Journal of Experimental Botany, Vol. 53, No. 371, pp. 1005-1015,
May 2002
© 2002 Oxford University Press
Original Papers |
Characterization of Arabidopsis photolyase enzymes and analysis of their role in protection from ultraviolet-B radiation
School of Biological Sciences, University of Manchester, Oxford Road, Manchester M13 9PT, UK
Received 8 August 2001; Accepted 21 December 2001
| Abstract |
|---|
|
|
|---|
DNA photolyases are enzymes which mediate the light-dependent repair (photoreactivation) of UV-induced damage products in DNA by direct reversal of base damage rather than via excision repair pathways. Arabidopsis thaliana contains two photolyases specific for photoreactivation of either cyclobutane pyrimidine dimers (CPDs) or pyrimidine (6-4)pyrimidones (6-4PPs), the two major UV-B-induced photoproducts in DNA. Reduced FADH and a reduced pterin were identified as cofactors of the native Arabidopsis CPD photolyase protein. This is the first report of the chromophore composition of any native class II CPD photolyase protein to our knowledge. CPD photolyase protein levels vary between tissues and with leaf age and are highest in flowers and leaves of 35-week-old Arabidopsis plants. White light or UV-B irradiation induces CPD photolyase expression in Arabidopsis tissues. This contrasts with the 6-4PP photolyase protein which is constitutively expressed and not regulated by either white or UV-B light. Arabidopsis CPD and 6-4PP photolyase enzymes can remove UV-B-induced photoproducts from DNA in planta even when plants are grown under enhanced levels of UV-B irradiation and at elevated temperatures although the rate of removal of CPDs is slower at high growth temperatures. These studies indicate that Arabidopsis possesses the photorepair capacity to respond effectively to increased UV-B-induced DNA damage under conditions predicted to be representative of increases in UV-B irradiation levels at the Earth's surface and global warming in the twenty-first century.
Key words: Arabidopsis thaliana, CPD photolyase, 6-4PP photolyase, UVB.
| Introduction |
|---|
|
|
|---|
The predicted reductions in the stratospheric ozone layer will result in increased levels of ultraviolet-B (UV-B) radiation (280315 nm) reaching the Earth's surface (Madronich et al., 1998). The rising concentrations of greenhouse gases may also result in coincident increases in surface temperatures and global climate change. UV-B radiation has a number of deleterious effects on physiological processes in plants (reviewed by Jansen et al., 1998; Rozema et al., 1997), including the inhibition of photosynthesis (Bornman, 1989), growth (Caldwell et al., 1995) and crop yield. Direct absorption of UV-B radiation induces the formation of pyrimidine dimers in DNA, which are the most predominant and biologically significant UV-B-induced lesions in DNA. Cyclobutane pyrimidine dimers (CPDs) constitute the major class of these lesions (75%) with the remainder being mainly pyrimidine (6-4)pyrimidone dimers (6-4PPs). Pyrimidine dimers are inhibitory to both DNA replication and transcription, so that impaired plant growth and mutagenesis during DNA replication result if these lesions remain unrepaired.
The accumulation of CPDs and 6-4PPs in DNA must be prevented if cell viability is to be maintained. Higher plants have evolved at least two major mechanisms for their removal. In the absence of visible light, pathways termed dark repair mechanisms can be used by plant systems to repair UV-B-induced damage in DNA. These pathways often involve several enzyme-mediated steps and constitute base and nucleotide excision repair mechanisms. In these DNA repair processes, recognition and excision of the damaged bases, often accompanied by excision of undamaged flanking regions of DNA, is followed by resynthesis and ligation of DNA strands. The light-dependent (360420 nm) repair of CPDs and 6-4PPs, termed photoreactivation, is believed to be the major pathway for the removal of these lesions in higher plants. Photoreactivation is mediated by photolyase enzymes which directly reverse DNA damage in an error-free manner.
A class of CPD-specific photolyases from micro-organisms, designated class I photolyases, were the first members of the photolyase family to be characterized (Sancar, 1994). A closely related class of 6-4 photoproduct-specific photolyases has recently been identified, with representatives found in Drosophila melanogaster (Todo et al., 1996), Xenopus laevis (Todo et al., 1997) and Arabidopsis thaliana (Nakajima et al., 1998). Cryptochromes, which are the blue-light photoreceptors found in plants and other organisms, are also closely related to class I photolyases. A more distantly related family of CPD photolyases designated class II photolyases (Yasui et al., 1994) has been identified in a number of species, including animals (Yashuhira and Yasui, 1992, 1994), Archaebacterium (Yasui et al., 1994), Eubacterium (O'Conner et al., 1996), and higher plants (Taylor et al., 1996a; Ahmad et al., 1997). All photolyases characterized to date have been shown to contain reduced FAD, and generally possess a second chromophore dependent on species, either the pterin 5,10-methenyltetrahydrofolate (MTHF) or 8-hydroxy-5-deaza-riboflavin (8-HDF) (Sancar, 1994). A similar reaction mechanism has been proposed for both classes of CPD photolyase (Sancar, 1994, 1996). The MTHF or 8-HDF chromophore functions as a photoantenna which absorbs blue light and transfers the resultant excitation energy to reduced FAD. The FADH- then donates an electron to the CPD which subsequently undergoes electronic rearrangement such that the cyclobutane ring is cleaved. The electron is then transferred back to regenerate FADH-. The cofactor composition of plant photolyase enzymes has not definitively been investigated, although it has recently been reported that the Arabidopsis CPD photolyases, when heterologously expressed in E. coli, contained only FADH and that this single cofactor was sufficient to confer enzyme activity (Kleiner et al., 1999).
