Journal of Experimental Botany, Vol. 52, No. 360, pp. 1437-1446,
July 1, 2001
© 2001 Oxford University Press
Original Papers |
Expression of six expansin genes in relation to extension activity in developing strawberry fruit
1 Horticulture Research International, Wellesbourne, Warwick CV35 9EF, UK
2 The Plant Laboratory, Department of Biology, University of York, York YO10 5YW, UK
Received 10 November 2000; Accepted 7 March 2001
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Expansins are proteins which have been demonstrated to induce cell wall extension in vitro. The identification and characterization of six expansin cDNAs from strawberry fruit, termed FaExp3 to FaExp7, as well as the previously identified FaExp2 is reported here. Analysis of expansin mRNAs during fruit development and in leaves, roots and stolons revealed a unique pattern of expression for each cDNA. FaExp3 mRNA was present at much lower levels than the other expansin mRNAs and was expressed in small green fruit and in ripe fruit. FaExp4 mRNA was present throughout fruit development, but was more strongly expressed during ripening. FaExp5 was the only clone to show fruit specific expression which was up-regulated at the onset of ripening. FaExp6 and FaExp7 mRNAs were present at low levels in the fruit with highest expression in stolon tissue. During fruit development FaExp6 had the highest expression at the white, turning and orange stages whereas expression of FaExp7 was highest in white fruit. The expression profiles of FaExp2 and FaExp5 in developing fruit were similar except that FaExp2 was induced at an earlier stage. Analysis of expansin protein by Western blotting using an antibody raised against CsExp1 from cucumber hypocotyls identified two bands of 29 and 31 kDa from developing fruit. Protein extracts from developing fruit were assayed for extension activity. Considerable rates of extension were observed with extracts from ripening fruit, but no extension was observed with protein from unripe green fruit. These results demonstrate the presence of at least six expansin genes in strawberry fruit and that during ripening the fruit acquires the ability to cause extension in vitro, characteristic of expansin action.
Key words: Expansins, strawberry, fruit, leaves, cell wall extension.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
In order for a plant cell to grow it must be continually able to modify and expand its cell wall, which is composed of cellulose microfibrils tethered together with hemicelluloses and embedded in a matrix of pectins and structural proteins (Carpita and Gibeaut, 1993
). Changes in the primary cell wall are not only required for cell expansion but also for developmental events, such as fruit softening. Transient disassembly of the cell wall during growth permits extension without permanently weakening the wall (Shieh and Cosgrove, 1998). In ripening fruits, irreversible changes in wall architecture (Rose and Bennett, 1999) result in progressive loss of firmness. In strawberry fruit, growth occurs throughout development with an increase in cell volume of approximately 1000-fold accompanied by a corresponding 100-fold increase in wall area (Knee et al., 1977). This enormous enlargement relies on the ability of the cell wall to expand or ‘loosen’. Growth continues during the ripening phase in which there is a dramatic alteration in fruit texture. The firmness of strawberry fruit declines throughout development, partly as a result of swelling of the cell wall as the hydration status increases. The degradative changes associated with ripening involve multiple structural changes within the cell wall that affect pectins and the cellulose–xyloglucan framework (Redgwell et al., 1997) resulting in increased polyuronide and hemicellulose solubilization (Knee et al., 1977). In strawberry there is a substantial loss of fruit firmness with an 11-fold decrease between unripe and ripe fruit (Redgwell et al., 1997). Of the possible candidate genes involved in cell wall metabolism, cellulase and pectate lyase are the only genes isolated from strawberry fruit which show increased expression during ripening (Medina-Escobar et al., 1997; Manning, 1998; Llop-Tous et al., 1999; Trainotti et al., 1999). However, as yet their role in fruit ripening has not been established.
A class of proteins called expansins have been shown to promote cell wall loosening in vitro and to catalyse wall extension and stress relaxation in a pH-dependent manner (McQueen-Mason et al., 1992). They do not appear to be conventional enzymes because their loosening effect on the wall is reversible and does not increase with time. Biochemical and biophysical data indicate that expansins bind to the surface of cellulose microfibrils thereby disrupting the hydrogen bonds formed with xyloglucan molecules and so allowing the cell wall to extend. Expansin mRNA has been identified in a range of growing vegetative tissues including cucumber hypocotyls, Arabidopsis (Shcherban et al., 1995), rice internodes (Cho and Kende, 1997), tomato meristems (Fleming et al., 1997) and cotton fibres (Shimizu et al., 1997). In Arabidopsis, more than 20 expansin open reading frames have been identified (Cosgrove, 1998) and it has become clear that expansins are represented by a substantial multigene family (McQueen-Mason and Rochange, 1999). In fruits, expansin cDNAs have been isolated from apricot (GenBank accession number AF038815, unpublished data), sweet cherry (GenBank accession number AAG13983, unpublished data) tomato, and strawberry (Rose et al., 1997; Civello et al., 1999). In tomato, the expression of six expansin genes has been described in unripe and ripening fruit suggesting a role for expansins in fruit development and ripening (Brummell et al., 1999a). The expansin cDNA, FaExp2, characterized in strawberry fruit is ripening related and encodes a protein that is most closely related to expansins expressed in apricot fruit (Civello et al., 1999).
