Journal of Experimental Botany, Vol. 52, No. 361, pp. 1697-1702,
August 1, 2001
© 2001 Oxford University Press
Original Papers |
Transformation of Lotus japonicus using the herbicide resistance bar gene as a selectable marker
1 Center for Legume Research, M409 Walters Life Sciences Building, University of Tennessee, Knoxville, TN 37996-0845, USA
2 Biological Sciences, Flinders University, Adelaide, SA 5001, Australia
3 Department of Botany, University of Queensland, St Lucia, QLD 4072, Australia
Received 27 October 2000; Accepted 29 March 2001
| Abstract |
|---|
|
|
|---|
Transgenic plants of the model legume Lotus japonicus were regenerated by hypocotyl transformation using a bar gene as a selectable marker. The bar encodes for Phosphinothricin Acetyl Transferase that detoxifies phosphinothricin (PPT), the active ingredient of herbicides such as Ignite (AgrEvo) and Basta (Hoechst). Transgenic L. japonicus plants resistant to PPT were positive upon PCR by bar gene-specific primers. In 5 out of 7 independent lines tested, PPT resistance segregated as a single dominant allele indicating a single T-DNA insertion into the plant genome. All regenerated plants were fertile and void of visible somaclonal abnormalities contrary to 14% infertility when antibiotic selectable markers were used. The lack of somaclonal variation, ease of PPT application and low cost of PPT makes this protocol an attractive alternative for the regeneration of transgenic L. japonicus. The production of PPT herbicide-resistant L. japonicus plants may have significant commercial applications in crop production.
Key words: Lotus, transformation, somaclonal variation, phosphinothricin.
| Introduction |
|---|
|
|
|---|
Lotus japonicus is a model legume used for the study of legumeRhizobium symbiosis (Handberg and Stougaard, 1992; Jiang and Gresshoff, 1997
400 Mb) suitable for molecular and genetic analyses (Jiang and Gresshoff, 1993
Techniques such as plant tissue culture, nodulation assay, crossing and histology have already been established for L. japonicus research (Jiang and Gresshoff, 1993
; Szczyglowski et al., 1998
; Hussain et al., 1999
). Plant transformation and regeneration is a prerequisite for the molecular analysis of genes involved in nodulation and symbiotic nitrogen fixation. Furthermore, efficient regeneration of transgenic plants is required for studies such as promoter/enhancer trapping and insertional mutagenesis (Schauser et al., 1998
; Martirani et al., 1999
; Webb et al., 2000
). A high frequency transformation and regeneration protocol for L. japonicus has been achieved by utilizing Agrobacterium-mediated hypocotyl transformation protocol (Handberg and Stougaard, 1992; Thykjaer et al., 1995
; Stiller et al., 1997
). In these methods selection for transgenics is accomplished using antibiotic-resistant selectable markers such as nptII and hptII genes. The whole regeneration process although effective is relatively expensive and time-consuming. Additionally, about 1020% of the transgenic lines regenerated through these schemes are sterile, probably due to somaclonally-induced abnormalities.
A bar gene, which provides resistance to herbicide PPT (phosphinothricin), has been used successfully as a selectable marker in legumes as well as other plants (Schroeder et al., 1993
; Larkin et al., 1996
; Trieu and Harrison, 1996
; Denchev et al., 1997
). Selection for bar gene activity can be achieved easily and at low cost by spraying plants with the herbicide Ignite (AgrEvo commercial formulation containing 600 g l-1 PPT). PPT spraying could potentially provide inexpensive and effective weed control in a Lotus field crop engineered with the bar gene. Although successful selection for transformants based on the bar gene has been reported for pea and Medicago truncatula (Schroeder et al., 1993
; Trieu and Harrison, 1996
), no reports existed for the bar gene transformation in L. japonicus. Here a successful production of transgenic L. japonicus using the bar gene as a selectable marker is reported. An absence of somaclonally induced plant sterility was observed.
