Journal of Experimental Botany, Vol. 52, No. 362, pp. 1785-1803,
September 1, 2001
© 2001 Oxford University Press
Original Papers |
Single and double overexpression of C4-cycle genes had differential effects on the pattern of endogenous enzymes, attenuation of photorespiration and on contents of UV protectants in transgenic potato and tobacco plants
1 Botanisches Institut der Universität zu Köln, Gyrhofstraße 15, D-50931 Köln, Germany
2 Institut für Biologie I (Botanik/Molekulargenetik), Rheinisch-Westfälische Technische Hochschule, Worringer Weg 1, D-52074 Aachen, Germany
Received 5 March 2001; Accepted 5 June 2001
| Abstract |
|---|
|
|
|---|
To improve the efficiency of CO2 fixation in C3 photosynthesis, C4-cycle genes were overexpressed in potato and tobacco plants either individually or in combination. Overexpression of the phosphoenolpyruvate carboxylase (PEPC) gene (ppc) from Corynebacterium glutamicum (cppc) or from potato (stppc, deprived of the phosphorylation site) in potato resulted in a 36-fold induction of endogenous cytosolic NADP malic enzyme (ME) and an increase in the activities of NAD-ME (3-fold), NADP isocitrate dehydrogenase (ICDH), pyruvate kinase (PK), NADP glycerate-3-P dehydrogenase (NADP-GAPDH), and PEP phosphatase (PEPP). In double transformants overexpressing cppc and chloroplastic NADP-ME from Flaveria pringlei (fpMe1), cytosolic NADP-ME was less induced and pleiotropic effects were diminished. There were no changes in enzyme pattern in single fpMe1 overexpressors. In cppc overexpressors of tobacco, the increase in endogenous cytosolic NADP-ME activity was small and changes in other enzymes were less pronounced. Determinations of the CO2 compensation point (
*) as well as temperature and oxygen effects on photosynthesis produced variational data suggesting that the desired decline in photorespiration occurred only under certain experimental conditions. Double transformants of potato (cppc/fpMe1) exhibited the most consistent attenuating effect on photorespiration. In contrast, photorespiration in tobacco plants appeared to be diminished most in single cppc overexpressors rather than in double transformants (cppc/fpMe1). In tobacco, introduction of the PEP carboxykinase (PEPCK) gene from the bacterium Sinorhizobium meliloti (pck) had little effect on photosynthetic parameters in single (pck) and double transformants (cppc/pck). In transgenic potato plants, increased PEPC activities resulted in a decline in UV protectants (flavonoids) in single cppc or stppc transformants, but not in double transformants (cppc/fpMe1). PEP provision to the shikimate pathway inside the plastids, from which flavonoids derive, might be restricted only in single PEPC overexpressors. Key words: C4-cycle, malic enzyme, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, transgenic potato/tobacco.
| Introduction |
|---|
|
|
|---|
Photorespiration commences with the oxygenase reaction of Rubisco and results in the loss of at least 25% of CO2 assimilated in air (Leegood et al., 1995
* (Häusler et al., 1999
*, due to an increase in the CO2/O2 ratio, but also in a higher rate of CO2 loss from the plants. Furthermore, in transgenic potato plants with a combined overexpression of PEPC and chloroplastic NADP-ME, the electron requirement for CO2 assimilation was lower than in the wild-type or single PEPC or NADP-ME overexpressors when the leaf temperature was increased above 30 °C. This suggests an appreciable attenuation of photorespiration (Lipka et al., 1999In this study, the physiological and biochemical responses of wild-type potato and tobacco plants, two closely related solanaceous species, were compared with transformants overexpressing C4-cycle genes individually and in combination. There has been a focus here on changes in the pattern of enzymes that are directly or indirectly involved in the metabolism of PEP or products of PEP carboxylation and the effects on CO2 assimilation and photosynthetic electron transport have been assessed. Changes in enzyme pattern and photosynthetic parameters observed in the transgenic plants are interpreted as compensational processes or adaptations to a redirection of metabolic fluxes.
| Materials and methods |
|---|
|
|
|---|
Plant material and gene constructs
Wild-type potato (Solanum tuberosum cv. Désirée) and tobacco (Nicotiana tabacum L. cv. Petit Havanna SR1) plants were transformed with the leaf disc method (Horsch et al., 1985
Construction and overexpression of a malate-insensitive potato PEPC in S. tuberosum
In potato, a modified endogenous PEPC gene (stppc) from potato (GenBank: X90982) was overexpressed under the control of the double 35S promoter. In order to reduce the malate sensitivity of ppc1 the phosphorylation site was modified: Glu7, Lys8, and Leu9 were replaced by a Ser and Ser11 was replaced by Asp. A further modification concerned 37 amino acids from positions 384 to 420. The DNA sequence coding for these amino acids was exchanged by the corresponding sequence from Flaveria trinervia. Modifications were accomplished by standard cloning techniques. The resulting gene was designated StppcS9D-C4.