Photoreactivation of UV-induced DNA damage is currently the best-characterized DNA repair pathway in higher plants (reviewed by Vornarx et al., 1998; Britt, 1996, 1999). Representatives of other repair pathways, including both base and nucleotide excision repair pathways and a mismatch repair pathway have now been characterized in plants (Vornarx et al., 1998; Britt, 1996, 1999). Light-dependent repair of both CPDs and 6-4PPs has been demonstrated in a number of plant species (Trosko and Mansour, 1968, 1969; Small, 1987; Pang and Hays, 1991; Chen et al., 1994; Taylor et al., 1996b; Hada et al., 1998). In addition, class II CPD photolyase and 6-4PP photolyase enzymes have recently been cloned from Arabidopsis thaliana (Taylor et al., 1996a; Ahmad et al., 1997; Nakajima et al., 1998). However, these studies did not investigate the ability of higher plants to cope with the increased DNA damage which may result from predicted elevated levels of UV-B incident at the Earth's surface. CPD photolyase activities have previously been reported to be markedly temperature sensitive in both Arabidopsis (Pang and Hays, 1991) and cucumber (Takeuchi et al., 1996). CPD repair activities decreased substantially at temperatures above 25 °C and were negligible at 37 °C. A reduced capacity for photoreactivation of CPDs and 6-4PPs could have severe repercussions for crop productivity especially as increases in levels of UV-B reaching the Earth's surface may coincide with elevated surface temperatures due to rising concentrations of greenhouse gases. In this study the biochemical characteristics and expression patterns of the Arabidopsis thaliana CPD and 6-4PP photolyase enzymes have been examined in the context of these anticipated changes in environmental conditions. The cofactor composition of the native class II CPD photolyase enzyme has also been examined and it has been shown to contain both reduced FADH and a pterin.
| Materials and methods |
|---|
|
|
|---|
Plant material and growth conditions
Arabidopsis thaliana (cv. Landsberg erecta) seeds were sown directly onto damp Levingtons M2 compost. Light-grown plants were raised in an environmental growth chamber (SGC970/C/HQI, Sanyo-Gallenkamp, Loughborough, UK) under controlled conditions of constant humidity (70%), with 16 h light and 8 h dark cycles at 20 °C unless otherwise stated. Visible light was provided by a combination of high intensity discharge lamps (Osram, Light Source Supplies, Bishops Stortford, UK) and tungsten lamps. The quantum flux density was measured daily 2 h into the photoperiod and was equivalent to 100 µmol m-2 s-1 photosynthetically active radiation (PAR) for light-grown tissue. Dark-grown tissue was raised under identical conditions except for the absence of light. UV-B irradiation was performed either in the absence of other light sources or in the presence of white light. Two UV-emitting tubes (Philips TL40/12, Philips, The Netherlands) were present in the growth chambers and wrapped in cellulose acetate (0.13 mm thick) to filter UV-C and UV-B wavelengths below 295 nm that are not present in natural sunlight. The cellulose acetate was changed at the start of each experiment.
Microbiological methods
DNA procedures and bacterial manipulations were performed using established protocols (Sambrook et al., 1989) unless otherwise stated. Plasmid DNA was prepared on an analytical scale by alkaline lysis (Birnboim and Doly, 1979) or using Qiagen columns according to the manufacturer's instructions (Qiagen Ltd., UK). DNA fragments were labelled by random hexanucleotide priming with [
-32P]dCTP (ICN, Costa Mesa, USA) and the Klenow fragment of E. coli DNA polymerase (Stratagene, UK).
Overexpression and purification of 6xHis-CPD photolyase
The ORF of the cloned A. thaliana CPD photolyase in the pCR2.1 vector (Invitrogen, Leek, The Netherlands) was amplified with primers containing BglII (AGCAAGATCTTTAAACAATAGTTATCTTGGGATCA) and NheI (TGCAACATATGGCGTCGACAGTCTCAG) sites at the 5' and 3' ends of the ORF, respectively, using the proof-reading DNA polymerase Pfu (Stratagene, UK). The DNA fragment was introduced at the NdeI site of the pET-11b vector (Calbiochem-Novabiochem, Nottingham, UK) in frame with a 6xHis tag coding region, yielding 6xHis-PHR1. E. coli BL21(DE3)pLysS was transformed with 6xHis-PHR1 and cultured in LB medium supplemented with 50 mg l-1 ampicillin until an OD 600 nm of 0.61.0 was reached. Expression of 6xHis-CPD photolyase was induced by the addition of 1 mM isothiopropylgalactoside and growth continued for 3 h. Bacterial cell extracts were prepared by sonication of 36 ml cells suspended in RS buffer (50 mM TrisHCl, pH 7.5, 50 mM NaCl, 0.1% Triton X-100, 10 mM imidazole, 5% (v/v) glycerol, 8 M urea) (1:10 buffer:culture media ratio used). The resultant suspension was clarified at 10 000 g for 10 min. The supernatant was applied to a nickel-chelating Sepharose fast-flow affinity chromatography column (Pharmacia), washed in lysis buffer containing 100 mM imidazole, and eluted in buffer containing 500 mM imidazole. The eluted proteins were purified by preparative SDSPAGE using 10% acrylamide gels. The 6xHis-CPD photolyase band was excised from the Coomassie-blue stained gel and destained using several changes of 100 mM TrisHCl pH 7.0. Protein was electroeluted from the gel slices, mixed with Freund's adjuvant and used to raise antiserum in sheep (Scottish Antibody Production Unit, Carluke, Scotland).
