Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Samis, K.
Right arrow Articles by McKersie, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samis, K.
Right arrow Articles by McKersie, B.
Agricola
Right arrow Articles by Samis, K.
Right arrow Articles by McKersie, B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of Experimental Botany, Vol. 53, No. 372, pp. 1343-1350, May 15, 2002
© 2002 Oxford University Press


Original Papers

Pyramiding Mn-superoxide dismutase transgenes to improve persistence and biomass production in alfalfa

Karen Samis1, Stephen Bowley1,3 and Bryan McKersie2

1 Biotechnology Division, Department of Plant Agriculture, University of Guelph, Guelph, Ontario, Canada N1G 2W1
2 BASF Plant Science, Research Triangle Park, North Carolina, NC 27709-3528, USA

Received 10 July 2001; Accepted 29 October 2001


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Expression of individual superoxide dismutase (SOD) transgenes improves environmental stress tolerance and biomass production in alfalfa (Medicago sativa L.). The objective of this study was to test the hypothesis that synergy exists between transgenic SOD stress-tolerance mechanisms, specifically that the simultaneous expression of two SOD transgenes confers greater benefit than the expression of a single SOD transgene. The hypothesis was tested through an evaluation of an F1 family generated through a sexual cross of a hemizygous Mit-MnSOD plant and a hemizygous Chl-MnSOD-transgenic alfalfa plant which had previously been screened in field trials for improved persistence. Southern analyses revealed that the parents each had single insertion regions of the MnSOD cDNA and the inheritance followed the expected Mendelian ratios. Native PAGE gels and enzyme inhibition assays revealed the activity of the transgenic MnSOD isozymes. F1 progeny containing either the Mit-MnSOD or the Chl-MnSOD transgene had significantly higher storage organ (crown+root) biomass compared to non-transgenic siblings. The joint expression of the transgenes resulted in a numerical increase in total SOD activity. However, F1 progeny containing both transgenes had lower shoot and storage organ biomass compared to siblings having only one or the other transgene, a result that did not support the authors' hypothesis. It was postulated that a promoter with lower expression than 35S may be necessary if closely related transgenes are to be pyramided in the same plant.

Key words: Alfalfa, biomass, persistence, SOD, stress tolerance.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Winter hardiness and persistence of perennial plants is a complex trait involving tolerances to freezing, desiccation, excess water, ice-encasement, and disease. The combination and severity of these stresses varies from year to year. Production practices for perennial crops are designed to avoid winter injury. For instance, the best management practices for alfalfa (Medicago sativa L.) include timing harvests before critical fall harvest dates, leaving shoot growth to trap insulating snow, and modifying field contours to improve surface drainage.

A genetic solution to improving winter hardiness is desired since crop production practices have limits on their ability to ensure winter survival. Although genetic variability for persistence exists in plant species, much of this variability has already been incorporated into high-yielding cultivars. In order to generate genetic variability for additional improvement, a genetic engineering approach has been used to improve winter hardiness. Alfalfa was chosen as our model because it is a perennial crop whose productivity in Ontario is limited by its persistence and the species has a well-defined tissue culture system allowing it to be easily transformed.

It was decided to focus on the collective stresses that cause winter injury, rather than on individual aspects of stress such as freezing, anoxia, or desiccation. Although these are distinctly different environmental stresses, they share a common feature in that they each promote the production of reactive oxygen species (Hetherington et al., 1987Go, 1988Go; McKersie et al., 1997Go; Pukacki et al., 1991Go; Schubert, 1994Go; Senaratna et al., 1984Go). The prediction was that if it were possible to enhance the plant's tolerance to oxidative stress, then its ability to tolerate a combination of environmental stresses associated with winter would be improved.

Attempts to modify oxidative stress tolerance have involved the manipulation of enzymes associated with the Halliwell–Asada pathway (Foyer and Halliwell, 1976Go; Foyer et al., 1994Go), including superoxide dismutase (SOD, EC 1.15.1.1), ascorbate peroxidase (APX, EC 1.11.1.1), and glutathione reductase (GR, EC 1.6.4.2). The greater part of this work has focused on the antioxidant SOD, a nuclear encoded metalloprotein which catalyses the dismutation of two superoxide molecules to hydrogen peroxide and oxygen. The metal co-factor, subcellular distribution, and sensitivity to H2O2 and KCN distinguish the three known isoforms of the enzyme: Cu/ZnSOD, FeSOD and MnSOD. Cu/ZnSOD activity is inhibited by both H2O2 and KCN, FeSOD activity is inhibited by H2O2, and MnSOD is resistant to both inhibitors (Bowler et al., 1994Go).