The bacterial expression vector pTrc99A was used to express modified proteins for further characterization. PEPC coded by StppcS9D-C4 had a lower Km(PEP) value (23 µM) than the endogenous PEPC (57 µM) and a strongly reduced malate sensitivity and was therefore used in further experiments. The modified gene was cloned into the plant vector pPAM (GeneBank Accession No. AY027531) together with an expression cassette containing the double 35S-Promotor (35SS) (Kay et al., 1987
), the 5'-untranslated region of tobacco etch virus (TL) (Carrington and Freed, 1990
) and the polyadenylation site pA35S. The DNA sequence between the distal part of the 35SS promoter and the proximal part of the modified stppc gene was as follows, tttggagaggacc (35SS), tcgagaattct (transition sequence), caacacaaca tatacaaaac aaacgaatct caagcaatca agcattctac ttctattgca gcaatttaaa tcatttcttt taaagcaaaa gcaattttct gaaaattttc accatttacg aacgat (TL), agcc (transition sequence), atg gct acg agg aat ctg agc gca gat att gat (stppcS9D-C4). Potato transfomants carrying the modified version of stppc were designated SPsStSD. Tobacco double transformants carrying cppc and fpMe1 were essentially generated as described previously (Lipka et al., 1999
) for potato plants and were designated (cppc+MExcppc)(1584x2732 : 11) and (cppc+ME)(1584x2731 : 3).
Cloning of the PEPCK gene and functional expression in E. coli
Transgenic tobacco plants were generated containing the PEPCK gene (pckA) from Sinorhizobium meliloti 2011 (Aguilar et al., 1985
) targeted to the chloroplast. PckA was amplified from plasmid pTH195 (Osteras et al., 1995
) with the 5'-oligonucleotide Lpck5' (gg aat tca ggA CGC GTt agg tgc ATG gat gag ctc ggc agc cgc aat cc) and a 3'-oligonucleotide complementary to the vector sequence including the EcoRI recognition sequence of the multiple cloning site. The 5'-oligonucleotide Lpck5' contained the start codon of pckA. Four triplets coding for the last amino acids from the carboxy terminus of Rubisco (rbcS1) preceded the ATG. The MluI restriction site was used to ligate the PCR product to the 5'-part of rbcS1 resulting in an rbcS1-pckA fusion. This oligonucleotide additionally contained an EcoRI- and a SstI-site. The PCR-amplified sequence was cloned into the EcoRI site of pUC19 resulting in pRm1, which was the basis for further cloning into the IPTG inducible bacterial expression vectors pKK223-3, pTrc99A and pGEX-5X-3 (Pharmacia) as well as into the plant expression vector pS. The EcoRI fragment from pRm1 was inserted into the EcoRI sites of pKK2233 and pGEX-5X-3 resulting in pRm5 and pRm7; a SstI fragment with pck was cloned into pTrc99A at the SstI-site to yield pRm6. The three constructs were tested for complementation of an E. coli mutant (HG4) unable to grow on succinate because it lacks pck and the PEPsynthetase gene ( pps) (Goldie and Sanwal, 1980
). HG4 mutants transformed with the individual three gene constructs were capable of growing on M9 minimal agar plates at 30 °C and 37 °C with succinate (0.5%) as sole carbon source. However, strong induction of the pck gene by addition of IPTG (5 mM) was fatal for growth indicating a perturbance of metabolism at very high PEPCK activities as was observed earlier (Chao and Liao, 1993
). The protein pattern of the two strains on SDS-PAGE revealed a strong band at the expected molecular weight positions of 58 kDa for HG4(pRm6) and 87 kDa for a GST-PEPCK fusion protein in HG4(pRm7). Concomitantly, PEPCK activity increased 140- and 660-fold, respectively, in induced overnight cultures. The E. coli strain BL21 (Grodberg and Dunn, 1988
) was used for production of PEPCK-GST fusion protein, required for raising specific antibodies against PEPCK from S. meliloti.
Transformation of tobacco plants with pS-Lpck
The construction of the plant vector pS-Lpck containing the pckA gene from S. meliloti fused to the Rubisco (rbcS1) transit sequence of potato was analogous to that of pSrLpps described earlier (Panstruga et al., 1997
). The expression cassette from pBinHygTX (35S-TripleX) (Gatz et al., 1992
) had been inserted into a pUC19 vector via EcoRI and HindIII (pRP8). In addition, the pck gene from yeast in fusion with the rbcs1 transit sequence was ligated into the SmaI site of the cassette resulting in plasmids pRP19. Most part of the chimeric rbc-pdk(yeast) gene (except for the proximal part of rbcS1 leader) was replaced by a MluI/BamHI fragment from pRm1, thus substituting the yeast pck completely by pck from S. meliloti fused to the distal part of rbc1. The complete rbcs1 transit sequence was regenerated by this procedure. To eliminate possible PCR errors, a 1759 bp SstI fragment was exchanged by the corresponding fragment of pTH195. The resulting plasmid was designated pRm3. As it was intended to express the gene under the original 35S promoter, the chimeric gene was excised with HpaI and BamHI and the ends (filled in by Kleenow polymerase) were ligated into the SmaI-site of vector pS (Panstruga et al., 1997
) to yield pS-Lpck. Tobacco lines containing pS-Lpck were designated pck.
For the generation of tobacco double transformants (cppc/pck) from cppc single transformants a hygromycin resistance-mediating plasmid was used. Therefore, the whole expression cassette (including 35S promoter, Lpck and polyadenylation site pACaMV) from pS-Lpck was excised with HindIII and ligated into the HindIII-site of pRP10. The latter plasmid was derived from pBinHygTX by replacing the 35S TripleX/pAOcs expression cassette with a 16 bp EcoRI/HindIII adaptor. The resulting plasmid was designated pBIN-Lpck.