Preparation of peptide antiserum to AtPHR1
Peptide antiserum was prepared to regions which showed no sequence conservation with either CPD photolyases or cryptochrome proteins. Peptides corresponding to C-terminal (ESKIRNQRPKLK) and internal (HDSASKECKRKAGEA) amino acid sequences of AtPHR1 were synthesized (Research Genetics, USA), conjugated to KLH or MAP derivatized, respectively, and injected into sheep to raise antibodies (Scottish Antibody Production Unit, Carluke, Scotland). The antiserum was purified using Protein G affinity columns (Amersham Pharmacia Biotech, Amersham, UK).
RNA isolation and Northern analysis
Total RNA was isolated from A. thaliana tissues and analysed by Northern analysis as described previously (Taylor et al., 1998).
Isolation of genomic DNA and ELISA analysis of thymine dimers
Arabidopsis tissue was harvested, stored at -80 °C and ground to a fine powder in liquid N2. DNA was isolated using the DNeasy Plant Kit (Qiagen). The yield of DNA was determined by spectrophotometric absorbance at 260 nm. CPD and 6-4PP lesions were detected by an ELISA procedure using TDM-1 and 6-4M monoclonal antibodies, specific for CPDs and 6-4PPs, respectively, as described earlier (Taylor et al., 1996b).
Immunodetection of CPD photolyase
Proteins were extracted from Arabidopsis tissue as described previously (Pang and Hays, 1991). Protein concentrations were determined by the Bio-Rad protein assay (Bio-Rad Laboratories, Hemel Hempstead, UK) using bovine serum albumin (BSA) as a standard. Protein samples were separated by SDSPAGE (10% gel) and transferred to PVDF membrane (Bio-Rad) for 3 h at 100 V. The blots were probed with anti-Arabidopsis CPD photolyase antiserum. The immune complexes were detected by alkaline-phosphatase conjugated antisheep IgG (Sigma-Aldritch, Poole, UK) and developed using premixed BCIP/NBT solution (Sigma). Primary and secondary antisera were used at 1/10 000 and 1/30 000 dilutions, respectively.
Chromophore analysis
Proteins were extracted from 20 g 4-week-old Arabidopsis tissue as described above. The resultant protein preparation was added to a 1/2000 dilution of either anti-CPD antiserum or pre-immune serum bound to CNBR- Agarose beads (Autogen Bioclear, Calne, UK) in a total volume of 10 ml TrisHCl, pH 7.4, containing 2 mM EDTA and the mixture was left on a rotator for 2 h at 4 °C. The immunoprecipitated protein was recovered by centrifugation at 13 000 g for 15 min and eluted from beads using 50 ml glycine (pH 3.0). Aliquots (1 ml) were analysed by absorption spectroscopy between 250 and 800 nm using a Shimadzu UV-2401 PC spectrophotometer.
| Results |
|---|
|
|
|---|
Overexpression and purification of Arabidopsis 6xHis-CPD photolyase in E. coli
The A. thaliana CPD photolyase was overexpressed as a 6xHis fusion protein in E. coli and the fusion protein used for the production of antibody probes with which to investigate CPD photolyase expression. The protein was purified by a combination of nickel affinity chromatography and preparative SDSPAGE. The purified 6xHis-CPD photolyase protein was identified as a single band of molecular mass 60 kDa after SDSPAGE analysis and silver staining (Fig. 1A
|
Preparation of peptide antiserum to AtPHR1
Peptides were designed to unique amino acid motifs (C-terminal and internal) in the predicted amino acid sequence of the Arabidopsis 6-4PP photolyase enzyme (AtPHR1), conjugated to KLH or MAP derivatized, respectively, and used to raise antiserum in sheep. Immune but not preimmune serum cross-reacted with the conjugated peptide antigen upon immunoblot analysis (data not presented). The antiserum specifically recognized a 63 kDa protein in floral tissue extracts prepared from Arabidopsis (Fig. 3B
), comparable with the predicted molecular mass of the protein (61.6 kDa) encoded by the cDNA clone representing the Arabidopsis 6-4PP photolyase (Nakajima et al., 1998).
|
Chromophore analysis of the Arabidopsis CPD photolyase
The majority of CPD photolyase enzymes characterized to date have been shown to contain two cofactors, reduced FADH, and either the reduced pterin 5,10-methenyltetrahydrofolyl polyglutamate (MTHF) or 8-hydroxy-5-deazaflavin. However, the class I CPD photolyase from Anacystis nidulans (Takao et al., 1989), a class II enzyme from Potorus tridactylis (Yasui et al., 1994), and the Arabidopsis CPD photolyase (Kleiner et al., 1999) appeared to contain only reduced FADH as the single cofactor when these proteins were heterologously expressed in E. coli. In these studies FADH alone was evidently sufficient for CPD photolyase enzyme activity. The native cofactor composition of plant photolyase enzymes has not been definitively investigated. The cofactor composition of the native Arabidopsis CPD photolyase has been examined by immunopurification of CPD photolyase from Arabidopsis leaf protein preparations, using Arabidopsis CPD photolyase antiserum. The identity of the purified protein was confirmed by SDSPAGE and Western blotting using the anti-CPD photolyase antiserum (Fig. 2A
|
CPD and 6-4PP photolyase protein levels vary between tissues and development in Arabidopsis
Antiserum raised to Arabidopsis CPD photolyase was used to examine the distribution of CPD photolyase protein in Arabidopsis tissues by Western analysis. The antiserum cross-reacted with a single band of 60 kDa in Arabidopsis extracts, identical in size to the protein recognized in lysates of E. coli expressing the 6xHis-CPD photolyase (Fig. 3A
). In A. thaliana, the CPD photolyase protein was most abundant in floral tissues, with intermediate levels present in leaf tissue and very low levels evident in roots (Fig. 3A
). Western analysis using antiserum recognizing Arabidopsis 6-4PP photolyase showed that this protein has a very similar tissue distribution to that of the CPD photolyase. 6-4PP photolyase was detected in all tissues except roots, with highest levels in siliques (Fig. 3B
).
