript levels were quantified with a digital image analyser (see above) and corrected for total RNA loading. Indicated numeric data are means of three independent experiments.
| Results |
|---|
|
|
|---|
A new allele of Csd2 encodes a chloroplastic Cu/Zn-SOD isoform characteristic of Arabidopsis thaliana ecotype Cvi
Four major SOD activities have been described in total leaf protein extracts from A. thaliana ecotype Col using native PAGE enzyme assays (Kliebenstein et al., 1998
|
To analyse the genetic basis of the different SOD profiles in Ler and Cvi, hybrid plants resulting from crosses between the two ecotypes were generated, and SOD isoenzymatic patterns were analysed in protein extracts from individual plants of the F1 and F2 progeny. In F1 plants from crosses in either direction, three putative chloroplastic Cu/Zn-SODs were detected (Fig. 2A
|
Chloroplastic Cu/Zn-SOD is encoded by the Csd2 gene in A. thaliana ecotype Col (Kliebenstein et al., 1998
Csd2 responds to mild photo-oxidative stress
Chloroplastic SODs are involved in the defense against light-related oxidative stress (Bowler et al., 1992
; Scandalios, 1993
; Casano et al., 1994
). In order to study Csd2 response to mild photo-oxidative stress conditions in Ler and Cvi, its expression was analysed in plants exposed to low temperature or incubated under high light intensity (see Materials and methods). Northern hybridization revealed differences between the two ecotypes (Fig. 3A
, upper panel). In control plants, the relative transcript levels were higher in Cvi (lanes a and j). As a response to the treatments, Csd2 mRNA levels evolved differently in the two ecotypes. Low temperature induced a progressive mRNA accumulation in Ler that reached a 6-fold after 48 h (lanes ae). In the case of Cvi, low temperature resulted in a reduction in the relative transcript levels, with a transient recovery at 24 h (lanes kn). Incubation under high light intensity resulted in a weak mRNA increase in Ler (lanes fi), while it caused a decrease in Cvi after 24 h (lanes or). Thus, Ler responded to both stress conditions with an increase in Csd2 mRNA. In contrast, reduced transcript levels were detected in Cvi after the treatments. To ensure that these differences were not due to a higher response threshold in Cvi, that is, that the mild stress treatments were causing stress to both ecotypes, the RNA samples were hybridized with a Pal1 probe. Pal1 encodes a phenylalanine ammonia-lyase and responds to low temperature and light treatments in A. thaliana (Leyva et al., 1995
). In this case, transcript increases were detected in both ecotypes after the treatments (Fig. 3A
, middle panel). The response was higher in Cvi, with maximum Pal1 mRNA accumulation after a 36 h exposure to low temperature, indicating that the mild stress conditions used here were sufficient to elicit a response in this ecotype.
|
As a complementary assay to study Csd2 response to low temperature and high light intensity, chloroplastic Cu/Zn-SOD activity was analysed in Ler and Cvi after the treatments (Fig. 3B
A comparison between Csd2 mRNA levels and chloroplastic Cu/Zn-SOD activity after the photo-oxidative treatments revealed further differences between the two ecotypes. In Ler, a 6-fold increase in mRNA level after low temperature treatments resulted in a 35% activity increase. Upon exposure to high light, the activity decreased even though mRNA levels increased. In the case of Cvi, mRNA levels decreased after the treatments, yet the activity increased up to 40% at low temperature or remained constant after high light exposure. Thus, Ler seemed to require higher Csd2 mRNA levels than Cvi to maintain or increase the activity under mild photo-oxidative stress conditions. This disparity suggests a complex regulation of chloroplastic Cu/Zn-SOD activity, and could be related to an unequal stability of the two isoenzymes in photo-oxidative conditions (Casano et al., 1997
) or to the effect of other protective mechanisms.