Screening for PEPCK positive tobacco plants was performed immunologically, essentially as described for the detection of NADP-ME (Lipka et al., 1999
). Single transformants overexpressing pck were designated pck(270-10) and pck(276-10). Double transformant lines of tobacco containing cppc and pck were designated (cppcxpck)(1004x27610 : 1) and (cppcxpck)(1004x6092 : 6).
Isolation of potato ME cDNAs by RT-PCR
cDNAs for the detection of transcript amounts of cytosolic and chloroplastic NADP-ME as well as of NAD-ME from potato were generated by RT-PCR (Chelly et al., 1988
) with total RNA isolated from wild-type potato using gene specific primer pairs. For NAD-ME the sequence data of the potato enzyme (62 kDa subunit) was used (Winning et al., 1994
; Accession No. Z23023, forward: gttcttaatgctaggagg, reverse: tcctggatatcgaagggtata). This resulted in a PCR product with a length of 630 bp. For cytosolic and chloroplastic NADP-ME, the sequence information published for tomato plants (Lycopersicon esculentum; leMe2; Accession No. AF001270, leMe1, Accession No. AF001269) was used to design degenerated primer pairs using stretches of the coding region, which were least homologous to published sequences of NADP-MEs from C3 and C4 plants. Potato-specific cDNAs were amplified with these primers. For the amplification of stMe2 the forward and reverse primers were, at(act)gtxgtxacxga(ct)ggxga and (ct)tc(ct)xgt xac(ct)tgxgcxgc, respectively. For stMe1 the following primer combination was used, tt(ct)aaraarccxtgggcxca (forward); xcc(ct)tt(ct)tcraartt(ct)tc(ct)tg (reverse). This resulted in PCR fragment sizes of 422 bp and 1037 bp for stMe2 and stMe1, respectively. The PCR products were quantitatively separated on agarose gels and electro-eluted onto Nylon membranes. A portion of the cDNA was ligated into pGEM®-T Easy (Promega) and sequenced (Perkin Elmer, ABI Prism, 310 genetic analyser). The amino acid sequences derived from the individual PCR products were identical to those published.
Extraction of RNA and Northern blot analysis
For RNA isolation, leaf material of greenhouse-grown potato plants was harvested at midday and frozen in liquid nitrogen. RNA was extracted using the RNase ALL medium (internet information; bionet.molbio.methds-regnts). Total RNA (10 µg per lane) was separated on 1% agarose gels in Mops-formaldehyde (Sambrook et al., 1989
), subsequently transferred on Porablot NY amp membranes (downward transfer) and hybridized with 32P-labelled cDNA probes (according to Church and Gilbert, 1984
). The signal strength was quantified using a phosphorimager (Storm 860, Molecular Dynamics) equipped with the Image Quant program (Molecular Dynamics, Sunnyvale, California, USA). The intensity of the signal was normalized for slight differences in the amount of 28S rRNA on the membrane.
Plant growth and propagation
Potato plants were grown from tubers in a growth chamber (14/10 h light/dark; 22 °C) and propagated by cuttings 34 weeks before an experiment. Tobacco plants were grown in a greenhouse (25 °C) with supplemental illumination (4000 lx, Osram HQI-T400/D lamps) for 16 h and propagated by cuttings until experiments were performed.
Extraction of leaf material for enzyme assays
Samples for enzyme assays were taken from upper source leaves of 6-week-old potato plants or 5-weeks-old tobacco plants immediately after photosynthesis measurements (see below). Leaf material was frozen in liquid nitrogen and stored at -80 °C until use. Frozen leaf material was extracted in a medium containing 50 mM Hepes-NaOH (pH 7.5), 5 mM MgCl2, 2 mM EDTA, 10% (v/v) glycerol, 0.1% Triton-X 100, and optional 10 mM DTT. The extracts were desalted by gel filtration on NAP-5 columns (Pharmacia). Enzyme activities were either measured directly after extraction or in extracts, which were brought to 50% (v/v) glycerol and stored at -20 °C. Storage of extracts had no effect on enzyme activities for at least up to 4 weeks.
Enzyme assays
PEPC:
PEPC activities were determined using two different reaction mixtures modified after Ashton et al. (Ashton et al., 1990
). Assay 1 contained, 100 mM Tricine-KOH (pH 8.0), 5 mM MgCl2, 2 mM DTT, 1 mM NaHCO3, 0.2 mM NADH, 2 U MDH, and 5 mM PEP; assay 2 contained, 100 mM Mes-NaOH (pH 6.6), 50 mM NaHCO3 (pH of the reaction mixture 7.2), 5 mM MnCl2, 0.2 mM NADH, 5 mM DTT, 2 U MDH, and 5 mM PEP.
PEPCK:
PEPCK was assayed in, 100 mM Mes-NaOH (pH 6.6), 50 mM NaHCO3 (pH of the reaction mixture 7.2), 5 mM MnCl2, 0.2 mM NADH, 5 mM DTT, 5 mM PEP, 4 mM ATP, and 2 U MDH.
NADP(NAD)-ME:
The activity of NADP-ME was determined as described previously (Häusler et al., 1987
) in 100 mM Tricine-NaOH (pH 8.4), 25 mM malate, 25 mM MgCl2, and 0.6 mM NADP, and NAD-ME was determined according to Ashton et al. (Ashton et al., 1990
) in 50 mM Hepes-NaOH (pH 7.2), 5 mM malate, 4 mM MnCl2, 2 mM EDTA, 0.2 mM NAD, 5 mM DTT, and 0.1 mM Coenzyme A.