The levels of CPD and 6-4PP photolyase proteins in Arabidopsis leaves varied with developmental stage (Fig. 3A
, B
). CPD photolyase protein was present only at low levels in leaves of young Arabidopsis plants (7-d seedlings), but then increased between 714-d (corresponding to the 24 leaf stages) before declining in the leaves of mature plants (6 weeks) (Fig. 3A
). The possibility that leaves possess different CPD photolyase protein levels at a given developmental stage (4-leaf, 8-leaf and 12-leaf) was addressed, but no significant differences in CPD photolyase protein content between oldest and youngest leaf pairs of Arabidopsis plants at any specific developmental stage was observed (data not presented). 6-4PP photolyase protein was present at all leaf ages examined (Fig. 3B
).
Expression patterns of CPD and 6-4PP photolyase enzymes in Arabidopsis
Previously it has been reported that light-dependent repair of CPDs in Arabidopsis requires exposure to visible light both prior and subsequent to UV irradiation (Chen et al., 1994). The effects of white light and UV-B irradiation on CPD and 6-4PP photolyase protein levels have been examined in aerial tissues of Arabidopsis Landsburg erecta and an explanation for these observations has been provided. UV-B levels approximating to a 100% increase in ambient levels in natural sunlight measured on a summers day in the North of England were used in this study. The incident dose rate was estimated to be equivalent to a dose of 0.36x10-1 W m-2 (Taylor et al., 1996b). Care was taken to filter out wavelengths below 290 nm, i.e. those wavelengths not penetrating the stratospheric ozone layer, by using cellulose acetate filters around the light source. Arabidopsis plants were grown to the eight-leaf stage under standard conditions (16 h light and 8 h dark photoperiod at 20 °C) and subsequently kept in the dark for periods up to 5 d. CPD photolyase protein levels declined over the first 3 d of this continuous dark period until they became undetectable in Arabidopsis leaf tissue (Fig. 4A
). The induction of CPD photolyase expression by white light and/or UV-B was also investigated using plants kept in the dark for 24 h. The level of CPD photolyase protein in leaf tissue of 24 h dark-grown plants increased rapidly after 1 h exposure to white light and reached a maximum after 24 h (Fig. 4B
). The levels of CPD photolyase protein then declined, so that after 24 h continuous illumination in white light only low levels of CPD photolyase protein were present in aerial tissues (Fig. 4B
). CPD photolyase protein levels continued to decline gradually over the next 72 h during continuous white light irradiation of plants (data not presented). CPD photolyase protein synthesis can be induced by either UV-B alone (Fig. 4C
) or white light supplemented with UV-B (Fig. 4D
). CPD photolyase protein levels remained high for up to 24 h when a UV-B component was present in the irradiation, which is several hours longer than when plants were irradiated with white light alone. However, a subsequent decline in CPD photolyase protein levels was then observed from 24 h until 3 d of continuous irradiation in the presence of UVB (data not shown). This is a similar, albeit delayed response, compared with that seen in Arabidopsis plants subjected to continuous illumination in white light alone (Fig. 4B
, C
, D
). Higher levels of CPD photolyase protein were induced in both the presence of UV-B alone and white light supplemented with UV-B than with white light alone. CPD photolyase mRNA transcript levels showed a similar pattern of induction to that of CPD photolyase proteins under identical conditions of continuous white light and UV-B irradiation (Fig. 4E
). These observations demonstrate that CPD photolyase expression is induced by both white light and UV-B, but that this induction is not sustained under continuous irradiation. When the patterns of 6-4PP photolyase expression in Arabidopsis were examined, it was found that the protein was always present in the dark and did not appear to be induced by either white light (Fig. 4F
) or UVB (data not presented). Thus, expression of the 6-4PP photolyase responsible for the photoreactivation of 6-4 photoproducts in Arabidopsis appears to be constitutively expressed and is not light regulated.