| Materials and methods |
|---|
|
|
|---|
Plant transformation and regeneration
L. japonicus ecotype Gifu B-129 was used. Hypocotyl transformation was as described previously (Stiller et al., 1997
as (NH4)2SO4, and 300 µg ml-1 cefotaxime sodium salt; Gemini Bio-products, USA, cat. no. 400115) and incubated for 5 d at 21 °C with 16/8 h day/night regime. The explants were subsequently transferred to selection medium (the same as regeneration medium plus 15 mg l-1 PPT as Basta herbicide) for 4 weeks under the same conditions as described above. Shoot induction was achieved in 36 weeks under the same conditions but on shoot induction medium (the same as selection medium except 150 µg ml-1 cefotaxime was added). Shoot elongation was achieved on shoot elongation medium (the same as shoot induction medium except 0.2 µg ml-1 BA, no NAA). Explants were transferred to fresh medium every week during selection, shoot induction, and elongation stages. Well-grown shoots were cut off and vertically inserted into root induction medium (1/2x B5 salts, 1/2x B5 vitamins, 1.0% sucrose, 0.5 µg ml-1 NAA) and incubated under the same conditions for a week. Root elongation was performed on root elongation medium (root induction medium without NAA) for 34 weeks.
Plant culture
Plants were grown in the greenhouse in horticultural mix (Fafard Mix No. 4 from Conrad Fafard, Inc., Agawam MA 01001-790, USA) and watered with water supplemented biweekly with complete nutrient solution Miracle Gro (Miracle Gro 15-30-15, Scotts Miracle-Gro Products Inc., PO Box 888, Port Washington, NY 11050, USA). Pods were harvested at the ripening stage (brown pod colour), seed isolated and kept at 4 °C. Seeds were scarified using sandpaper (aluminium oxide sandpaper, 150 fine grit, Ace Hardware Corp., IL) before sterilization in 3% H2O2 as described previously. Commercially available pesticides were applied as required to control diseases and pests.
Vector construct and Agrobacterium strain
The binary vector pTAB10 in Agrobacterium tumefaciens strain AGL1 was obtained from TJ Higgins laboratory (CSIRO Division of Plant Industry, Institute of Plant Production and Processing, GPO Box 1600, Canberra ACT 2601, Australia). The pTAB10 has a bar gene driven by a 35S cauliflower mosaic virus promoter. Agrobacterium was grown on 1x YT (8 g bacto-tryptone, 5 g bacto-yeast extract, 2.5 g l-1 NaCl, pH 7.0; 1.4% Bacto-agar added for solid medium) with 25 µg ml-1 rifampicin at 28 °C.
Plant DNA analysis
Extraction of genomic DNA was carried out according to Dellaporta et al. (Dellaporta et al., 1983
). DNA was quantified by using Hoeffer DNA Fluorometer (Model TKO 100, Hoeffer Scientific Instruments, San Francisco, USA). Polymerase Chain Reaction (PCR) was carried out on 80 ng of genomic DNA or 50 pg of plasmid DNA. The PCR primers used were as follows: forward primer (BARA): 5'TGCACCATCGTCAACCACTA 3', reverse primer (BARB): 5'ACAGCGACCACGCTGTTGAA3'. The PCR was performed in MJ Research thermal cycler (PTC 200, MJ Research Inc., Watertown, Massachussets, USA). The PCR conditions were as follows: initial denaturation at 95 °C for 2 min, subsequent denaturations at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 2 min, 35 cycles, the final extension at 72 °C for 10 min. The PCR mixture was composed of 0.5 units of Taq Polymerase, 10x Taq Polymerase buffer, 200 µM dNTPs, 0.3 µM primers, and 1.5 mM MgCl2.
Screening for PPT resistance
PPT at 120 mg l-1 (Ignite, AgrEvo Co. Wilmington, Delaware, USA) was sprayed on primary transformants 18 weeks after the transfer of tissue-derived plants to the soil and resprayed one week later. Resistant plants were marked one week after the second spray.
T2 seeds from the PPT-resistant primary transformants (T1) were sown at a density of approximately 40 seeds per 10 cm diameter pot. PPT at 50 mg l-1 was sprayed on plants 7 weeks after planting the seeds. The second spray of PPT (100 mg l-1) was applied one week later. The number of survived plants was recorded one week after the second spray. A
2 analysis was performed to test the fit of the observed ratio to the expected ratio of 3 resistant : 1 sensitive plants.