NADP(NAD)-MDH:
In order to activate NADP-MDH fully the extracts were mixed with DTT to give a final concentration of 50 mM and were incubated for 30 min at room temperature (Holaday et al., 1992
). The assay mixture contained, 100 mM Tricine-NaOH (pH 8.0), 5 mM EDTA, 2 mM OAA (prepared freshly prior to start of the reaction), 0.2 mM NADPH, and 20 mM DTT. NAD-MDH was assayed in 100 mM Hepes-NaOH (pH 7.5); 5 mM EDTA, and 2 mM NADH.
NADP(NAD)-GAPDH:
The assay for NADP-GAPDH (Leegood, 1990
) contained, 100 mM Tricine-NaOH (pH 7.8), 5 mM 3-PGA, 0.2 mM NADPH, 2 mM ATP, 8 mM MgSO4, 2 mM DTT, 1.0 mM EDTA, and 2 U ml-1 PGK. For NAD-GAPDH the same assay medium was used with the exception that NADPH was replaced by NADH and DTT was omitted.
PK, PEPP:
PK was assayed according to Plaxton (Plaxton, 1990
) either in 100 mM Hepes-NaOH (pH 6.9) or (pH 7.9), 2 mM PEP, 2 mM ADP, 50 mM KCl, 10 mM MgCl2, 0.2 mM NADH, 0.2 mg ml-1 BSA, 2 mM DTT, and 2 U LDH. PEPP activity was determined in the same assay mixtures as for PK in the absence of ADP.
NADP-ICDH:
NADP-ICDH was assayed according to Chen (Chen, 1998
) in 100 mM K-phosphate (pH 7.5), 5 mM MgCl2, 2 mM isocitrate, and 0.1 mM NADP.
Isolation of chloroplasts from potato and tobacco leaves
Chloroplasts were isolated according to Barlett et al. at 04 °C on a reduced scale (Bartlett et al., 1982); leaf material (approximately 10 cm2 leaf area) was disintegrated between two small interlocking ribbed rollers (MEKU, Wennigen, Germany) and 2 ml extraction buffer was added immediately. The homogenate was passed through one layer of Miracloth, collected in a 2 ml tube and centrifuged in a Microfuge for 2 s. The supernatant was removed with a syringe and the pellet resuspended. Chloroplast isolation was completed within 2 min.
Native polyacrylamide gel electrophoresis and NADP-ME activity staining
Separation of native proteins and staining for NADP-ME activity on polyacrylamide gels was done according to Häusler et al. (Häusler et al., 1987
) with the system of Davis (Davis, 1964
) using 7.5% separation gels. Activity of NADP-ME was visualized using the standard reaction supplemented with 0.5 mM EDTA, PMS (10 µg ml-1) and NBT (200 µg ml-1). As a control, MgCl2 was omitted.
Photosynthesis measurements
CO2 assimilation and modulated Chl a fluorescence were measured as described elsewhere (Häusler et al., 1999
). O2 inhibition of CO2 assimilation was measured either in a gas mixture containing 1490 µl l-1 CO2, 21% O2 balanced with N2 or 1510 µl l-1 CO2, 2% O2 balanced with N2 provided by gas cylinders. The CO2 concentration of the incoming gas stream were lowered to values expected for ambient air with a CO2 diluter (Analytical Development Company, UK). The intracellular CO2 concentration (Ci) was adjusted by varying the concentrations of CO2 in the incoming gas stream and was kept constant in all sets of experiments. For measurements of photosynthesis, fully developed upper source leaves of 6-week-old potato plants or 5-week-old tobacco plants were used. In order to consider diurnal changes in photosynthetic performance, measurements were done with the same plants after 47 h light on the first day and 913 h light on the second day. After the measurements, leaves were excised, plunged into liquid N2 and stored at -80 °C. These leaf samples were used for the determination of enzyme pattern.
Determination of UV protectants (flavonoids)
For flavonoid measurements, leaf discs were extracted as described previously (Pinto et al., 1999
) in MeOH : H2O : HCl (79 : 20 : 1 by vol.) at 60 °C for 1 h (with 99.8% MeOH and 35.4% HCl) and the absorption at 310 nm was determined after cooling down the extracts to room temperature.
Statistical evaluation of experimental data
All data shown in the tables and figures are mean values ± standard deviation (SD) of 27 independent data acquisitions using leaves from different plants of individual transformant or control lines. Significant differences between wild-type/control plants and transformants were assayed using the Welch-test (Lorenz, 1984
), which allows for unequal relative errors between two groups of measurements assuming that a Gauss distribution is applicable. The authors are aware that this is not necessarily the case for all sets of data. Note that a high variability within a set of data and/or a limited data number makes significant differences between wild-type/control plants and transformants less probable, despite similar or identical mean values.
| Results |
|---|
|
|
|---|
PEPC from plants and C. glutamicum can be distinguished by differential assay compositions
The kinetic properties of PEPC from different sources may vary. For instance, the Km(PEP) of PEPC from C. glutamicum ranges between 0.85.0 mM depending on the presence of acetyl CoA (100 µM), an activator of the bacterial enzyme, whereas the Km(PEP) of PEPC from potato is lower (190 µM) (Gehlen et al., 1996
|
Overexpression of pck targeted to chloroplasts in tobacco plants
Plant PEPCK is a cytosolic enzyme, which is involved in the CO2 concentrating mechanism in C4 and CAM plants as well as in gluconeogenesis in a variety of tissues and specialized cells of C3 plants (Leegood et al., 1999
). High activities of PEPC and PEPCK in one compartment would result in a futile cycle and the waste of ATP. As it was desired to release CO2 in the vicinity of Rubisco and to prevent futile cycling, the bacterial pck gene from S. meliloti was targeted to the chloroplasts of transgenic tobacco plants by fusing it to the Rubisco (rbcS1) transit sequence of potato. The functionality of the PEPCK protein was tested by complementation of an E. coli strain unable to grow on succinate as the sole carbon source (see Materials and methods).