A number of cDNA gene constructs have been introduced into alfalfa to alter SOD expression, including MnSOD, FeSOD, and Cu/ZnSOD. Evaluation of T0 and T1 transgenic plants revealed a wide range of oxidative stress tolerances. Detailed analyses identified transgenic plants which displayed altered levels of SOD activity, enhanced freezing stress tolerance, enhanced drought tolerance, and improved biomass production and persistence in field trials (McKersie et al., 1996Go, 1997Go, 1999Go, 2000Go). Additional analyses indicated that the transgenic plants had larger shoot, crown and root systems compared to the non-transgenic controls. The general conclusion of these experiments was that the expression of an additional SOD isozyme was related to improved stress tolerance and plant vigour. Such expression increased the size of the root and crown systems which resulted in a larger available quantity of carbohydrate and protein reserves and improved persistence (McKersie et al., 1999Go, 2000Go).

The experiments to date have demonstrated that expression of single SOD enzymes confered improved tolerance to a range of stresses. However, there was the question of whether the expression of one particular SOD isozyme maximized the potential of stress response pathways. The objective of this study was to test the hypothesis that the simultaneous expression of two transgenic SOD isozymes would additively or synergistically confer greater stress tolerance and biomass production than the expression of only one. The hypothesis was tested through an evaluation of an F1 family generated through sexual crosses between a Mit-MnSOD plant and a Chl-MnSOD transgenic plant that had previously been screened in field trials for improved persistence. The F1 family was evaluated for transgene segregation ratios, the levels of transgenic enzyme activity, and the effect of combined transgene SOD activity on plant biomass yield.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Plant material
Two primary (T0) hemizygous genotypes of alfalfa were chosen as the highest performing genotypes from among a series of independent transformations with one of two CaMV35S-superoxide dismutase constructs; namely, pMitSOD and pChlSOD (McKersie et al., 1999Go). Gene constructs and transformation procedures were previously described (Bowler et al., 1991Go; D'Halluin et al., 1990Go; McKersie et al., 1999Go). One of these individuals, N4-Mit-MnSOD, originated from transformations of the embryogenic plant N4-4-2 with pMitSOD and the other, S4-Chl-MnSOD, originated from transformations of the embryogenic plant S4-23-2 with pChlSOD. Both constructs contained the nptII gene as a selectable marker. The Mit-MnSOD construct consisted of a Nicotiana MnSOD with a mitochondrial transit peptide, the Chl-MnSOD was identical except for a transit peptide substitution with the chloroplast transit peptide of the Rubisco small subunit from Pisum sativum. The embryogenic plants used for transformation were selections from the University of Guelph alfalfa breeding populations. F1 progeny segregating for parental transgenes were generated by sexual hybridization between T0 plants using suction emasculation and hand pollination. Seeds of reciprocal crosses were kept separate.

Classification of F1 progeny
There were four possible transgenic genotype classes within each family: genotypes having inherited transgenes from both parents, genotypes having a transgene from the maternal parent, genotypes having a transgene from the paternal parent, and genotypes not inheriting either transgene. Segregating progeny were classified using PCR primers specific to the 35S-MnSOD transgene (5' to 3' CTCCAGTGCTCCATAGTC and ACACTCTCGTCTACTCCAAG) and the nptII transgene (5' to 3' CCGGCTACCTGCCCATTC and GCGATAGAAGGCGATGCG). The expected PCR product size was 600 bp with Mit-MnSOD, 700 bp with Chl-MnSOD, and 392 bp with nptII.