Tolerance to paraquat is higher in Cvi
The different response of the two chloroplastic Cu/Zn-SOD isoenzymes to mild photo-oxidative conditions suggested that Ler and Cvi could have different levels of tolerance to photo-oxidative stress. To analyse that possibility the effect of paraquat, a herbicide that causes a light-dependent increase in the production of superoxide radical in chloroplasts, was tested in Ler and Cvi. Plants sprayed with different concentrations of paraquat were incubated for 24 h under high light (see Materials and methods), and then returned to the growth chamber for 1 week. The evaluation of survival rates showed reductions in Ler plant populations treated with as low as 8 µM paraquat (Fig. 4A
). In contrast, concentrations up to 12 µM had no effect in Cvi survival, indicating that Cvi had a higher tolerance to in vivo foliar applications of the herbicide.
|
To analyse the different response of Ler and Cvi to paraquat treatments further, an in vitro tolerance test was devised in which plants were cut at the crown, placed in Petri dishes containing paraquat solutions and exposed to high light for 24 h (see Materials and methods). Tolerance to the herbicide was evaluated by measuring chlorophyll contents after the treatments. In cut plants incubated in the absence of paraquat, a 20% chlorophyll reduction was detected in both Ler and Cvi (Fig. 4B
Csd2-1 and Csd2-2 could be associated to different levels of paraquat tolerance
Since the chloroplasts are the main target of paraquat toxicity in the light, chloroplastic Cu/Zn-SOD activity could be important for the herbicide tolerance. The in vitro tolerance test was used to analyse Csd2 response to paraquat treatments in Ler and Cvi. Northern hybridization showed that Csd2 mRNA levels suffered similar variations in the two ecotypes (Fig. 5A
). Incubation with 50 nM paraquat induced an increase in the relative mRNA levels (5-fold in Ler and 2-fold in Cvi). Transcript levels were maintained close to control values at 100200 nM paraquat, and were reduced by half at 300 nM paraquat. At all paraquat concentrations, the relative mRNA levels were higher in Cvi.
|
Chloroplastic Cu/Zn-SOD activity was also analysed in paraquat-treated plants (Fig. 5B
|
| Discussion |
|---|
|
|
|---|
The ecotypes Ler and Cvi represent two A. thaliana varieties adapted to different climatic regions and, therefore, equipped to respond to particular stress situations. In this report, the response of Ler and Cvi to photo-oxidative stress was studied using paraquat treatments under high light intensity. The data presented here indicate that Cvi can tolerate higher herbicide concentrations after either foliar applications or in vitro treatments. In as much as paraquat enhances the effect of exposure to high light intensity, these results are consistent with the idea that Cvi is better adapted than Ler to respond to high irradiance, and suggest that this difference could be related to a higher superoxide detoxifying capability in Cvi chloroplasts in that particular stress situation.
The chloroplastic Cu/Zn-SOD activities detected in Ler and Cvi leaf extracts were found to be encoded by two Csd2 alleles. Expression analyses in the two ecotypes showed that the basal Csd2 transcript levels were higher in Cvi. Analysis of Csd2 response to mild photo-oxidative stress revealed that, in both ecotypes, incubation at low temperature induced an increase in chloroplastic Cu/Zn-SOD activity. This increase was supported by an increase in the mRNA level in Ler, but not in Cvi. On the other hand, high light treatments induced higher mRNA levels in Ler, while lower mRNA levels were detected in Cvi. However, the activity suffered a moderate decrease in Ler and was maintained at control levels in Cvi. This apparent disparity could be explained by a different stability of the two isoenzymes. Damage to Cu/Zn-SOD by ROS has been well documented (Casano et al., 1997
). ROS increases associated to the mild stress treatments used in this work could have a higher detrimental effect in the activity of the Ler variant. Thus, higher mRNA levels would be required in Ler to increase the enzymatic activity at low temperature and to maintain the activity levels in high light intensity.