PEPCK activity was barely detectable in leaf extracts of wild-type tobacco or transformants overexpressing the pck gene targeted to the chloroplast. Moreover, in plants containing pck in combination with cppc, the high background of bacterial PEPC activity prevented an accurate determination of PEPCK activity. However, PEPCK activity determined in isolated chloroplasts increased from 0.2 mU mg-1 in the wild type by a factor of 35 and 27 in single and double transformants carrying pck alone and in combination with cppc (Table 1B
). The poor activity of PEPCK in leaf extracts could be due to a high sensitivity of the PEPCK protein towards proteolytic degradation (Leegood et al., 1999
). However, limited proteolysis does not affect Vmax.
The activity of endogenous NADP-ME increases as a result of PEPC overexpression
In transgenic potato plants, total activities of NADP-ME were raised up to 4-fold in leaf extracts of PEPC (cppc, lines 3LD9, 3LD15 9x9-1; stppc lines SPsStSD41, 91, 21, and 72) overexpressors as well as in double transformants (lines 3LD/ME1, 2, 3, 5) containing cppc in combination with fpMe1 (Table 1A
). There was also an increase in mitochondrial NAD-ME, which was significant in the single cppc overexpressing line 3LD9 and prominent in most of the stppc overexpressing lines tested (single measurements, Table 1A
). The increase in total NADP-ME activity in the double transformants (cppc/fpMe1) was not due to overexpression of fpMe1 per se as stromal NADP-ME activity in single fpMe1 transformants (line ME18) could only be unequivocally detected in chloroplast, but not in leaf extracts (Lipka et al., 1999
). NADP-ME activities measured in leaf extracts of individual fpMe1 overexpressors were therefore similar to wild-type plants, but they were considerably increased in chloroplast extracts of single and double transformants of potato as well as of tobacco plants carrying the fpMe1 gene (Table 1A
). Moreover, the large increase in NADP-ME activity in leaf extracts of PEPC overexpressors was not observed in chloroplast extracts suggesting that this activity was localized outside the chloroplasts (Table 1A
).
On the basis of chloroplast protein contents, endogenous chloroplast NADP-ME activity was low and ranged between 0 and 4.24 mU mg-1 in wild-type tobacco and potato plants or single PEPC overexpressors, but increased significantly (between 14 and 47 mU mg-1) in chloroplasts extracted from plants overexpressing fpMe1 (i.e. lines ME18, 3LD9/ME1 and 5 for potato and cppc/fpMe1 for tobacco). From the data shown in Table 1A
, it appears likely that the increase in extraplastidial NADP-ME responds to the increase in PEPC in a dose-dependent manner both in cppc and stppc overexpressors of potato. Interestingly, in double transformants of potato carrying the fpMe1 gene in combination with cppc, total NADP-ME activity was lower compared to single cppc overexpressors despite similar magnitudes of foreign PEPC activity suggesting that the introduction of the second gene (i.e. fpMe1) triggers the decline of endogenous cytosolic NADP-ME activity (Table 1A
).
For tobacco, there was also the trend of an increase in total NADP-ME in cppc overexpressors, which was more apparent after NADP-ME activity staining on native gels (see below). An increase in NADP-ME activity (2-fold) was significant only in double transformants carrying cppc in combination with fpMe1 (Table 1B
). Hence, an overexpression of PEPC has differential effects on changes in cytosolic NADP-ME activity between different species, even between closely related species such as potato and tobacco.
Staining of NADP-ME activity isolated from leaf and chloroplast extracts on native gels
Staining for NADP-ME activity on native polyacrylamide gels reveals that, despite distinct migration distances, there was only one major NADP-ME activity band extracted from potato and tobacco leaves that was considerably increased in single cppc (line 3LD9 for potato and line cppc197-4 for tobacco) or double cppc/fpMe1 (line 3LD9/ME5, potato only) overexpressors (Fig. 1A
). It should be noted that the activity of cytosolic NADP-ME in the respective wild-type plants shown in Fig. 1
was extremely low compared to other experiments (not shown). The faint second activity band, which was observed only in wild-type potato, was most probably due to endogenous chloroplastic NADP-ME (Fig. 1A
). The stained bands in the absence of MgCl2 (control) represent most likely chloroplastic NADP-MDH. NADP-ME activity in chloroplast extracts of single and double transformants of potato could only be detected when the plants express chloroplastic NADP-ME (fpMe1) (Fig. 1B
). This is consistent with the large increase of NADP-ME activities in the respective chloroplast extracts (Table 1A
). Furthermore, a comparison of the RF values indicated that the relative migration distance of the activity band of introduced NADP-ME was different from the major activity band found in whole leaf extracts (not shown).