Leaf tissue was homogenized in 400–500 µl buffer (0.2 M Tris-HCl pH 7.4, 0.25 M NaCl, 25 mM EDTA pH 8.0, 0.5% SDS) using either electrically powered homogenizing pestles (Camframo, Wiarton, Ontario) or a Fast PrepTM FP120 instrument (Savant Instruments, Inc., Holbrook, NY) at 4 m s-1 for 20 s. The homogenate was cooled on ice then centrifuged for 10 min. DNA was precipitated from 300 µl with 2 vols of 100% ethanol, incubation at room temperature for a minimum of 2 min, followed by centrifugation at 13000 g for 5 min. DNA pellets were air-dried and genomic DNA resuspended in 100 µl sterile dH20 (pH 7.5–8.0).

PCR reaction cocktails consisted of 1xPCR buffer with 1.5 mM Mg2+, 0.5 mM dNTP mix, 10 pmol of each primer, 0.5 U Taq polymerase (Roche Diagnostics, Laval, Québec), and either 20–80 ng genomic template or 50 pg plasmid template in a 25 µl reaction. Amplification was performed using either a Perkin Elmer GeneAmp PCR System 2400 (Perkin-Elmer Corporation, Norwalk, Connecticut) or a Stratagene Robocycler 96 Temperature Cycler (Strategene Cloning Systems, La Jolla, California). For the Perken Elmer, primary denaturation was at 94 °C for 5 min, 30 cycles of denaturation (94 °C for 30 s), annealing (57 °C for 30 s), and elongation (72 °C for 1.5 min), with a final elongation at 72 °C for 5 min. For the Robocycler, primary denaturation was at 94 °C for 5 min, 30 cycles of denaturation (94 °C for 45 s), annealing (57 °C for 45 s), and elongation at 72 °C for 1.5 min, with a final elongation at 72 °C for 5 min. PCR products were analysed on 0.8% agarose gels prestained with ethidium bromide.

Southern hybridization
Genomic DNA was extracted from leaf tissue using the DNAzol ES extraction reagent (Molecular Research Center, Inc., Cincinnati, Ohio). The following modifications were applied to the manufacturer's protocol: tissue was ground for 45 s in Oak Ridge centrifuge tubes containing liquid nitrogen and spherical grinding beads, instead of with a mortar and pestle; ground tissue was transferred using a metal spatula, instead of a plastic or wooden spatula; and DNA pellets were solubilized in 100 µl TE buffer (pH 8.0).

Genomic DNA was digested at 37 °C with SacI and EcoRI (Amersham Pharmacia, Inc., Baie d'Urfé, Québec) in a 400 µl reaction mix according to the manufacturer's suggested procedure. Precipitated genomic DNA was resuspended in 18 µl TE buffer (pH 8.0) and loaded into a 1% agarose gel and electrophoresed at 20 V overnight. DNA was transferred to a positively charged membrane (Roche Diagnostics) via capillary transfer.

Probes were prepared from plasmid templates using the PCR DIG probe synthesis kit (Roche Diagnostics, Laval, Québec). Amplification parameters were the same as used for PCR cycling except that in the last 20 cycles the elongation step was increased by two seconds each cycle starting from the original 1.5 min.

Denatured and labelled probes were diluted 1:10000 in prewarmed DIG Easy Hyb solution (Roche Diagnostics, Laval, Québec). Hybridizations were carried out overnight in hybridization bags and washing, detection, and stripping stages were conducted following the recommended protocol for the DIG system. CSPD was used as the chemiluminescent substrate. Blots were exposed to X-OMAT Kodak film at room temperature for a minimum of 45 min after 30 min incubation in the dark at 37 °C.

Segregation analyses
Statistical analysis was performed using the Statistical Analysis System (SAS) for Windows, version 6.12 (SAS Institute, Cary, NC). Yates corrected chi-square ({chi}2) test was applied to test the goodness-of-fit to the expected segregation of transgenes within families using a Type I probability level of 5%. The expected segregation patterns for progeny of a hemizygous parent is 1:1 for single insertion events. Progeny of a cross of two hemizygous plants with single insertion events was expected to segregate 1:1:1:1 for maternal transgene, both transgenes, paternal transgene, and no transgene, respectively.