Chlorophenol red (CR) assay
The chlorophenol red assay was carried out as reported earlier (Kramer et al., 1993
) on T2 plants of the two PPT-resistant lines (pTAB10-7 and pTAB10-8). The assay solution contained 1/10x Gamborg's salt mixture (Sigma Chemical Company), 50 mg l-1 CR, 15 M benzylaminopurine (BAP), 0.5 M naphthaleneacetic acid (NAA), and 5 mg l-1 PPT. The pH of the solution was adjusted to 6.0 at which the assay solution was red. Shoots with 12 trifoliate leaves of 3-week-old seedlings were incubated in microtitre plate wells with assay solution in a growth chamber, 16/8 h day/night regime, 21 °C. The colour observation was performed after 2 d of incubation. Wild-type L. japonicus shoots incubated under the same conditions were used as a control. A colour shift from red to orange/yellow was considered as a resistant reaction.
| Results |
|---|
|
|
|---|
Transformation and regeneration
Dark-grown hypocotyl explants were transformed with A. tumefaciens strain AGL1 harboring the bar gene construct. Essentially the same protocol was followed as described earlier (Stiller et al., 1997
The calli developing from the parent explants were relatively compact compared to the calli regenerated using geneticin (5 mg l-1) or hygromycin (15 mg l-1) selection. Shoots with normal leaves developed directly from this callus. About 13 cm long shoots were cut off and rooted on root induction medium followed by root elongation. Rooting efficiency was above 90%.
Somaclonal variation in regenerated plants
All 30 independent shoots regenerated using the PPT selection protocol were free of visual abnormalities, had normal small leaves with normal size internodes and produced seeds indicating little or no somaclonal variation. This contrasts with shoots obtained from the geneticin or hygromycin selection, which often show abnormally shaped leaves and shoots (Fig. 1
), and a significant number of regenerants are sterile. For example, 22 out of 156 regenerated lines did not produce pods in a recent transformation scheme.
|
Analysis of primary transformants (T1)
Eight independent putative transgenic plants and wild-type Gifu controls grown in the greenhouse were sprayed with 120 mg l-1 PPT at 18 weeks to assess their resistance. One of the putative transgenic lines and all wild-type plants died after PPT application, whereas the rest of the plants did not have any visible damage to the foliage (Fig. 2
). Trieu and Harrison reported the resistance of transgenic M. truncatula to PPT at a concentration of 40 mg l-1 and 400 mg l-1 (Trieu and Harrison, 1996
). It was found here that a spray of 560 mg l-1 PPT caused about 50% foliar damage to the PPT-resistant Lotus plants.
|
PCR was carried out on genomic DNA of the T1 and Gifu plants using the bar gene-specific primers. The seven PPT-resistant T1 plants gave the expected PCR product of 310 bp, while the susceptible T1 plant and wild-type Gifu did not (Fig. 3
|
Segregation of PPT resistance in T2 generation
T2 progenies of the resistant T1 plants were grown along with wild-type plants and sprayed with PPT. Table 1
contains the number of resistant and sensitive plants observed in each line. Five out of the seven lines segregated as 3 resistant to 1 sensitive plants (
2 values were not significant). This ratio indicates that the bar segregated as a single-copy dominant allele. In contrast, two lines, the pTAB10-2 and pTAB10-6, had ratios significantly higher than expected for a single dominant allele, suggesting that multiple T-DNA insertion events occurred in these lines. All T1 and T2 plants were healthy and produced normal flowers and seeds. No Agrobacterium growth was observed while germinating T2 seeds on non-selective nutrient agar, indicating that the resistance of plants to PPT was not due to endophytic Agrobacterium contamination.