|
Transcript levels of endogenous cytosolic NADP-ME are increased in transgenic potato plants overexpressing cppc or stppc
In order to explore whether the observed increase in cytosolic NADP-ME activity in potato plants overexpressing cppc is regulated on the transcriptional or post-transcriptional level, Northern blot analysis was performed. For this purpose the respective cDNA used as a probe was isolated by RT-PCR with degenerated primer pairs designed from gene-specific sequences published for the leMe2 gene from tomato (see Materials and methods). As shown in Fig. 2
(left panel), transcript amounts of cytosolic NADP-ME from potato (stMe2) were low in control plants, but increased by a factor of 26 in individual cppc overexpressors of potato and were slightly elevated in stppc overexpressors (Fig. 2
; left panel). The transcript amount of stMe2 in transgenic potato plants carrying the fpMe1 gene alone was even lower compared to the control plants, whereas the abundance of stMe2 transcripts was again slightly increased in individual double transformants carrying cppc in combination with fpMe1 compared to the wild type. Thus, the rise in NADP-ME activity (Table 1A
) is correlated with the increase in transcript amounts of stMe2 in the respective transgenic lines (compare Table 1A
). The transcript amounts of stMe2 in leaves of wild-type potato are also subjected to changes in the nutritional status of the plants (cf. Pinto et al., 1999
). Nutrient-deficient wild-type potato plants exhibited higher transcript amounts of stMe2 compared to nutrient-sufficient plants (Fig. 2
; right panel [L]). Moreover, there were no large differences in the transcript amounts between leaf blade and midrib (Fig. 2
; right panel [LB, MR]).
|
The mRNAs of endogenous chloroplastic NADP-ME or mitochondrial NAD-ME were not detectable on Northern blots suggesting low transcript amounts. However, both transcripts must have been present in leaves, as the corresponding cDNAs were isolated by RT-PCR (see Materials and methods).
Pattern of enzymes involved in PEP metabolism are affected in transgenic potato and tobacco plants overexpressing C4-cycle genes
Effects of overexpressing C4-cycle genes on the activity pattern of other enzymes involved in the metabolism of PEP or in the products of PEP carboxylation or proliferation, were investigated in transgenic potato plants (Table 2A
). Besides NAD(P)-ME (Table 1A
), there was an increase in the activity of PK (measured either at the pH optimum of the putative chloroplastic or cytosolic enzymes; i.e. pH 7.9 or pH 6.9) only in single cppc overexpressors, which would be consistent with an increase in glycolytic fluxes. PEPP, an enzyme which catalyses a similar reaction as PK, but without ATP generation, was elevated in single transformants of potato carrying the cppc gene as well as in two lines of the cppc/fpMe1 double transformants when measured at pH 7.9 (Table 2A
; PEPP [2]). An increase in PEPP has been discussed as an indicator for phosphate depletion (Duff et al., 1989
). Activities of NADP-MDH and NAD-MDH, which catalyse the conversion of OAA to malate in the stroma or extra-chloroplastic compartments, were not affected in single cppc or fpMe1 overexpressors. For the double cppc/fpMe1 overexpressors, only the line 3LD9/ME2 showed an increase in both NAD-MDH and NADP-MDH activities. NADP- and NAD-GAPDH catalysing 3PGA/GAP conversions in the stroma or the cytosol were increased only in the double transformants (cppc/fpMe1), but not in the respective single transformants (cppc or fpMe1). NADP-ICDH activity, which is involved in anaplerotic generation of carbon skeletons for amino acid biosynthesis, showed the trend of a slight increase only in cppc overexpressors.
|
As for potato, there was an appreciable increase in the activity of PK in individual cppc overexpressors of tobacco, which was prominent for the putative cytosolic enzyme (measured at pH 6.9). In contrast to potato, PK activity was also increased in double transformants of tobacco carrying cppc and fpMe1 (Table 2B
|
|
|
The CO2 compensation point (
*) and dark respiration in the light (Rd) are differentially affected in transgenic potato plantsThe effect of single and double overexpression of cppc and fpMe1 on the CO2 compensation point in the absence of dark respiration in the light (
*) and on dark respiration in the light (Rd) was studied with transgenic potato plants using the method of Brooks and Farquhar (Brooks and Farquhar, 1985
* on the Ci-axis and -Rd on the A-axis (Fig. 3A
*=38 µl l-1 and 32 µl l-1, and Rd=0.77 µmol m-2 s-1 and 1.2 µmol m-2 s-1 for the control plant (line pS13) and the PEPC (cppc) overexpressor (line 3LD13), respectively. However, A/Ci curves of fpMe1 overexpressors (line ME19) and double cppc/fpMe1 transformants (lines 3LD9/ME5 and 2) look more complex because a clear single intersection of the A/Ci curves is missing (Fig. 3C
* appeared to be slightly increased in ME19 (Fig. 3C
* from 38 µl l-1 in the control plant to 23 µl l-1 and 18 µl l-1 in the lines 3LD9/ME5 and 3LD9/ME2, respectively, only when the PFDs ranged between 150300 µmol m-2 s-1. This appeared to be accompanied by an increase in Rd from 0.9 µmol m-2 s-1 in the control plant to about 1.7 µmol m-2 s-1 in the double transformants. However, the A/Ci curves at low light (15 µmol m-2 s-1) and at high light (600 µmol m-2 s-1) dramatically diverged indicating that this approach for
* and Rd determination is not feasible. It is likely that stromal redox potentials are perturbed with increasing PFDs by the introduction of chloroplast NADP-ME, particularly when it operates in concert with overexpressed PEPC.
|
Oxygen-dependent inhibition of CO2 assimilation and enhancement of electron requirements for CO2 assimilation are diminished in transgenic potato plants with a combined overexpression of PEPC and NADP-ME
An increase in atmospheric O2 from 2% to 21% and/or in temperature from 25 °C to 35 °C (at 21% O2) increases the rate of oxygenation over the rate of carboxylation of RuBP catalysed by Rubisco (Chen and Spreitzer, 1992
) and results in a decline in A and in an increase in the electron requirement for A (e/A-ratio) as a consequence of higher photorespiration rates. This increase in the e/A-ratio is due to higher losses of CO2 per electron transported and to the additional requirement of electrons for the recycling of carbon back into the Calvin cycle.