Further evidence of the role of expansins in fruit softening is shown by Brummel et al. where transgenic tomato plants overexpressing LeExp1 produced softer fruit than wild-type plants (Brummel et al., 1999b). Overexpression of LeExp1 altered the depolymerization of structural hemicelluloses whereas polyuronide depolymerization was not directly affected.
The identification of six expansin cDNAs (FaExp2–7) with unique expression patterns in developing strawberry fruit is reported here. In addition, it is demonstrated that expansins from ripening strawberry fruit are able to catalyse extension.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Plant materials
Day neutral strawberry plants (Fragaria ananassa Duch. cv Brighton) were grown in a glasshouse with a 12/18 °C night/day regime. Fruit were harvested at 4, 7 and 10 d post-anthesis (DPA) and collectively termed small green fruit, 13 and 16 DPA (large green fruit) and at the white (19 DPA), turning, orange, ripe, and overripe stages. The seeds (achenes) were harvested from small green and ripe fruit. Young, rapidly expanding and mature fully expanded leaf and stolon tissue was harvested from the same plants. Stolon growth was measured daily to determine the expanding and the fully expanded regions. To collect root tissue, strawberry plants were grown hydroponically in Murashige and Skoog nutrient solution with aeration. Expanding root tissue was harvested from the last 2 cm of root tissue including the root tips. Fully expanded root tissue was harvested from the upper section of the roots. All tissue was frozen immediately in liquid nitrogen and stored at –75 °C.
RNA extraction
Extraction of total RNA from fruits and other tissues was as previously described (Manning, 1991).
Cloning of expansin cDNAs
First strand cDNA was synthesized from total RNA (5 µg) isolated from small green fruit (7 DPA) and from orange stage fruit using M-MLV reverse transcriptase (SuperScript Preamplification System) primed with oligo (dT)12-18 according to the manufacturer's instructions (Life Technologies). Expansin sequences were amplified by polymerase chain reaction (PCR) using degenerate primers designed to conserved amino acid domains (sense primer, 5' ATGGGIGGIGCNTGYGGNTA 3'; antisense primer, 5' TGCCARTTYTGNCCCCARTT 3'; I=deoxy inosine; N=A, T, C or G, Y, C or T, R, A or G). Amplification was performed with cDNA synthesized from 0.5 µg total RNA for 35 cycles (94 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min) and one cycle of 72° C for 10 min. Reaction products were analysed on a 1.5% (w/v) agarose gel and a single band of 
500 bp was purified by Qiaex II (Qiagen, Crawley UK) and either used directly as a probe or cloned into pPCR-Script (Stratagene). The putative expansin clones were grouped by their Sau 3A restriction digest patterns. Analysis of the products on a 2% agarose gel indicated there were six groups of cDNAs. Clones representing each group were sequenced using AmpliTaq DNA polymerase FS (Perkin-Elmer, Warrington UK) and analysed on an Applied Biosystems model 377 sequencer. To check for cross hybridization between the expansin clones, Southern blots were prepared with Sau 3A restriction digests of each clone and probed sequentially with the expansin sequences.
Northern blot analysis
Total RNA (10 µg) from expanding and expanded leaves, roots, stolons and fruit from different stages of development was separated on a 1.4% agarose–formaldehyde gel and capillary blotted onto Hybond N+ membrane (Roche). The blots were probed with cDNA fragments obtained from day 7 and orange stage fruit radiolabelled with [
-32P]-dCTP (3000 Ci mmol-1) by random priming using DNA polymerase (Bioline). Blots were hybridized at 65 °C using 0.25 M sodium phosphate pH 7.4, 7% SDS. The final wash was with 0.2xSSC, 0.1% SDS at 65 °C before exposure to film.
Analysis of expansin gene expression by RT-PCR
Total RNA (0.1 ng or 100 ng) was used as a template for first strand cDNA synthesis using RT-PCR beads (Amersham-Pharmacia Biotech) with 100 nM oligo d(T)12-18 primer. Reactions were incubated at 42 °C for 30 min and denatured at 95 °C for 5 min prior to the addition of expansin gene specific PCR primers (100 nM). Amplification conditions were 35 cycles of 95 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min followed by one cycle of 72 °C for 10 min. Control reactions, to test for contamination by genomic DNA, were prepared by inactivating the reverse transcriptase at 95 °C for 10 min before addition of the gene specfic primers. The integrity of the RNA was assessed in control RT-PCR reactions using 0.05 pg RNA and 200 nM 18 S rRNA primers (Clontech). The amplification products were purified using a PCR purification kit (Qiagen) and sequenced as described above. The following expansin gene specific primers were used (5'
3'): FaExp3 sense TCCCTGGCACCATTGTT, antisense gctctcctgcatc tcaccc; FaExp4 sense GGGTTGGGGTGTGGTTCT, antisense GATGCCTCCCCTTCTTCTG; FaExp5 sense TCTCGCCCAGCCCGTCTTCCAGCAT, antisense TGGGTTGCCAATTAGTTCTT; FaExp6 sense TGCGCAAACGACCCGAAC, antisense CACGCTCACCCTCACGAT; FaExp7 sense TAACTTCGCGCAGGCCAATGACAAT; antisense CTTT CTTCACACATGGTACTCTTCT; FaExp2 sense CGGGTCTTGCTACGAAATGCGA, antisense AATGAGACGGGGACGATACCAGCG. PCR products were separated on 2% agarose gels and stained with ethidium bromide. To verify that amplification was in the linear range, RT-PCR reactions were run with each template and primer pair. A sample of the reaction was removed every third cycle starting from cycle 20 and blotted onto Hybond N+ membrane in 0.4 M NaOH. The blots were probed with either an 18S rRNA probe or a mixture of the six expansin cDNAs radiolabeled with [-32P]-dCTP (3000 Ci mmol-1) by random priming using DNA polymerase (Bioline). The blots were then scanned with a PhosphorImager (Molecular Dynamics) and the data analysed using ImageQuant 3.3 software (Molecular Dynamics).