Upon exposure to the strong photo-oxidative conditions caused by paraquat, the differences in Csd2 response between Ler and Cvi were more conspicuous. Treatments with 50 nM paraquat induced mRNA increases in both ecotypes that were higher in Ler, 100200 nM paraquat had no apparent effect in Ler and caused a slight reduction in Cvi, and 300 nM paraquat caused a strong reduction in the mRNA levels in both Ler and Cvi. In contrast, the relative enzymatic activity decreased in Ler at all paraquat concentrations, while it increased in Cvi plants exposed to paraquat concentrations up to 200 nM, and was maintained at control values at higher herbicide concentrations. Again, these results suggested a higher stability of the Cvi isoenzyme under stress conditions.
The possibility of obtaining plants homozygous for the two Csd2 alleles in different genetic backgrounds provided the means to study a possible contribution of chloroplastic Cu/Zn-SOD to paraquat tolerance. Analysis of four homozygous F3 populations revealed that plants containing Csd2-2 were more tolerant than plants containing Csd2-1, suggesting that the two chloroplastic Cu/Zn-SOD isoenzymes could be associated to different levels of paraquat tolerance. This is consistent with the fact that paraquat toxicity is mediated by superoxide production. Tolerance to paraquat has been correlated with high levels of antioxidative enzymes in resistant biotypes (Amsellem et al., 1993
; Scandalios, 1993
) and transgenic plants (Sen Gupta et al., 1993
a; Perl et al., 1993
; Slooten et al., 1995
; Van Camp et al., 1996
; McKersie et al., 2000
). The role of Csd2-2 in paraquat tolerance could be based on several possibilities. Since the mRNA levels are higher in Cvi, both in untreated plants and after treatments with any herbicide concentration, a higher turnover rate of the protein could be afforded in this ecotype in conditions in which, due to the production of superoxide radical, the stability of the enzyme is reduced (Casano et al., 1997
). In addition, a different stability of the two isoenzymes under stress-related ROS increases, as suggested by the disparity between mRNA and activity levels after the treatments, could contribute to the better performance of the Cvi isoenzyme. A similar situation has been described in maize: superoxide increases induced by cercosporin led to accumulation of Sod transcripts, but SOD activity remained constant, suggesting that protein turnover might play a key role in the response of the different SODs to ROS (Scandalios, 1993
). Lastly, an increased tolerance to paraquat in plants containing Csd2-2 could also be related to biochemical peculiarities of its gene product, since the two amino acids that are different in the Cvi isoenzyme are located near the two poles of the active centre (Bordo et al., 1994
) and map in regions that seem to be important for the enzymatic activity (Abarca et al., 1999
).
Analysis of paraquat tolerance in F3 homozygous plant populations revealed that Csd2-2 plants were more sensitive than Cvi, indicating that other factors might contribute to paraquat tolerance. This is to be expected, since high levels of SOD activity should be complemented with an efficient hydrogen peroxide detoxifying system in order to offer an adequate protection. This has been reported in transgenic plants overexpressing SOD, in which increased levels of peroxidase activity were detected (Sen Gupta et al., 1993
b). A similar situation has been described for a Conyza bonariensis variety with high levels of tolerance to paraquat; in this plant, the genetic basis of herbicide tolerance was found to be restricted to a single gene that controls the expression of both SOD and peroxidase encoding genes (Amsellem et al., 1993
). In addition, differences in paraquat tolerance have been related to higher glutathione reductase activity (Amsellem et al., 1993
) or to a reduced paraquat uptake (Preston et al., 1992
). These and other factors, such as a higher capability of excess light energy dissipation, or higher concentrations of superoxide scavengers such as phenolic compounds, hydroquinones or carotenoids (Foyer et al., 1994
; Salin, 1987
) could contribute to the natural tolerance of Cvi to paraquat treatments.