|
Chlorophenol red assay
The colour change of chlorophenol red assay solution is pH-dependent (Trieu and Harrison, 1996
). At pH 6.0 and higher, the solution colour is red whereas at lower pH, the colour is yellow. The leaf tissues resistant to PPT cause medium acidification leading to the yellowing of solution. Tissues sensitive to PPT undergo necrosis in assay solution, hence the solution colour stays red. A total of 58 seedlings of the pTAB10-7 and 54 seedlings of the pTAB10-8 were analysed. Figure 4
shows a microtitre plate with chlorophenol red assay after 2 d of incubation. In the case of the pTAB10-7 the ratio of resistant to sensitive plants was 2.87:1 (
2=0.021 at 1 df, n=58) and in the case of the pTAB10-8 the ratio was 2.86:1 (
2=0.025 at 1 df, n=57). These ratios indicate that in these lines the bar gene was inherited as a single dominant allele thus confirming the PPT spraying data (Table 1
).
|
| Discussion |
|---|
|
|
|---|
L. japonicus is a model legume used for the study of determinate nodulation in many laboratories around the world. Consequently, the first plant gene known to exhibit a symbiotic mutant phenotype was cloned from L. japonicus (Schauser et al., 1999
Somaclonally induced morphological variability is a common occurrence in L. japonicus when transformation via tissue culture and antibiotic selection are used. In the latest transformation experiments, about 14% of the regenerated plants are rendered sterile. Somaclonal variation appeared to be absent in the case of PPT selection. All 30 independently regenerated lines were normal and produced seeds. Improved shoot organogenesis was obvious at the shoot induction and shoot elongation stages. In the case of antibiotic selection, the first formed shoots appeared to have rosette-like, thickened and deformed leaves in a large proportion of regenerants. In contrast, PPT-derived shoots had normal leaves with internodes coming directly from the compact calli.
The data presented here indicate that the transformation of L. japonicus by the bar gene is stable and heritable. A positive PCR for the presence of the bar gene and PPT resistance of the primary transformants are early indicators of a successful transformation. T1 plants failing these two tests can be discarded at the outset of the post-tissue culture stage, saving time and labour to manage transgenics. A further confirmation of stable and heritable transformation came from the segregation for PPT resistance and chlorophenol red assay in the T2 generations. Among seven lines analysed, five segregated for PPT resistance close to a 3 resistant:1 sensitive ratio, indicating the segregation pattern for a single dominant allele. These data also suggested that there was only a single T-DNA insertion event in these lines. Two of the lines gave a higher number of PPT-resistant plants in T2 than expected for a single dominant allele, pointing to multiple T-DNA insertions in the genome (Campisi et al., 1999
). The occurrence of single insertion events with this PPT protocol was about 70%, significantly higher than with antibiotic selection in Arabidopsis thaliana (47%, Campisi et al., 1999
) or L. japonicus (20%, unpublished data). This will be useful for obtaining single copy transformants of Lotus often required for molecular analyses.
For the first time, transgenic plants of Lotus species were regenerated, which are resistant to PPT, an active ingredient of commercial herbicides. Moreover, the regenerated transgenic plants demonstrated higher levels of resistance to PPT than commonly used for weed control. This is promising provided that resistance in field conditions resembles that of the greenhouse-grown plants. If so, these results represent a significant contribution to legume crop improvement and management.
| Acknowledgments |
|---|
We thank to TJ Higgins and Linda Tabe for providing the pTAB10 vector.
| Notes |
|---|
4 To whom correspondence should be addressed. Fax: +61 7 3365 1699. E-mail: j.stiller{at}botany.uq.edu.au
| References |
|---|
|
|
|---|
Campisi L, Yang Y, Yi Y, Heilig E, Herman B, Cassita AJ, Allen DW, Xiang H, Jack T. 1999. Generation of enhancer trap lines in Arabidopsis and characterization of expression patterns in the inflorescence. The Plant Journal 6, 699707.
Dellaporta SL, Wood J, Hicks JB. 1983. A plant DNA mini-preparation: Version II. Plant Molecular Biology Reporter 1, 1921.
Denchev PD, Songstad DD, McDaniel JK, Conger BV. 1997. Transgenic orchardgrass (Dactylis glomerata) plants by direct embryogenesis from microprojectile bombarded leaf cells. Plant Cell Reports 16, 813819.
Handberg K, Stougaard J. 1992. Lotus japonicus, an autogamous, diploid legume species for classical and molecular genetics. The Plant Journal 2, 487496.[Web of Science]
Hussain AKM, Jiang Q, Broughton WJ, Gresshoff PM. 1999. Lotus japonicus nodulates and fixes nitrogen with the broad host range Rhizobium sp. NGR234. Plant Cell Physiology 8, 894899.