Extraction of expansin protein
Attempts to solubilize expansin activity from cell wall preparations of strawberry fruit tissue by extracting with a high salt buffer (McQueen-Mason et al., 1992) were unsuccessful. The reason why this extraction procedure is unsuitable for strawberry fruit is not known but may be related to the mixture of cell wall polysaccharides or the high phenolic content present in the fruit. The method reported here provides a source of active expansin protein. De-achened fruit (5 g) were ground to a powder in a pestle and mortar with liquid nitrogen and macerated further with 25 ml of extraction buffer ( 10 mM 3-[N-morpholino] propanesulphonic acid (MOPS)/NaOH buffer, pH 7.0, 0.5% (w/v) cetyl trimethylammonium bromide (CTAB), 30% (w/v) glycerol) until the mixture reached room temperature. The extract was then centrifuged at 10 000 g for 5 min at room temperature in a Sorvall RC5B centrifuge. The supernatant was decanted and clarified by filtration through Miracloth (Calbiochem-Novabiochem). Three volumes of acetone (–20 °C) were added to the supernatant, mixed and incubated on ice for 5 min. The mixture was centrifuged at 5000 g for 10 min at 4 °C, the supernatant discarded and the protein pellet washed once with three volumes of acetone (–20 °C) before drying under vacuum. The dried pellets were stored at –20 °C. For comparison on Western blots, total proteins were also extracted by heating in 2xSDS sample buffer (0.125 M Tris-HCl, 4% [w/v] SDS, 20% [v/v] glycerol and 10% [v/v] 2-mercaptoethanol, pH 6.8) according to Laemmli (Laemmli, 1970). SDS-extracted protein was precipitated with 10% trichloroacetic acid (TCA), pelleted by centrifugation and dissolved in 0.1 M NaOH. Protein was assayed by the method of Bradford using a commercial kit (Pierce, Chester UK) and bovine serum albumin as standard (Bradford, 1976).
Assay of expansin activity
Expansin activity was assayed as described earlier (McQueen-Mason et al., 1992) using a custom made extensometer. The protein extracted from 5 g of fruit tissue was resuspended to a concentration of 1.5 mg protein ml-1 in assay buffer (50 mM sodium acetate, pH 4.5). Aliquots of extract (100 µl) were assayed using 2 mm wide strips of cellulose/xyloglucan composite material derived from Acetobacter culture (Whitney et al., 1995, 2000) extended under a constant force of 11 g. Composite material was chosen instead of plant cell wall material as it is a uniform substrate and allows higher rates of extension (data not shown). The basal rate of extension of the composite was determined in assay buffer without protein for 15 min. The buffer was replaced by protein solution and extension monitored for a further 15 min. Expansin activity was expressed as the difference in extension rates before and after the addition of protein. Results are the mean±SE of three to six measurements for each treatment.