|
CPD but not 6-4PP exhibits a lagperiod in photoreactivation after 3 d dark exposure
The capacity of Arabidopsis leaf tissue to remove CPDs and 6-4PPs from damaged DNA after prolonged UV-B exposure in the dark was examined by placing plants in continuous UV-B irradiation for between 1 d and 4 d. The repair of UV-B-induced CPDs was examined by ELISA to determine the levels of residual UV-B-induced lesions in DNA at various times after the plants were returned to white light. Arabidopsis plants irradiated with UV-B for either 1 or 2 d before exposure to photoreactivating light were able to remove UV-B-induced CPDs almost immediately after exposure to white light, although higher levels of initial DNA damage were evident in leaf tissues after 2 d UV-B irradiation (Fig. 5A
). The repair of CPDs was detectable after 30 min and appreciable by 2 h following exposure to white light when plants had been kept in the dark for the preceding 1 or 2 d (Fig. 5A
). However, plants exposed to UV-B irradiation in the dark for 3 d or more before exposure to white light displayed a lag period of 2 h after transfer to white light before any detectable repair of UV-B-induced CPDs was observed (Fig. 5A
). No such lag period was evident for the repair of 6-4 photoproducts (Fig. 5B
), consistent with constitutive expression of the 6-4PP photolyase in Arabidopsis. The delay in removal of UV-B-induced CPDs by photoreactivation after 3 d continuous UVB irradiation in the dark is consistent with the negligible levels of both CPD photolyase transcript and protein found in Arabidopsis leaf tissue after 3 d dark/UV-B exposure (Fig. 4
). Exposure of leaf tissue from these plants to white light is necessary to induce CPD photolyase expression and the 2 h lag period before removal of CPDs is consistent with the requirement for induction of CPD photolyase mRNA transcription and de novo protein synthesis (Fig. 4B
). These observations demonstrate that exposure to white light prior to and after UV-B irradiation is necessary for the induction of CPD photolyase transcription and protein synthesis in Arabidopsis and explains why plants grown for extensive periods in the dark (Chen et al., 1994) require exposure to photoreactivating light before any repair of CPDs is detectable.
|
The effects of temperature on CPD and 6-4PP photolyase protein levels and repair activities
The light-dependent repair of CPDs in Arabidopsis and in cucumber cotyledons has been reported to be markedly temperature sensitive (Pang and Hays, 1991; Takeuchi et al., 1996). Photolyase-mediated repair of CPD lesions was reported to decline between 22 °C and 30 °C and to be negligible when Arabidopsis plants were transferred from 22 °C to 37 °C for 13 h (Pang and Hays, 1991). The effects of varying temperatures on CPD photolyase protein levels and enzyme activities in Arabidopsis plants grown in conditions consistent with those used in earlier studies (Pang and Hays, 1991) have been investigated in an attempt to explain these observations. Arabidopsis plants at the 8-leaf developmental stage were transferred from their standard growth conditions (22 °C) and placed in the dark to acclimatize to the appropriate temperature for 2 h. The plants were then exposed to white light for the indicated periods of time and CPD photolyase protein levels in leaf tissue extracts were determined by Western blotting (Fig. 6A
). CPD photolyase protein levels did not differ significantly either between plants exposed to different temperatures, or with duration of time for which plants were kept at the elevated growth temperature (Fig. 6A
). The possibility that enzyme activity might be temperature-sensitive whilst CPD photolyase protein levels remained unaltered was then investigated.
|
Arabidopsis plants were placed at the appropriate temperature for 18 h in the dark, then supplemented with UVB for the last 6 h to induce formation of DNA damage, prior to determining the temperature dependence of UV-B-induced lesion repair (Fig. 6B
|
| Discussion |
|---|
|
|
|---|
CPD and 6-4PP photolyase protein levels in Arabidopsis varied markedly both between tissues and temporally with leaf development. The highest levels were associated with floral tissue, which may serve to minimize the formation of mutagenic lesions in germline DNA. Young Arabidopsis seedlings were found to contain very low levels of CPD photolyase protein compared to mature leaf tissue. This is unexpected since the repair of UV-B-induced DNA damage might be expected to be more critical in young seedlings where DNA replication is associated with elevated levels of cell division. One explanation could be that enzyme activities involved with dark repair pathways, i.e. base and/or nucleotide excision repair pathways, are elevated in tissues in which active cell division is taking place. Support for this hypothesis comes from studies on the primary wheat leaf which contains a natural developmental gradient of cells from the meristem at the base to senescing cells at the tip. The levels of DNA ligase I protein, an enzyme involved in both DNA replication and excision repair (Taylor et al., 1998) decrease from the basal meristem to the tip of the primary wheat leaf, whilst CPD photolyase protein levels increase from leaf base to tip (RM Taylor and WM Waterworth, unpublished observations). CPD photolyase protein content increased steadily with Arabidopsis leaf age between 11 d and 18 d, possibly coincident with the development of leaf photosynthetic capacity. The presence of low levels of CPD photolyase protein in root tissues is also consistent with CPD photolyase expression in other tissues and unicellular organisms which are never exposed to sunlight (Ozer et al., 1995). A number of lines of evidence suggest that photolyase may interact with components of NER and function in dark repair processes, possibly at the level of DNA damage recognition (reviewed in Thoma, 1999).