Photosynthetic parameters of wild-type and transgenic potato plants were compared on the basis of O2 and temperature effects on A and e/A-ratios (for the latter compare Lipka et al., 1999
). The percentage O2 inhibition of A can be expressed as (Anpr-Apr)/Anprx100, where npr and pr denote non-photorespiratory (i.e. 2% O2) and photorespiratory (i.e. 21% O2) conditions, respectively (Ku et al., 1999
). Likewise, the O2 effect on the e/A-ratio can be expressed as (e/Apr-e/Anpr)/e/Aprx100 reflecting the relative increase in the e/A-ratio as photorespiration increases. In the wild type, O2 inhibition of A and O2 dependent e/A-enhancement were increased from about 42.5% and 43.5% at 25 °C to 55.6% and 56.9% at 35 °C, respectively (Table 3A
). This shows that both parameters, the fractional O2 inhibition of A and enhancement of e/A-ratios are closely linked in the wild type and, as a closer inspection of Table 3A
reveals, in all transgenic potato lines investigated. In cppc overexpressors (line 3LD9), both parameters were indistinguishable from the wild type (Table 3A
), whereas they were lowered appreciably in fpMe1 overexpressors (line ME18) at 35 °C, but not at 25 °C. The O2 effect on both parameters was most pronounced for the double transformant lines (3LD9/ME3, 2 and 5). However, there were differential effects on both parameters between different double transformant lines with regard to the temperature. The relative attenuation of both parameters was similar in the line 3LD9/ME5 at 25 °C and 35 °C, whereas it was much more pronounced in the line 3LD9/ME2 at 35 °C than at 25 °C (Table 3A
). Thus, both parameters decreased by about 1012% at 35 °C in the line 3LD9/ME2.
Temperature dependencies of A and e/A-ratios in transgenic potato plants
Changes in A and in e/A-ratios are linearly correlated with the temperature between 25 °C and 35 °C in wild-type potato and transgenic lines overexpressing fpme1 alone or in combination with cppc (Lipka et al., 1999
). Different transgenic lines were compared on the basis of the slopes of A and e/A-ratios measured between 25 °C and 35 °C (A35-A25)/10 in a gas mixture containing either 21% or 2% O2. If the rate of photorespiration were decreased in 21% O2 (i.e. under photorespiratory conditions), a less steep decline in A or a less steep increase in e/A-ratios would be expected. The slopes (A35-A25)/10 were negative for wild-type and transgenic potato plants with an individual overexpression of either cppc or fpMe1 (Fig. 4A
) indicating that A declines with increasing temperature (see above). There was a decrease in the slopes (A35-A25)/10 to less negative values in double transformants overexpressing cppc/fpMe1 with the most pronounced effect for the line 3LD9/ME2. In 2% O2, conditions under which the oxygenase reaction of Rubisco is strongly suppressed, A was less affected in the wild-type and single cppc and fpMe1 overexpressors. However, there was an marked increase in the slopes (A35-A25)/10 for the double transformants, in which A increased with increasing temperature.
The fractional changes of the e/A-ratio were similar, but not identical to those of A (Fig. 4B
). There was a slight decline in the slope of e/A-ratios in single cppc overexpressors, a more pronounced decline in the fpMe1 overexpressors and a clear decrease in three of the four double transformants (Fig. 4B
). In the line 3LD9/ME2, there was even a negative slope suggesting a decrease rather than an increase in the e/A-ratio as the temperature is raised. In 2% O2, slopes of e/A-ratios were negative and not appreciably affected in transgenic plants compared to the wild type. For the cppc/fpMe1 double transformants, temperature effects on A and e/A ratios were consistent with the observed O2 effects on both parameters shown in Table 3A
.
Oxygen-dependent inhibition of CO2 assimilation and enhancement of electron requirements for CO2 assimilation are altered in transgenic tobacco plants with an individual or a combined overexpression of PEPC, NADP-ME, and PEPCK
The impact of O2 on photosynthesis was measured in transgenic tobacco plants overexpressing cppc individually or in combination with fpMe1 or pck (Table 3B
). In contrast to potato, an appreciable effect on the attenuation of O2 inhibition of A or the enhancement of e/A-ratios was observed for PEPC overexpressors. There was apparently no effect on both parameters in plants overexpressing pck alone and a trend of a decline when plants overexpress cppc and pck in combination. Beside cppc overexpressors, double transformants overexpressing cppc and fpMe1 showed a decline in the O2 inhibition of A at 25 °C, but not at 35 °C. However, this was less marked than in individual cppc overexpressors. Moreover, for the double PEPC/NADP-ME transformants (cppc/fpMe1) there was a pronounced discrepancy between the attenuation of O2 inhibition of A (28.0±9.5%) and the O2 enhancement of e/A-ratios at 25 °C (38.2±7.1%).