SDS-PAGE and Western blotting
Equal amounts of protein (20 µg) extracted by the CTAB and SDS methods were separated on a 12% (w/v) polyacrylamide gel (Laemmli, 1970). Proteins extracted by the CTAB method were denatured in 1xSDS sample buffer prior to SDS-PAGE. Proteins extracted by the SDS method were loaded directly. The separated proteins were blotted onto Hybond-P membrane (Amersham) at 4 °C in 25 mM Tris, 190 mM glycine and 20% (v/v) methanol. The membrane was blocked with 10% (v/v) horse serum, 2 mM sodium azide in phosphate buffered saline–Tween (PBS-T, 80 mMNa2HPO4, 20 mM NaH2PO4, 100 mM NaCl, pH 7.5, 0.05% Tween-20) overnight at 4 °C. To detect expansin polypeptides the membrane was incubated for 2 h with cucumber anti-expansin antibodies (Li et al., 1993) diluted 1:1000 in blocking solution. The membrane was washed 3x5 min with PBS-T followed by 3x5 min washes with Tris buffered saline–Tween (TBS-T, 20 mM Tris, pH 7.6, 136 mM NaCl, 0.05% Tween-20). Polypeptides cross-reacting with the expansin antiserum were located with mouse anti-rabbit antibody coupled to alkaline phosphatase (Sigma). The conjugate was diluted 1:1000 with blocking solution in TBS-T and incubated with the membrane for 2 h. After 4x5 min washes in TBS-T the blot was developed with bromochloroindolyl phosphate toluidine salt/nitro blue tetrazolium chloride and the reaction stopped with 10 mM EDTA.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Expression of expansin genes in strawberry tissues
To study the role of expansins during fruit development, expansin cDNAs were cloned from rapidly expanding unripe fruit (7 DPA) and from ripening (orange stage) fruit. Using degenerate primers designed to conserved amino acid domains, amplification products of the expected size (
500 bp) were obtained by RT-PCR from day 7 and orange stage fruit. Initially, this mixture of expansin cDNAs from each stage was used as a probe to examine expansin gene expression in developing fruits and in other strawberry tissues (expanding and expanded leaves, roots and stolons). The probe from the day 7 fruit detected expansin transcripts in all tissues examined and throughout fruit development (Fig. 1A). However, these mRNAs were more abundant in small green fruit (4, 7 and 10 DPA), turning, orange and ripe fruit with lower expression in large green fruit (13 and 16 DPA) and white fruit (19 DPA). The size of the transcript detected by the unripe probe ranged from 1.6 kb in day 4 fruit to 1.5 kb at other stages of fruit development. This probe hybridized strongly to RNA from expanding leaves and less strongly to RNA from stolons (both expanding and expanded). There was also some hybridization to RNA from expanding roots, but only low levels of expression were found in the other tissues. In leaves, the size of the transcript was 1.4–1.5 kb whilst in roots and stolons a transcript of 1.4 kb was present.
|
The Northern blot probed with the PCR product amplified from day 7 fruit was reprobed with the PCR product from orange stage fruit. This produced a quite different pattern of expression that indicated very low levels of transcript in young fruit. Transcript levels increased markedly in the fruit from the white to the orange stage and remained constant thereafter. The fruit transcript appeared as a doublet of 1.2 kb and 1.6 kb under high stringency (Fig. 1B
). Transcripts of similar sizes were detected in leaf, stolon and root tissue but at much lower levels. The results from the Northern analysis demonstrate that fruit development is associated with at least two different patterns of expansin gene expression and that expansin mRNA is also present in other strawberry tissues, principally expanding leaves and expanding and fully expanded stolons.
Molecular characterization of strawberry expansins
Restriction digests of cloned PCR products indicated that several expansin genes are expressed in strawberry fruit. In total, six different expansin PCR products were identified (Fig. 2), ranging in length from 464–494 bp. Two of the clones were isolated from day 7 unripe fruit (FaExp3 and FaExp4) and four from orange stage fruit (FaExp5–FaExp7 and FaExp2). Clone FaExp2 has been previously identified in ripe fruit (Civello et al., 1999). All six clones showed sequences typical for alpha-expansins (Shcherban et al., 1995).
|
The expansins from unripe fruit (FaExp3 and FaExp4) share 84% amino acid identity and are closely related to expansins isolated from fruit of other species over the equivalent region (Fig. 3
). FaExp3 shares 85% similarity with the tomato fruit expansin, LeExp5, (Brummell et al., 1999a) whilst FaExp4 is highly related (98%) to PavExp2 from sweet cherry (Prunus avium, Genbank AAG13983, unpublished data). LeExp5 mRNA is maximally expressed in unripe tomato during green fruit expansion and maturation (Brummel et al., 1999a, b) whereas FaExp3 is expressed slightly earlier in fruit development during cell division and expansion.
|
Interestingly, the ripening related expansins, FaExp2 and FaExp5, have a higher amino acid similarity to FaExp7 (96%) and AtExp1 (88%) from Arabidopsis thaliana (Shcherban et al., 1995
) respectively, than to each other. In addition, FaExp2 and FaExp7 are highly related to the apricot fruit expansins PaExp2 (Genbank AF038815, unpublished data) and PaExp1 (Genbank U93167, unpublished data) respectively, being 94% and 95% similar over the equivalent region. The truncated amino acid sequences of the fruit expansins PaExp1, PaExp2, PavExp1 and the strawberry expansins FaExp2 and FaExp7 represent a separate cluster which is phylogenetically distinct from the tomato expansins. Strawberry, apricot and sweet cherry belong to the family Rosaceae, but at present no expression data are available for the apricot and sweet cherry expansins. FaExp1 and FaExp6 have least homology with the other strawberry expansins, with FaExp6 being most closely related (91%) to AtExp6 (Shcherban et al., 1995).