Paraquat tolerance has also been related to peroxidase and NADH dehydrogenase activities in barley chloroplasts (Casano et al., 1999
). The chloroplastic NADH dehydrogenase complex, which is encoded in the plastid genome by the Ndh genes, seems to be involved in the poising of the cyclic electron transport and in the protection against photo-oxidative stress (Casano et al., 2000
). Differences in the Ler and Cvi sequences for the NdhG gene have been previously described (Martínez et al., 1997
). Whether these differences have an effect on the activity of the complex remains to be proved; if that were the case, this could be an additional source of enhanced tolerance in Cvi.
In addition to differences at the chloroplast level, other peculiarities of the Cvi ecotype could be involved in its high tolerance to photo-oxidative stress. After ozone exposure, a high level of salicylic acid (SA) accumulation that leads to a hypersensitive response-like cell death has been reported for Cvi (Rao and Davis, 1999
). This effect has been attributed to a reduced sensitivity to jasmonic acid, which acts as a negative modulator of the SA response pathway (Rao et al., 2000
). A direct relationship between ozone and photo-oxidative stress responses seems unlikely, since ROS production after ozone decomposition takes place mainly in the apoplast (Sandermann, 1996
) and the oxidative burst associated to SA accumulation appears to initiate at the plasma membrane level (Chen et al., 1993
). However, since hydrogen peroxide can diffuse among subcellular compartments, cross-talk between light- and defence-signalling pathways probably occurs. In fact, a systemic acquired resistance-like response to high light has been described in A. thaliana that appears to involve hydrogen peroxide signalling (Karpinski et al., 1999
). It is not known whether this response involves SA. If that were the case, it would be interesting to quantify SA accumulation in Ler and Cvi after photo-oxidative stress.
In summary, the results presented here show that two A. thaliana ecotypes adapted to different light regimes have different levels of tolerance to paraquat that could be related, at least in part, to the possession of specific chloroplastic Cu/Zn-SOD isoenzymes. Further genetic analyses will be required to confirm this point. The identification of other features that contribute to the better response of Cvi to light-related stress will make it possible to improve the tolerance of less tolerant ecotypes such as Ler, and will lead to a better understanding of the mechanisms used by plants to respond to oxidative stress.
| Acknowledgments |
|---|
The authors wish to thank C Bartolomé and J Alvarez for advice on bioclimatic and floristic regions, L Casano for helpful hints on SOD activity assays and C Díaz-Sala for critical reading of the manuscript. This work was supported by the Spanish DGICYT (Grant PB96-0675).
| Notes |
|---|
1 To whom correspondence should be addressed. Fax: +34 91 8855066. E-mail: mdolores.abarca{at}uah.es
2 Present address: IBMCP, CSIC-UPV, Camino de Vera s/n, 46022-Valencia, Spain. ![]()
| References |
|---|
|
|
|---|
Abarca D, Martín M, Sabater B. 1999. Two genomic sequences encoding chloroplastic Cu/Zn superoxide dismutases from Arabidopsis thaliana ecotypes Ler (Acc. No. AJ238521) and Cvi (Acc. No. AJ238522). PGR99-089. Plant Physiology 120, 933.
Alonso-Blanco C, Koornneef M. 2000. Naturally occurring variation in Arabidopsis: an underexploited resource for plant genetics. Trends in Plant Science 5, 2229.[Web of Science][Medline]
Amsellem Z, Jansen MAK, Driesenaar ARJ, Gressel J. 1993. Developmental variability of photo-oxidative stress tolerance in paraquat-resistant Conyza. Plant Physiology 103, 10971106.[Abstract]
Ausubel FH, Brent R, Kingston RE, Moore DD, Smith JA, Seidman JG, Struhl K. (eds) 1990. Current protocols in molecular biology. Greene Publishing Associates, 4.3.1.
Beauchamp CO, Fridovich I. 1971. Superoxide dismutase. Improved assay and an assay applicable to acrylamide gels. Analytical Biochemistry 44, 276287.[Web of Science][Medline]
Bordo D, Djinovic K, Bolognesi M. 1994. Conserved patterns in the Cu,Zn superoxide dismutase family. Journal of Molecular Biology 238, 366386.[Web of Science][Medline]
Bowler C, Van Montagu M, Inzé D. 1992. Superoxide dismutase and stress tolerance. Annual Review of Plant Physiology and Plant Molecular Biology 43, 83116.[Web of Science]
Bowler C, Van Camp W, Van Montagu M, Inzé D. 1994. Superoxide dismutase in plants. Critical Reviews in Plant Science 13, 199218.