Enzyme assays
Two F1 genotypes were randomly selected from each segregation class. Leaf tissue from fully opened leaves on 5–10 node, non-flowering stems was ground with liquid nitrogen using a vortex and spherical grinding beads for 45 s. Approximately 0.5 g frozen powdered tissue was quickly transferred to 1.0 ml cold protein extraction buffer (50 mM KH2PO4, pH 7.8) and kept on ice. Homogenates were centrifuged at 13600 g for 5 min at 4 °C and the resulting supernatant transferred and centrifuged again at 13600 g for 15 min. Protein content was measured at 595 nm using the Coomassie Plus Protein Assay reagent (Pierce, Rockford, Illinois) and concentrations calculated relative to BSA standards. Native PAGE assays were conducted following the protocols described earlier (McKersie et al., 2000Go).

A series of inhibition assays were used to confirm the classification of each isozyme band. After electrophoresis, paired gels were divided, one was a control and the other was incubated in an inhibition solution (0.09% H2O2 to inhibit both Cu/ZnSOD and FeSOD, or 50 mM NaCN to inhibit Cu/ZnSOD) for 30 min at 4 °C on a shaker. Gels were rinsed in dH2O and incubated for 30 min in staining solution.

Stained gels were scanned and analysed using Quantity One, The Discovery Series, version 4.0.1 (Bio-Rad Laboratories, Hercules, CA). Isozyme activity levels were expressed in units of SOD activity mg-1 of protein relative to the internal SOD standard from bovine erythrocytes (Sigma, EC 1.15.1.1).

Enzyme activity was analysed using the SAS Proc Glm procedure on a natural log scale and back transformed units of activity mg-1 protein are reported. Within each F1 family, pairwise contrasts of transformed data were performed between F1 classes with and without the SOD transgenes, and between the single SOD transgene and double transgene classes using a Type 1 probability level of 5%.

Field evaluation
Cuttings from young stems were used to propagate all F1 progeny vegetatively. Propagules were initiated in the greenhouse in 2x2x14 cm six cell Root-trainers (Spencer-Lemaire Industries, Edmonton, Alberta) filled with Turface (Plant Products, Mississauga, Ontario). The field trial was arranged as a split plot with four replications. Whole plots were represented by segregation classes within a family and subplots were represented by individual F1 genotypes. The four segregation classes were randomly allocated to each whole plot. Whole plots were spaced 15 cm apart and consisted of five subplots arranged in parallel rows spaced 20 cm apart. Each subplot, or experimental unit, was 45 cm long and contained six propagules of an F1 genotype spaced 7.5 cm apart.

Two field locations were used for this experiment: Elora Research Station (ERS) and New Liskeard Research Station (NLRS). ERS, R.R. No. 2, Ariss, Ontario, is located at 43°38.75' North Latitude and 80°24.5' West Longitude and has a clay brunisolic gray brown Luvisol-London (Guelph loam) soil type. NLRS, Highway 11B North, New Liskeard, Ontario, is located at 47°31' North Latitude and 79°40' West Longitude and has a lacustrine light brown grey (New Liskeard clay loam) soil type. Rooted cuttings were transplanted into the spaced planting arrangement at ERS on 21 May 1999 and at NLRS on 1 June 1999. These trials were conducted under a Canadian Food Inspection Agency confined field test permits (99-UOG1-075-ALF01-177, -236).

Plants were clipped at ERS station in mid-July 1999. Plants were excavated at NLRS on 15–16 September 1999 and ERS on 22–23 September 1999. Harvested plants from both locations were stored in plastic bags at -20 °C until processing. Each plant was washed to remove residual soil and then divided into three sections: root to a 15 cm depth, crown, and shoot. The root/crown boundary was defined as immediately below the lowest terminal bud node (approximately at ground level) and the crown/shoot boundary was defined as 5 cm above the root/crown boundary. All sections from the individual propagules within each subplot were counted, bulked, dried at 70 °C for 48 h, and the mean weight per plant recorded (g DM plant-1).

An across location analysis was conducted for shoot and storage organ (crown+root) biomass. Statistical analyses were performed using the SAS Proc Mixed procedure. Blocks within locations and individual genotypes within class effects were classified as random effects, all other effects were assumed fixed. Hypotheses were tested using a Type I probability level of 5%. Pairwise contrasts were performed to detect the effects of individual and combined transgenes on plant biomass.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Southern hybridization analyses to determine copy number indicated that N4-Mit-MnSOD had one insertion of the pMitSOD T-DNA and S4-Chl-MnSOD had one insertion of the pChlSOD T-DNA (Fig. 1Go). The number of insertion events in each parent also equalled the copy number since all of the hybridization fragment sizes were greater than the size of each complete T-DNA sequence (pMitSOD was 6200 bp, and pChlSOD was 6000 bp).