RT-PCR analysis of expansin transcript accumulation
Southern analysis of the expansin clones revealed cross hybridization between different expansins and therefore an RT-PCR approach was used to characterize the expression of specific expansin genes. The procedure (Halford et al., 1999), enabled DNA fragments of specific size to be amplified from the six different expansin genes using gene specific primers and either 0.1 ng or 100 ng of total RNA template. All amplifications were in the linear range between 35 and 41 cycles (Fig. 4) and 35 cycles were used as standard. Control RT-PCR reactions using 18S rRNA primers were also linear between 35 and 41 cycles and produced a single band of similar intensity with all samples confirming that equivalent amounts of template were present (Fig. 5). The conditions for all RT-PCR reactions were identical except for clone FaExp3 in which 1000-fold more template was necessary in order to visualize the products. The RT-PCR products were sequenced and all show identity with the corresponding cDNAs.
|
|
Figure 5
shows the expression profiles of all six genes analysed on 2% (w/v) agarose gels and stained with ethidium bromide. Each gene had a unique expression profile during fruit development and differed in its expression in other tissues. The spatial expression of FaExp3 and FaExp4 was similar in leaf, root and stolon tissues but could be distinguished quantitatively by the vast difference in the amount of template required for PCR amplification. Amplification from a plasmid DNA template under identical conditions produced PCR fragments of similar intensity for each cDNA. This suggests that the higher quantity (1000-fold) of total RNA template required to amplify FaExp3 is due to the low abundance of the corresponding message. Clones FaExp3 and FaExp4 had distinct patterns of expression in the fruit, FaExp3 being most abundant in small green fruit then declining sharply to undetectable levels in the white, turning and orange stages before being expressed again in ripe fruit. The expression of FaExp4 was very different, its transcript being present in high levels at all stages of fruit development, but with a small reduction in large green fruit. Genes encoding FaExp6, FaExp7 and FaExp2 identified from orange stage fruit were expressed at lower levels in leaf, root and stolon tissues than FaExp3 and FaExp4 from unripe fruit. The only fruit specific expansin identified, FaExp5, was expressed in the later stages of fruit development from turning to fully ripe. In contrast, FaExp6 and FaExp7 were most highly expressed in fully expanded stolon tissue. During fruit development, FaExp6 was more abundant at the white, turning and orange stages whilst FaExp7 was mostly expressed in white and turning fruit. Clone FaExp2 exhibited weak expression in leaves, stolons, roots, and green fruit but was strongly up-regulated in fruit from the white stage onwards. Collectively, the RT-PCR data support the Northern analysis data (Fig. 1) in that expansins are mostly expressed during the later stages of development when anthocyanin production begins and the fruit start to ripen.
Analysis of expansin activity and protein levels in developing fruit
In order to correlate expansin action with the expression of expansin genes, acid-induced extensibility was measured in protein extracts from all stages of fruit development using a cellulose/xyloglucan cell wall composite (Whitney et al., 1995, 2000). When protein extracts were prepared from strawberry fruits using the method described earlier (McQueen-Mason et al., 1992) it was not possible to obtain measurable extension activity. The CTAB method described in this paper dramatically increased extension activity extracted from the fruit. Extension was greatest with extracts from orange, ripe and overripe fruit with some extension observed in white and turning fruit (Fig. 6A). Little extension was present in fruit before the turning stage or in achenes. However, the results from Northern and RT-PCR analysis indicate that expansins are also expressed in small green fruit. To test the possibility that inhibitors of extension may have been present in unripe fruit, tissue from ripe and small green unripe fruits was mixed in equal proportions before extraction and assay. There was no significant reduction in extension activity of ripe fruit when co-extracted with small green unripe fruit (Fig. 6B). Therefore, it seems unlikely that inhibitors are affecting the assay of unripe fruit leading to a loss of extension. It may be that expansins expressed in unripe tissues do not effectively disrupt the cellulose/xyloglucan bonds, but instead act upon a different cell wall component. As yet a suitable substrate has not been identified.
|
The protein extracted by the CTAB method for the extension assays was also analysed by Western blotting. The cucumber expansin (CsExp1) antibody bound to protein bands of
29 and 31 kDa that differed in their relative abundance during fruit development (Fig. 7A). The 31 kDa band increased in extracts from fruit 7 DPA to 16 DPA and then declined at the white and turning stages. This band was not present in fruit 4 DPA, orange, ripe or overripe fruit. The smaller band (29 kDa) first appeared in white fruit and then increased until the ripe stage with similar amounts in overripe fruit. Both expansin protein bands were present in white and turning fruit. In order to assess the efficiency of the CTAB extraction method, total protein from all stages of fruit development was also prepared using a standard SDS method (Laemmli, 1970). Analysis of the SDS extracts by Western blotting showed a similar pattern of immunostaining to that of the CTAB extracts (Fig. 7B). However, the CTAB method appears to be more effective than SDS at extracting immunoreactive material from unripe fruit whereas the reverse was true for fruit at the white stage. These data confirm the validity of using the CTAB method for extracting active expansin protein.