Jiang Q, Gresshoff PM. 1997. Classical and molecular genetics of the model legume Lotus japonicus. Molecular PlantMicrobe Interactions 10, 5968.
Jiang Q, Gresshoff PM. 1993. Lotus japonicusa model plant for structurefunction analysis in nodulation and nitrogen fixation. In: Gresshoff PM, ed. Current topics of plant molecular biology, II. Boca Raton: CRC Press, 97110.
Kramer C, Di Mio J, Carswell GK, Shillito RD. 1993. Selection of transformed protoplast-derived Zea mays colonies with phosphinothricin and a novel assay using the pH indicator chlorophenol red. Planta 190, 454458.
Larkin PJ, Gibson JM, Mathesius U, Weinman JJ, Gartner E, Hall E, Tanner GJ, Rolfe BG, Djordjevic MA. 1996. Transgenic white clover. Studies with the auxin-responsive promoter, GH3, in root gravitropism and lateral root development. Transgenic Research 5, 325335.[Web of Science][Medline]
Martirani L, Stiller J, Mirabella R, Alfano F, Lamberti A, Radutoiu SE, Iaccarino M, Gresshoff PM, Chirazzi M. 1999. T-DNA tagging of nodulation and root related genes in Lotus japonicus: expression patterns and potential for promoter trapping and insertional mutagenesis. Molecular Plant Microbe Interactions 12, 275284.
Schauser L, Handberg K, Sandal N, Stiller J, Thykjaer T, Oajuelo E, Nielson A, Stougaard J. 1998. Symbiotic mutants deficient in nodule establishment identified after T-DNA transformation of Lotus japonicus. Molecular and General Genetics 259, 414423.
Schauser L, Roussis A, Stiller J, Stougaard J. 1999. A plant regulator controlling development of symbiotic root nodules. Nature 402, 191195.[Medline]
Schroeder H, Scholtz AH, Wardley-Richardson T, Spencer D, Higgins TJ. 1993. Transformation and regeneration of two cultivars of pea (Pisum sativum L.). Plant Physiology 101, 751757.[Abstract]
Stiller J, Martirani L, Tuppale S, Chian R-J, Chiurazzi M, Gresshoff PM. 1997. High frequency transformation and regeneration of transgenic plants in the model legume Lotus japonicus. Journal of Experimental Botany 48, 13571365.
Szczyglowski K, Shaw RS, Wopereis J, Copeland S, Hamburger D, Kasiborski B, Dazzo FB, de Bruijn F. 1998. Nodule organogenesis and symbiotic mutants of the model legume Lotus japonicus. Molecular PlantMicrobe Interactions 11, 684697.
Thykjaer T, Stiller J, Handberg K, Jones J, Stougaard J. 1995. The maize transposable element Ac is mobile in the Lotus japonicus. Plant Molecular Biology 27, 981993.[Web of Science][Medline]
Trieu AT, Harrison MJ. 1996. Rapid transformation of Medicago truncatula: regeneration via shoot organogenesis. Plant Cell Reports 16, 611.
Webb KJ, Skot L, Nicholson MN, Jorgensen B, Mizen S. 2000. Mesorhizobium loti increases root-specific expression of a calcium-binding protein homologue identified by promoter tagging in Lotus japonicus. Molecular PlantMicrobe Interactions 13, 606616.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
D. Lohar, J. Stiller, J. Kam, G. Stacey, and P. M. Gresshoff Ethylene insensitivity conferred by a mutated Arabidopsis ethylene receptor gene alters nodulation in transgenic Lotus japonicus Ann. Bot., June 7, 2009; (2009) mcp132v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Lohar and D. McK. Bird Lotus japonicus: A New Model to Study Root-Parasitic Nematodes Plant Cell Physiol., November 15, 2003; 44(11): 1176 - 1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Somers, D. A. Samac, and P. M. Olhoft Recent Advances in Legume Transformation Plant Physiology, March 1, 2003; 131(3): 892 - 899. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