Temperature dependencies of A and e/A-ratios in transgenic tobacco plants
The slopes (A35-A25)/10 measured in 21% O2 (Fig. 5A
) were negative for wild-type and transgenic tobacco plants overexpressing cppc alone or in combination with fpMe1. However, an overexpression of pck individually or in combination with cppc resulted in a lack of temperature response of A, i.e. the slopes (A35-A25)/10 were close to zero (Fig. 5A
). Under non-photorespiratory conditions (2% O2), the increase in A with increasing temperature was similar for wild-type plants and the individual transgenic lines. A trend of a decline in the e/A-ratio was observed only in transgenic tobacco plants overexpressing cppc and pck in combination, but not in the respective single transformants (Fig. 5B
). In 2% O2, there was also a decline in the slope of the e/A- ratio in transgenic tobacco lines overexpressing pck, cppc/pck and cppc/ME. In conclusion, temperature effects on A and e/A-ratios (Fig. 5
) were not consistent with the observed O2 effects on both parameters for the individual transformant lines (Table 3B
).
Effect of elevated PEPC activity on the content of UV protectants (flavonoids) in potato leaves
In a recent report, Pinto et al. observed a direct linear correlation between the activity of cytosolic NADP-ME and flavonoid contents in bean leaves after treatment of N-deficient plant with UV-radiation (Pinto et al., 1999
). The question was asked whether an increase in cytosolic NADP-ME in PEPC overexpressors of potato causes a similar increase in UV-protectants. Surprisingly, the combined increase in the activity of PEPC and endogenous cytosolic NADP-ME in cppc or stppc overexpressors diminished rather than increased flavonoid contents in transgenic potato. As is shown in Fig. 6
, flavonoid contents declined by 15% (cppc) to 44% (stppc) in single PEPC overexpressors, but remained unchanged compared to the wild type in fpMe1 overexpressors or in double transformants overexpressing cppc in combination with fpMe1. These data suggest that initial steps of the shikimate pathway in the chloroplasts, which provide the phenolic ring for flavonoid biosynthesis, are impaired when PEP consumption is increased in the cytosol by overexpressing either cppc or stppc.
|
| Discussion |
|---|
|
|
|---|
An attempt was made to lower the rate of photorespiration and to increase thereby the efficiency of CO2 assimilation in C3 plants by introducing a combination of genes involved in the CO2 concentrating mechanism of C4 plants into the two closely related solanaceous species, potato and tobacco. An increase in the activity of individual C4-cycle enzymes might cause perturbations of metabolism in C3 plants, but it can also result in substantial effects on certain aspects of photosynthetic performance (Häusler et al., 1999
Compensational changes in endogenous enzyme activities in transgenic potato and tobacco plants
Enzymes involved in the metabolism of PEP or in the products of PEP carboxylation were altered in transgenic potato and tobacco plants. The most striking effect was observed for cytosolic NADP-ME, which increased up to 4-fold in transgenic potato plants as a response to increased PEPC activities. Staining for NADP-ME activity on native gels suggested a much higher increase in some experiments (Fig. 1
). Introduction of the bacterial PEPC (cppc) as well as of a modified version of the endogenous gene (stppc) yielding a protein, which is less sensitive to malate inhibition (see Materials and methods), induced cytosolic NADP-ME at a transcriptional level. Even wild-type potato and tobacco plants exhibit relatively high activities of cytosolic NADP-ME compared to other C3 plants as, for instance, F. pringlei (Table 1C
). This is consistent with the observation that leaves of solanaceous species contain substantial activities of this enzyme (Knee et al., 1996
). In leaves of C3 plants the role of cytosolic NADP-ME is unclear. There are indications that the cytosolic enzyme is associated with vascular bundles, particularly with developing xylem and internal phloem (Schaaf et al., 1995
) suggesting that NADPH produced by this reaction is required for lignin biosynthesis. Moreover, antisense repression of cytosolic NADP-ME in tobacco resulted in a decline in lignin deposition (Schuch et al., 1990
). The highest expression was found in stems and roots, and the lowest in the leaves. There are also a number of indications for the involvement of NADP-ME in stress responses (Casati et al., 1999
), such as in bean plants, where the expression of NADP-ME increased as a result of N-limitation (for potato, Fig. 2
; right panel) and correlates with the abundance of UV-absorbing compounds (see below). This points to an involvement of NADP-ME in the biosynthesis (probably via NADPH proliferation) of these compounds (Pinto et al., 1999
).
For the transgenic potato plants, the observed increase in the activities of endogenous cytosolic NADP-ME is most likely the consequence of metabolic perturbation caused by the introduction of PEPC. The increase in cytosolic NADP-ME may counteract interfering effects on cell pH as a consequence of excessive accumulation of malic acid in the cytosol. In a broad range of transgenic potato plants overexpressing either cppc or stppc, the increase in endogenous cytosolic NADP-ME activity appeared to be directly correlated with the increase in PEPC activities. Interestingly, the induction of NADP-ME was attenuated in transgenic potato plants overexpressing both cppc and fpMe1 despite the identical range of PEPC activities in single and double transformants (Table 1A
). This suggests





), 150(), 300(
), and 600(
) µmol m-2 s-1. Arrows point at possible intersections of the curves. ((A) and (B) were taken from Häusler et al., 1999).