|
The presence of two immunoreactive bands with different sizes and distinct patterns of distribution during fruit development correlates with the expression data from RT-PCR and Northern analysis. The initial increase in the 29 kDa expansin protein at the onset of ripening parallels the extension data suggesting this is likely to be the ripening related expansin encoded by FaExp2. The subsequent expression of FaExp5 may contribute to the increasing intensity of the 29 kDa band as the fruit ripens.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Six expansin cDNAs from strawberry fruit have been identified and characterized, two from rapidly expanding unripe fruit (7 DPA) and four from ripening (orange stage) fruit. Each expansin has a unique expression profile during fruit development and some are also expressed in other tissues such as leaves, roots and stolons. The patterns of expression during fruit development fall into three main groups: (a) those that show an up-down-up profile (FaExp3 and FaExp4); (b) those that show a down-up-down profile (FaExp6 and FaExp7) and (c) those which increase during development (FaExp5 and FaExp2). Civello et al. also observed a ripening-related expression profile for FaExp2 (Civello et al., 1999
). The up-down-up pattern of expression has been observed with other genes expressed during strawberry fruit development (Manning, 1998). Interestingly, the clones which share the greatest homology do not necessarily have similar expression profiles. For example, FaExp7 and FaExp2 have 96% amino acid identity and yet are expressed at very different times during fruit development.
The deduced amino acids sequences indicate that all the strawberry clones are conventional alpha-expansins with the characteristic eight conserved cysteine residues. Expansins represent a highly conserved gene family but the functions of numerous isoforms expressed in fruit remain to be determined. It is interesting that the same number of expansins have been identified in strawberry and tomato fruit with the likelihood, that other, more lowly expressed genes remain to be discovered. In strawberry, growth of the receptacle after petal fall is initially due to a combination of cell division and cell expansion. Cell division ceases after about 7 d, the subsequent growth of the fruit being accounted for by a massive increase in cell expansion (Knee et al., 1977). Fruit growth and the ripening associated softening are two overlapping processes in strawberry that may require different modifications of the plant primary cell wall. Growth itself is likely to involve a series of integrated cell wall transitions.
Expansins may have a similar role in the enlargement of strawberry fruit to those expressed in vegetative tissues (Cosgrove, 1997). The two clones expressed in unripe fruit (FaExp3 and FaExp4) are also expressed in expanding and expanded leaf, root and stolon tissues. However, these two clones are not just expressed in small green fruit. Clone FaExp4 is highly expressed throughout development whilst FaExp3, although silent for much of the fruit's development, is also expressed in ripe fruit. Since FaExp4 appears to be expressed in all tissues and throughout fruit development it may have a general role in cell wall modification during plant growth. FaExp6 and FaExp7 expression is enhanced in white and turning fruits and these developmental stages represent a transition to ripening that is marked by an increase in anthocyanin production. This phase is also characterized by changes in the abundance of numerous mRNAs (Manning, 1998). Auxin is essential for strawberry fruit growth but also represses ripening and the expression of many ripening-enhanced genes (Manning, 1994). The effects of auxin on expansin gene expression have not been addressed in this study, but the expression of FaExp2 (Civello et al., 1999) was reported to be insensitive to auxin. Expression profiles of the ripening-related clones FaExp2 and FaExp5 indicate that these expansins might be responsible for the increased extension activity observed from ripening fruit. They may have a key role in the terminal phase of cell wall modification.
Similarities between patterns of expression are evident for some of the expansins from strawberry and tomato (Brummell et al., 1999a) during equivalent stages of fruit development. However, none of the tomato expansins so far described have expression profiles resembling those of FaExp3 and FaExp 4 in strawberry (Brummell et al., 1999a). This is not surprising considering that tomato and strawberry fruits differ fundamentally in their growth characteristics and cell wall composition. In tomato, growth ceases prior to ripening and softening is accompanied by substantial pectin depolymerization (Huber and O'Donoghue, 1993) whereas in strawberry, growth continues and there is little change in the molecular size distribution of pectins during ripening (Huber, 1984). In both fruits, growth and ripening are tightly regulated events whose co-ordination may depend on the timing and degree of expression of individual expansin genes. Although the temporal regulation of expansins in strawberry has been described, little is known about their spatial distribution in fruits, another factor that could explain the complexity of this family of proteins.
The roles of different fruit expansins remain uncertain. Suppression of the abundance of the ripening-specific expansin Exp1 in transgenic tomatoes to low levels (3% of wild-type levels) resulted in an increase in fruit firmness at all stages of ripening (Brummel et al., 1999b). However, although firmer than the controls, the transgenic fruit still showed the characteristic increase in softening during the ripening stages. Therefore, some of the components necessary for progressive cell wall breakdown appear to act independently of this expansin. The accessibility of depolymerases to cell wall polymers may be regulated indirectly by expansins. In strawberry, ripening-enhanced enzymes such as cellulase (Llop-Tous et al., 1999) and pectate lyase (Medina-Escobar et al., 1997) may act synergistically with expansins to effect complete cell wall disassembly.