Native CPD photolyase protein was isolated from Arabidopsis leaf extracts by immunoprecipitation using antiserum raised to recombinant Arabidopsis CPD photolyase protein. The cofactors associated with this native Arabidopsis photolyase showed characteristics consistent with reduced FAD and a pterin such as MTHF. This is the first analysis of chromophores in a native class II CPD photolyase purified from a native source to our knowledge. Kleiner et al. reported that only reduced FAD could be identified as a cofactor when Arabidopsis CPD photolyase protein was heterologously expressed in E. coli (Kleiner et al., 1999). However, all other characterized photolyases and related cryptochrome proteins appear to contain two cofactors. The only exceptions to this have been when a small number of cloned CPD photolyases have been expressed in E. coli, specifically the class I CPD photolyase from the cyanobacterium Anacystis nidulans (Takao et al., 1989) and class II enzymes from Potorous tridactylis (Yasui et al., 1994) and Arabidopsis (Kleiner et al., 1999). In these studies either reduced FAD or an unidentifiable cofactor represented the only cofactor present in the photolyase protein. In the case of A. nidulans, the purified native enzyme was also shown to possess 8-HDF in addition to reduced FAD (Ecker et al., 1990). Discrepancies between the cofactor composition of native and heterologously expressed CPD photolyases may be attributable to differences in protein synthesis or post-translational processing, or that quantities of the second cofactor become severely limiting when large amounts of overexpressed photolyase are produced in E. coli cells. The molecular mass of the enzyme studied by Kleiner et al. was determined to be 50 kDa (Kleiner et al., 1999). This is significantly lower than expected for the Arabidopsis CPD photolyase, estimated at 60 kDa by SDSPAGE and predicted size to be 57 kDa from the primary sequence of the CPD photolyase cDNA clone (Taylor et al., 1996a). It is concluded that the native Arabidopsis CPD photolyase possesses two chromophores, reduced FAD and a pterin such as MTHF, whereas the enzyme expressed in the heterologous E. coli system is associated with only a single FAD chromophore.
Atmospheric pollution is expected to result in both increased UV-B levels reaching the Earth's surface through stratospheric ozone layer depletion and higher temperatures due to greenhouse warming. If photolyase-mediated repair of UV-B-induced DNA damage is very sensitive to temperature increases, as previously reported for Arabidopsis extracts (Pang and Hays, 1991) and cucumber (Takeuchi et al., 1996), then this could have implications for crop yields and biomass production through adverse effects on growth. However, it has been demonstrated that photoreactivation of CPD lesions in Arabidopsis in vivo is not as markedly temperature-sensitive as previously reported, whilst photoreactivation of 6-4PPs appears temperature-insensitive over the temperature range used in these and previous studies. CPD photolyase protein levels were examined by Western analysis and repair of UV-induced CPDs and 6-4PPs in DNA was evaluated directly using an ELISA-based assay system, thus allowing the CPD photolyase protein content and repair activities to be examined simultaneously in vivo. This contrasts with the earlier in vitro studies (Pang and Hays, 1991), although it must be noted that Takeuchi et al. used a similar ELISA-based system to assay CPD repair in cucumber (Takeuchi et al., 1996). The temperature sensitivity of CPD repair by photoreactivation could vary between plant species or ecotype. Indeed, differences in capacity for both dark and light repair of CPDs have been observed in a study of UV-B-resistant and -sensitive rice cultivars (Hidema et al., 1997), indicating that significant variation in photoreactivation capacity can be observed within a species. Thus, the temperature sensitivity of CPD photolyase activity may plausibly vary between different ecotypes of Arabidopsis. Arabidopsis thaliana ecotype Columbia was used by Pang and Hays (Pang and Hays, 1991), whereas the Landsberg erecta ecotype has been used here.
UV-B irradiation alone induces CPD photolyase protein synthesis in a manner comparable to that of white light, whilst exposure to white light supplemented with UV-B was shown to induce higher levels of CPD photolyase protein than with white light alone (Fig. 4
). Spectral analysis of emissions from the UV-B light source eliminated the possibility that a component of visible light present in the UV-B light source could have been responsible for this observation. Supplemental UV-B has been reported to induce a modest (50%) increase in CPD photolyase activity in the aerial tissue of light-grown Arabidopsis (Pang and Hays, 1991). That CPD photolyase activities and protein levels in Arabidopsis can be regulated by UV-B is consistent with the known regulation of photolyase by UV-B in other species routinely exposed to sunlight, and thus UV-B irradiation. Carassius auratus (goldfish), continuously exposed to light filtering through shallow water, exhibit a similar regulation of CPD photolyase by UV-B (Yasuhira and Yasui, 1992).
The observation that detectable CPD photolyase protein was present in Arabidopsis aerial tissues for up to 3 d in continuous darkness suggests that this protein has a slow turnover rate. This implies that there would always be a basal level of CPD photolyase protein present in tissues from the previous daylight exposure in field-grown plants which experience normal day/night cycles. Arabidopsis plants in the field are therefore normally capable of photoreactivation upon first exposure to light, of which UV-B radiation is an inevitable component.
In dark-grown Arabidopsis there is a requirement for a broad spectrum white light pulse before the repair of CPDs can be induced (Chen et al., 1994), and this is supported by the data presented here. Arabidopsis plants placed in the dark or continuous UV-B for 2448 h were shown to retain significant but reduced amounts of CPD photolyase protein (Fig. 4
), and to show almost immediate repair of any induced CPDs upon exposure to UV-B light (Fig. 5
). By contrast, plants grown in the dark, or exposed to continuous irradiation for 34 d were shown to contain low or undetectable levels of CPD photolyase protein or transcript and displayed a lag period of 2 h before the detectable repair of UV-B-induced CPD photoproducts in DNA was observed after exposure of plants to white light (Fig. 5
). The requirement for exposure of Arabidopsis plants to white light exposure prior to repair of CPDs (noted by Chen et al., 1994) can thus be explained by the use of 5 d dark-grown seedlings in their studies. The studies presented here indicate that no detectable levels of CPD photolyase protein would remain in plants grown in the dark for 4 d or longer and that CPD repair in such tissues cannot be implemented until de novo synthesis of new CPD photolyase protein, induced by changes in the light regime, has occurred.