Casano LM, Gómez LD, Lascano HR, González CA, Trippi VS. 1997. Inactivation and degradation of CuZn-SOD by active oxygen species in wheat chloroplasts exposed to photo-oxidative stress. Plant Cell Physiology 38, 433440.
Casano LM, Martín M, Sabater B. 1994. Sensitivity of superoxide dismutase transcript levels and activities to oxidative stress is lower in mature-senescent than in young barley leaves. Plant Physiology 106, 10331039.[Abstract]
Casano LM, Martín M, Zapata JM, Sabater B. 1999. Leaf age- and paraquat concentration-dependent effects on the levels of enzymes protecting against photo-oxidative stress. Plant Science 149, 1322.
Casano LM, Zapata JM, Martín M, Sabater B. 2000. Chlororespiration and poising of cyclic electron transport. Plastoquinone as electron transporter between thylakoid dehydrogenase and peroxidase. Journal of Biological Chemistry 275, 942948.
Chen Z, Silva H, Klessig DF. 1993. Active oxygen species in the induction of plant systemic acquired resistance by salicylic acid. Science 262, 18831886.
Doyle JJ, Doyle JL. 1990. Isolation of plant DNA from fresh tissue. BRL Focus 12, 1315.
Foyer CH, Lelandais M, Kunert KJ. 1994. Photo-oxidative stress in plants. Physiologia Plantarum 92, 696717.
Haughn G, Somerville C. 1986. Sulfonylurea-resistant mutants of Arabidopsis thaliana. Molecular and General Genetics 204, 430434.
Holmberg N, Bülow L. 1998. Improving stress tolerance in plants by gene transfer. Trends in Plant Science 3, 6166.
Kanematsu S, Asada K. 1990. Characteristic amino acid sequences of chloroplast and cytosol isozymes of CuZn-superoxide dismutase in spinach, rice and horsetail. Plant Cell Physiology 31, 99112.
Karpinski S, Reynolds H, Karpinska B, Winsgle G, Creissen G, Mullineaux P. 1999. Systemic signaling and acclimation in response to excess excitation energy in Arabidopsis. Science 284, 654657.
Kliebenstein DJ, Monde RA, Last RL. 1998. Superoxide dismutase in Arabidopsis: an eclectic enzyme family with disparate regulation and protein localization. Plant Physiology 118, 637650.
Levine A. 1999. Oxidative stress as a regulator of environmental responses in plants. In: Lerner HR, ed. Plant responses to environmental stresses. New York: Marcel Dekker Inc, 247264.
Leyva A, Jarillo JA, Salinas J, Martínez-Zapater JM. 1995. Low temperature induces the accumulation of phenylalanine ammonia-lyase and chalcone synthase mRNAs of Arabidopsis thaliana in a light-dependent manner. Plant Physiology 108, 3946.[Abstract]
Lichtenthaler HK. 1987. Chlorophylls and carotenoids: pigments of photosynthetic membranes. Methods in Enzymology 148, 350382.
Lobin W. 1983. The occurrence of Arabidopsis thaliana in the Cape Verde Islands. Arabidopsis Information Service 20, 119123.
Martínez P, López C, Roldán M, Sabater B, Martín M. 1997. Plastid DNA of five ecotypes of Arabidopsis thaliana: sequence of ndhG gene and maternal inheritance. Plant Science 123, 113122.
McKersie BD, Murnaghan J, Jones KS, Bowley SR. 2000. Ironsuperoxide dismutase expression in transgenic alfalfa increases winter survival without a detectable increase in photosynthetic oxidative stress tolerance. Plant Physiology 122, 14271437.