One of the key questions that remains unanswered is how do expansins differ in their functional properties? It was not possible to measure extension activity in unripe green fruit although transcripts of several expansins were present at this stage. Failure to detect extension could have been due to (a) low activity of the protein, (b) poor extraction efficiency or (c) inappropriate substrate used in the assay. Western analysis suggests that there is less expansin protein in unripe green fruit compared to ripening fruit and this alone could account for the apparent lack of activity observed with the extension assay. It has been suggested that the likely substrate of the cucumber expansin (CsExp1) in cell walls is the cellulose xyloglucan matrix, but that other (1–4) ß-glucan to (1–4) ß-glucan hydrogen bonded contacts can also serve as substrates (Whitney et al., 2000). Expansin action was also shown to be greater on composites containing long chain xyloglucans than on those containing shorter chains (Whitney et al., 2000). Expression of the corresponding recombinant proteins will enable a better understanding of their properties.
Evidence here and elsewhere is accumulating for the increasingly complex nature of the proteins involved in cell wall modification. This is exemplified by the expansins and unravelling the roles of these proteins in fruit development will be a major challenge for the future.
|
Acknowledgments |
|---|
This work was funded by a United Kingdom Biotechnology and Biological Sciences Research Council ROPA grant (KM). We thank Dan Cosgrove (Penn State University) who kindly provided the CsExp1 antibody, Sarah James and Matthieu Pinel for technical assistance. We thank Andrew Thompson for critical reading of the manuscript. The sequences reported in this paper have been submitted to the GenBank database and the accession numbers are FaExp3, AF226700; FaExp4, AF226701; FaExp5, AF226702; FaExp6, AF226703; and FaExp7, AF226704.
|
Notes |
|---|
3 To whom correspondence should be addressed. Fax: +44 1789 470552. E-mail: elizabeth.harrison{at}hri.ac.uk
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principal of protein–dye binding. Analytical Biochemistry 72, 248–254.[Web of Science][Medline]
Brummell DA, Harpster MH, Dunsmuir P. 1999a. Differential expression of expansin gene family members during growth and ripening of tomato fruit. Plant Molecular Biology 39, 161–169.[Web of Science][Medline]
Brummell DA, Harpster MH, Civello PM, Palys JM, Bennett AB, Dunsmuir P. 1999b. Modification of expansin protein abundance in tomato fruit alters softening and cell wall polymer metabolism during ripening. The Plant Cell 11, 2203–2216.
Carpita N, Gibeaut DM. 1993. Structural models of primary cell walls in flowering plants: consistency of molecular structure with the physical properties of the walls during growth. The Plant Journal 3, 1–30.[Web of Science][Medline]
Cho HT, Kende H. 1997. Expression of expansin genes is correlated with growth in deepwater rice. The Plant Cell 9, 1661–1671.[Abstract]
Civello PM, Powell ALT, Sabehat A, Bennett AB. 1999. An expansin gene expressed in ripening strawberry fruit. Plant Physiology 121, 1273–1279.
Cosgrove DJ. 1997. Assembly and enlargement of the primary cell wall in plants. Annual Review of Cell and Developmental Biology 13, 171–201.[Web of Science][Medline]
Cosgrove DJ. 1998. Expansins in Arabidopsis: gene family overview and expression patterns of two -expansin genes. 8th International Cell Wall Meeting, Abstract 7.01.
Fleming AJ, McQueen-Mason S, Mandel T, Kuhlemeier C. 1997. Induction of leaf primordia by the cell wall protein expansin. Science 276, 1415–1418.
Halford WP, Falco VC, Gebhardt BM, Carr DJJ. 1999. The inherent quantitative capacity of the reverse transcription-polymerase chain reaction. Analytical Biochemistry 266, 181–191.[Web of Science][Medline]
Huber DJ. 1984. Strawberry fruit softening: the potential roles of polyuronides and hemicelluloses. Journal of Food Science 49, 1310–1315.
Huber DJ, O'Donoghue EM. 1993. Polyuronides in avocado (Persea americana) and tomato (Lycopersicon esculentum) fruits exhibit markedly different patterns of molecular weight downshifts during ripening. Plant Physiology 102, 473–480.[Abstract]
Knee M, Sargent JA, Osborne DJ. 1977. Cell wall metabolism in developing strawberry fruits. Journal of Experimental Botany 28, 377–396.
Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 277, 680–685.
Li Z-C, Durachko DM, Cosgrove DJ. 1993. An oat coleoptile wall protein that induces wall extension in vitro and that is antigenically related to a similar protein from cucumber hypocotyls. Planta 191, 349–356.
Llop-Tous I, Dominguez-Puigjaner E, Palomer X, Vendrell M. 1999. Characterization of two divergent endo-ß-1,4-glucanase cDNA clones highly expressed in the nonclimacteric strawberry fruit. Plant Physiology 119, 1415–1421.
Manning K. 1991. Isolation of nucleic acids from plants by differential solvent precipitation. Analytical Biochemistry 195, 45–50.[Web of Science][Medline]
Manning K. 1994. Changes in gene expression during strawberry fruit ripening and their regulation by auxin. Planta 194, 62–68.
Manning K. 1998. Isolation of a set of ripening-related genes from strawberry: their identification and possible relationship to fruit quality traits.Planta 205, 622–631.[Web of Science][Medline]
McQueen-Mason S, Durachko SJ, Cosgrove DJ. 1992. Two endogenous proteins that induce cell wall extension in plants. The Plant Cell 4, 1425–1433.