Previous reports have found that photolyase activities were highly temperature-sensitive in higher plants. However, although the Arabidopsis lines used in these studies showed a decrease in CPD photolyase repair activity at higher temperatures, they efficiently photoreactivated UV-B-induced CPDs and 6-4PPs over a wide physiological temperature range. These data have important implications with respect to the responses of plant tissues to predicted increases in both UV-B levels at the Earth's surface and global warming early in the twenty-first century. In these studies with Arabidopsis at least, the photorepair capacity of plants appears to be able to cope with the anticipated increased levels of UVB-induced DNA damage sustained at elevated growth temperature regimes. However, further studies need to be undertaken on field-grown crops to determine whether genetically inbred crop species have retained the protective mechanisms found here in Arabidopsis.
| Acknowledgements |
|---|
We thank Caroline Grimshaw for technical assistance. We are grateful to M Nikaido for provision of TDM-1 and 6-4M monoclonal antibodies, specific for CPDs and 6-4PPs respectively. We also wish to thank Richard Taylor for advice and assistance during the duration of the work. This work was supported by BBSRC research grant number SP67343 on the Resource Allocation and Stress in Plants initiative for Wanda M Waterworth.
| Footnotes |
|---|
1 To whom correspondence should be addressed. Fax: +44(0)161 2753938. E-mail: mqbsswmw{at}man.ac.uk
| References |
|---|
|
|
|---|
Ahmad M, Jarilo J, Klimczak L, Landry L, Peng T, Last R, Cashmore A. 1997. An enzyme similar to animal type II photolyases mediates photoreactivation in Arabidopsis. The Plant Cell 9, 199207.[Abstract]
Birnboim HC, Doly J. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Research 7, 15231523.
Bornman JF. 1989. Target sites of UV-B radiation in photosynthesis of higher plants. Journal of Photochemistry and Photobiology 4, 145158.
Britt AB. 1996. DNA damage and repair in plants. Annual Review of Plant Physiology and Plant Molecular Biology 47, 75100.[Medline]
Britt AB. 1999. Molecular genetics of DNA repair in higher plants. Trends in Plant Science 4, 2025.[ISI][Medline]
Caldwell MM, Teramura AH, Tevin M, Bornman JF, Bjorn LO, Kulandaivelu G. 1995. Effects of increased solar radiation on terrestrial plants. Ambio 24, 166173.
Chen J-J, Mitchell D, Britt AB. 1994. A light-dependent pathway for the elimination of UV-induced pyrimidine (6-4) pyrimidinone photoproducts in Arabidopsis thaliana. The Plant Cell 6, 13111317.[Abstract]
Ecker APM, Kooiman P, Hessels JKC, Yasui A. 1990. DNA photoreactivating enzyme from the cyanobacterium Anacystis nidulans. Journal of Biological Chemistry 265, 80098015.
Featherstone C, Jackson SP. 1999. DNA double-strand break repair. Current Biology 9, R759761.[ISI][Medline]
Hada M, Hashimoto T, Shin M. 1998. UV-B-induced DNA damage and its photorepair in nuclei and chloroplasts of Spinacia oleracea L. Photochemistry and Photobiology 68, 319322.
Hidema J, Kumagai T, Sutherland BM. 1997. UV-radiation-sensitive norin 1 rice contains defective cyclobutane pyrin dimer photolyase. The Plant Cell 12, 156978.
Jansen MAK, Gaba V, Greenberg BM. 1998. Higher plants and UV-B radiation: balancing damage, repair and acclimation. Trends in Plant Science 4, 2024.
Johnson JL, Hammalvarez S, Payne G, Sancar GB, Rajagopalan KV, Sancar A. 1988. Identification of the second chromophore of Escherichia coli and yeast DNA photolyases as 5,10-methenyltetrahydrofolate. Proceedings of the National Academy of Sciences, USA 85, 20462050.
Kim ST, Malhotra K, Ryo H, Sancar A, Todo T. 1996. Purification and characterization of Drosophila melanogasta photolyase. Mutation Research 363, 97104.[ISI][Medline]
Kleiner O, Butenandt L, Carell T, Batschauer A. 1999. Class II photolyase from Arabidopsis thaliana contains FAD as a cofactor. European Journal of Biochemistry 264, 161167.[ISI][Medline]
Madronich S, McKenzie RL, Bjorn LO, Caldwell MM. 1998. Changes in biologically active ultraviolet radiation reaching the Earth's surface. Photochemistry and Photobiology 46, 519.
Nakajima S, Sugiyama M, Iwai S, Hitomi K, Otoshi E, Kim ST, Jiang CZ, Todo T, Britt AB, Yamamoto K. 1998. Cloning and characterization of a gene (UVR3) required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. Nucleic Acids Research 26, 638644.
O'Conner KA McBride MJ, West M, Yu H, Trinh L, Yuan K, Lee T, Zusman DR. 1996. Photolyase of Myxococcus xanthus, a Gram-negative eubacterium, is more similar to photolyases found in Archaea and higher eukaryotes than to photolyases of other eubacterium. Journal of Biological Chemistry 271, 62526359.
Ozer Z, Reardon JT, Hsu DS, Malhotra K, Sancar A. 1995. The other function of DNA photolyase: stimulation of excision repair of chemical damage to DNA. Biochemistry 34, 1586615889.
Pang Q, Hays JB. 1991. UV-B-inducible and temperature-sensitive photoreactivation of cyclobutane pyrimidine dimers in Arabidopsis thaliana. Plant Physiology 95, 536543.