Perl A, Perl-Treves R, Galili S, Aviv D, Shalgi E, Malkin S, Galun E. 1993. Enhanced oxidative stress defense in transgenic potato expressing tomato Cu,Zn superoxide dismutases. Theoretical and Applied Genetics 85, 568576.
Preston C, Holtum JAM, Powles SB. 1992. On the mechanism of resistance to paraquat in Hordeum glaucum and H. leporinum. Delayed inhibition of photosynthetic O2 evolution after paraquat application. Plant Physiology 100, 630636.
Rao MV, Lee H, Creelman RA, Mullet JE, Davis KR. 2000. Jasmonic acid signaling modulates ozone-induced hypersensitive cell death. The Plant Cell 12, 16331646.
Rao MV, Davis KR. 1999. Ozone-induced cell death occurs via two distinct mechanisms in Arabidopsis: the role of salicylic acid. The Plant Journal 17, 603614.[Web of Science][Medline]
Rédei GP. 1992. A heuristic glance at the past of Arabidopsis genetics. In: Koncz C, Chua N, Schell J, eds. Methods in Arabidopsis research. Singapore: World Scientific Publishing Co Pte Ltd, 115.
Salin ML. 1987. Toxic oxygen species and protective systems of the chloroplast. Physiologia Plantarum 72, 681689.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd edn. New York: Cold Spring Harbor Laboratory Press.
Sandermann H. 1996. Ozone and plant health. Annual Review of Phytopathology 34, 347366.[Web of Science][Medline]
Scandalios JG. 1993. Oxygen stress and superoxide dismutases. Plant Physiology 101, 712.[Web of Science][Medline]
Schultz J. 1995. The ecozones of the world. Berlin: Springer-Verlag.
Sen Gupta A, Heinon JL, Holaday AS, Burke JJ, Allen RD. 1993a. Increased resistance to oxidative stress in transgenic plants that overexpress chloroplastic Cu/Zn superoxide dismutase. Proceedings of the Natural Academy of Sciences, USA 90, 16291633.
Sen Gupta A, Webb RP, Holaday AS, Allen RD. 1993b. Overexpression of superoxide dismutase protects plants from oxidative stress. Induction of ascorbate peroxidase in superoxide dismutase-overexpressing plants. Plant Physiology 103, 10671073.[Abstract]
Slooten L, Capian K, Van Camp W, Van Montagu M, Sybesma C, Inzé D. 1995. Factors affecting the enhancement of oxidative stress tolerance in transgenic tobacco overexpressing manganese superoxide dismutase in the chloroplasts. Plant Physiology 107, 737750.[Abstract]
Takhtajan A. 1986. Floristic regions of the world. Los Angeles, CA: University of California Press.
Tsang EdWT, Bowler C, Hérouart D, Van Camp W, Villarroel R, Genetello C, Van Montagu M, Inzé D. 1991. Differential regulation of superoxide dismutases in plants exposed to environmental stress. The Plant Cell 3, 783792.
Van Camp W, Capiau K, Van Montagu M, Inzé D, Slooten L. 1996. Enhancement of oxidative stress tolerance in transgenic tobacco plants overproducing Fe-superoxide dismutase in chloroplasts. Plant Physiology 112, 17031714.[Abstract]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
H.-S. Jung and K. K. Niyogi Quantitative Genetic Analysis of Thermal Dissipation in Arabidopsis Plant Physiology, June 1, 2009; 150(2): 977 - 986. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Taji, M. Seki, M. Satou, T. Sakurai, M. Kobayashi, K. Ishiyama, Y. Narusaka, M. Narusaka, J.-K. Zhu, and K. Shinozaki Comparative Genomics in Salt Tolerance between Arabidopsis and Arabidopsis-Related Halophyte Salt Cress Using Arabidopsis Microarray Plant Physiology, July 1, 2004; 135(3): 1697 - 1709. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