McQueen-Mason S, Rochange F. 1999. Expansins in plant growth and development: an update on an emerging topic. Plant Biology 1, 19–25.
Medina-Escobar N, Cardenas J, Moyano E, Caballero JL, Munoz-Blanco J. 1997. Cloning, molecular characterization and expression pattern of a strawberry ripening-specific cDNA with sequence homology to pectate lyase from higherplants. Plant Molecular Biology 34, 867–877.[Web of Science][Medline]
Redgwell RJ, MacRae E, Hallett I, Fischer M, Perry J, Harker R. 1997. In vivo and in vitro swelling of cell walls during fruit ripening. Planta 203, 162–173.
Rose JKC, Bennett AB. 1999. Cooperative disassembly of the cellulose-xyloglucan network of plant cell walls: parallels between cell expansion and fruit ripening. Trends in Plant Science 4, 176–183.[Web of Science][Medline]
Rose JKC, Lee HH, Bennett AB. 1997. Expression of a divergent expansin gene is fruit-specific and ripening-regulated. Proceedings of the National Academy of Sciences, USA 94, 5955–5960.
Shcherban TY, Shi J, Durachoko DM, Guiltinan MJ, McQueen-Mason SJ, Shieh M, Cosgrove DJ. 1995. Molecular cloning and sequence analysis of expansins—a highly conserved, multigene family of proteins that mediate cell wall extension in plants. Proceedings of the National Academy of Sciences, USA 92, 9245–9249.
Shieh MW, Cosgrove DJ. 1998. Expansins. Journal of Plant Research 111, 149–157.[Web of Science][Medline]
Shimizu Y, Aotsuka S, Hasegawa O, Kawada T, Sakuno T, Sakai F, Hayashi T. 1997. Changes in levels of mRNAs for cell wall-related enzymes in growing cotton fiber cells. Plant and Cell Physiology 38, 375–378.
Trainotti L, Ferrarese L, Dalla Vecchia F, Rascio, N, Casadoro G. 1999. Two different endo-ß-1,4-glucanases contribute to the softening of the strawberry fruits. Journal of Plant Physiology 154, 355–362.
Whitney SEC, Brigham JE, Darke AH, Reid JSG, Gidley MJ. 1995. In vitro assembly of cellulose/xyloglucan networks: ultrastructural and molecular aspects. The Plant Journal 8, 491–504.
Whitney SEC, Gidley MJ, McQueen-Mason SJ. 2000. Probing expansin action using cellulose/hemicellulose composites. The Plant Journal 22, 327–334.[Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  Y.-X. Zhong, J.-Y. Chen, H.-L. Feng, J.-F. Kuang, R. Xiao, M. Ou, H. Xie, W.-J. Lu, Y.-M. Jiang, and H.-T. Lin Expansin and XET Genes Are Differentially Expressed During Aril Breakdown in Harvested Longan Fruit J. Amer. Soc. Hort. Sci., May 1, 2008; 133(3): 462 - 467. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Raab, J. A. Lopez-Raez, D. Klein, J. L. Caballero, E. Moyano, W. Schwab, and J. Munoz-Blanco FaQR, Required for the Biosynthesis of the Strawberry Flavor Compound 4-Hydroxy-2,5-Dimethyl-3(2H)-Furanone, Encodes an Enone Oxidoreductase PLANT CELL, April 1, 2006; 18(4): 1023 - 1037. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. OOKAWARA, S. SATOH, T. YOSHIOKA, and K. ISHIZAWA Expression of {alpha}-Expansin and Xyloglucan Endotransglucosylase/Hydrolase Genes Associated with Shoot Elongation Enhanced by Anoxia, Ethylene and Carbon Dioxide in Arrowhead (Sagittaria pygmaea Miq.) Tubers Ann. Bot., September 1, 2005; 96(4): 693 - 702. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Gray-Mitsumune, E. J. Mellerowicz, H. Abe, J. Schrader, A. Winzell, F. Sterky, K. Blomqvist, S. McQueen-Mason, T. T. Teeri, and B. Sundberg Expansins Abundant in Secondary Xylem Belong to Subgroup A of the {alpha}-Expansin Gene Family Plant Physiology, July 1, 2004; 135(3): 1552 - 1564. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Cosgrove, L. C. Li, H.-T. Cho, S. Hoffmann-Benning, R. C. Moore, and D. Blecker The Growing World of Expansins Plant Cell Physiol., December 15, 2002; 43(12): 1436 - 1444. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Aharoni and A. P. O'Connell Gene expression analysis of strawberry achene and receptacle maturation using DNA microarrays J. Exp. Bot., October 1, 2002; 53(377): 2073 - 2087. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Chen, P. Dahal, and K. J. Bradford Two Tomato Expansin Genes Show Divergent Expression and Localization in Embryos during Seed Development and Germination Plant Physiology, November 1, 2001; 127(3): 928 - 936. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||