Rozema J, van der Staaij J, Bjorn LO, Caldwell MM. 1997. UV-B as an environmental factor in plant life: stress and regulation. Trends in Ecology and Evolution 12, 2228.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Press.
Sancar A. 1994. Structure and function of DNA photolyases. Biochemistry 33, 29.[Medline]
Sancar A. 1996. No end of history for photolyases. Science 272, 4849.[ISI][Medline]
Small GD. 1987. Repair systems for nuclear and chloroplast DNA in Chlamydomonas reinhardtii. Mutation Research 181, 3135.
Takao M, Oikawa A, Eker APM, Yasui A. 1989. Expression of an Anacystis nidulans photolyase gene in Escherichia coli, functional complementation and modified action spectrum of photoreactivation. Photochemistry and Photobiology 50, 633637.[ISI][Medline]
Takeuchi Y, Murakami M, Nakajima N, Kondo N, Nikaido O. 1996. Induction and repair of damage to DNA in cucumber cotyledons irradiated with UV-B. Plant and Cell Physiology 37, 181187.
Taylor RM, Hamer MJ, Rosamond J, Bray CM. 1998. Molecular cloning and functional analysis of the Arabidopsis thaliana DNA ligase 1 homologue. The Plant Journal 14, 7581.[Medline]
Taylor RM, Nikaido O, Jordan J, Rosamund J, Bray CM, Tobin AK. 1996b. UV-B-induced DNA lesions and their removal in wheat (Triticum aestivum L.) leaves. Plant, Cell and Environment 19, 171181.[Medline]
Taylor R, Tobin AK, Bray CM. 1996a. Nucleotide sequence of an Arabidopsis thaliana cDNA at-phrII (accession no. X99301 [GenBank] ) encoding a protein with high homology to the class II CPD photolyases present in higher eukaryotes. Plant Physiology 112, 862.
Thoma F. 1999. Light and dark in chromatin repair: repair of UV-induced DNA lesions by photolyase and nucleotide excision repair. EMBO Journal 18, 65856598.[ISI][Medline]
Todo T, Takemori H, Ryo M, Yamamoto K, Toh H, Inui T, Ayaki H, Nomura T, Ikenaga M. 1996. Similarity among the Drosophila (6-4) photolyase, a human photolyase homolog and the DNA photolyase-blue light receptor family. Science 272, 109112.[Abstract]
Todo T, Kim ST, Hitomi K, Otoshi E, Inui T, Morioka H, Kobayashi H, Ohtsuka E, Toh H, Ikenaga M. 1997. Flavin adenine dinucleotide as a chromophore of the Xenopus (6-4)photolyase. Nucleic Acids Research 25, 764768.
Trosko JE, Mansour VH. 1968. Response of tobacco and Haplopappus cells to ultraviolet radiation after posttreatment with photoreactivating light. Mutation Research 6, 333343.
Trosko JE, Mansour VH. 1969. Photoreactivation of ultraviolet light-induced pyrimidine dimers in Ginkgo cells grown in vitro. Mutation Research 7, 120121.[ISI][Medline]
Vornarx EJ, Mitchell HL, Karhikeyan R, Chatterjee I, Kunz BA. 1998. DNA repair in higher plants. Mutation Research 400, 187200.[ISI][Medline]
Yashuhira S, Yasui A. 1992. Visible light-inducible photolyase gene from the goldfish Carassius auratus. Journal of Biological Chemistry 267, 2564425647.
Yasui KA, Eker APM, Yasuhira S, Yajima H, Kobayashi T, Takao M, Oikawa A. 1994. A new class of DNA photolyases present in various organisms including aplacental mammals. EMBO Journal 13, 61436151.[ISI][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
P. Casati, M. Campi, F. Chu, N. Suzuki, D. Maltby, S. Guan, A. L. Burlingame, and V. Walbot Histone Acetylation and Chromatin Remodeling Are Required for UV-B-Dependent Transcriptional Activation of Regulated Genes in Maize PLANT CELL, April 1, 2008; 20(4): 827 - 842. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Teranishi, K. Nakamura, H. Morioka, K. Yamamoto, and J. Hidema The Native Cyclobutane Pyrimidine Dimer Photolyase of Rice Is Phosphorylated Plant Physiology, April 1, 2008; 146(4): 1941 - 1951. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Baliga, S. J. Bjork, R. Bonneau, M. Pan, C. Iloanusi, M. C.H. Kottemann, L. Hood, and J. DiRuggiero Systems Level Insights Into the Stress Response to UV Radiation in the Halophilic Archaeon Halobacterium NRC-1 Genome Res., June 1, 2004; 14(6): 1025 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ulm, A. Baumann, A. Oravecz, Z. Mate, E. Adam, E. J. Oakeley, E. Schafer, and F. Nagy Genome-wide analysis of gene expression reveals function of the bZIP transcription factor HY5 in the UV-B response of Arabidopsis PNAS, February 3, 2004; 101(5): 1397 - 1402. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Frohnmeyer and D. Staiger Ultraviolet-B Radiation-Mediated Responses in Plants. Balancing Damage and Protection Plant Physiology, December 1, 2003; 133(4): 1420 - 1428. [Full Text] |
||||
| |||||||||||||||||||||





, 24 h;
, 48 h;
, 72 h) before exposure to photoreactivating white light. The removal of DNA damage (A: CPDs; B: 6-4PPs) was followed over the subsequent 24 h. Points represent an average of at least two independent experimental. Error bars are 1 SD.