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 1.  Southern hybridization for the nptII gene of pMitSOD and pChlSOD in three primary transgenic alfalfa plants. Lane 1: molecular marker; lane 2: pChlSOD; lane 3: S4-Chl-MnSOD (one insertion); lane 4: pMitSOD; lane 5: N4-Mit-MnSOD (one insertion).

 
F1 progeny were divided into two classes based on positive and negative inheritance of the transgene from the parent. Segregation ratios for parent genotypes N4-Mit-MnSOD and S4-Chl-MnSOD did not deviate from the 1:1 expected ratio, which indicated that the transgenes were segregating in a simple Mendelian fashion (Table 1Go). The pairwise transgene inheritance ratios for the F1 progeny were also not significantly different (P=0.28) than expected for the segregation of independently assorting transgenes (Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1.  Goodness-of-fit tests for individual transgene segregation and for the co-segregation of transgenes in F1 families derived from two hemizygous T0 transgenic alfalfa plants, one containing a 35S-mit-MnSOD cDNA transgene, the other containing a 35S-chl-MnSOD cDNA transgene

 
SOD activity assays indicated that the protein samples from non-transgenic plants (N4-4-2) contained five resolvable SOD isozymes (Figs 2Go, 3Go) The three fastest moving isozymes were inhibited with both H2O2 and NaCN which indicated that they were Cu/ZnSOD isozymes. The intermediate isozyme was inhibited only by H2O2 indicating that this was an FeSOD isozyme. The highest molecular weight isozyme or slowest moving band was not inhibited by either H2O2 or HCN indicating that this represented a MnSOD isozyme.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 2.  Native PAGE assay of leaf extracts of alfalfa genotypes showing endogenous and transgenic SOD activity. Gel A was assayed without inhibitor, gel B was assayed with H2O2 to inhibit FeSOD and Cu/ZnSOD. Lane 1: non-transgenic N4-4-2 control; lane 2: N4-Mit-MnSOD; lane 3: N4-Chl-MnSOD; lane 4: S4-Chl-MnSOD.

 


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3.  Native PAGE assay of leaf extracts of alfalfa genoptypes showing endogenous and transgenic SOD activity. Gel A was assayed without inhibitor, gel B was assayed with NaCN to inhibit Cu/ZnSOD. Lane 1: non-transgenic N4-4-2 control; lane 2: N4-Mit-MnSOD; lane 3: N4-Chl-MnSOD; lane 4: S4-Chl-MnSOD.

 
Genotype N4-Mit-MnSOD expressed an additional MnSOD isozyme of slightly lower molecular weight than the endogenous MnSOD isozyme, but was not resolvable from the endogenous isozyme. S4-Chl-MnSOD expressed a unique MnSOD isozyme that was distinguishable from the endogenous and the mitochondrial SOD transgenic isozyme. These additional isozyme bands were not inhibited by either H2O2 or NaCN confirming that they were MnSOD isozymes (Figs 2,Go 3Go).

The SOD isozyme banding patterns of the randomly selected F1 genotypes were similar to those observed previously and no additional or unique bands were observed. Plants containing both the mit-MnSOD and chl-MnSOD transgenes corresponded to a blended pattern based on the single transgene class (Fig. 4Go). The FeSOD isozyme bands were generally faint and often displayed minimal to no detectable levels of expression. Consequently, comparative analyses were only performed for the MnSOD, cyt-Cu/ZnSOD, and chl-Cu/ZnSOD.



View larger version (89K):
[in this window]
[in a new window]
 
Fig. 4.  Native PAGE assay of leaf extracts of F1 alfalfa genotypes showing endogenous and transgenic MnSOD activity. Lane 1: non-transgenic; lane 2: Mit-MnSOD; lane 3: Chl-MnSOD; lane 4: Mit-MnSOD-Chl-MnSOD.

 
There were no significant differences detected in SOD activity, either total or for any of the individual SOD types (Table 2Go). The Mit-MnSOD plants had numerically higher MnSOD activity, but no difference in Cu/ZnSOD activity compared to the non-transgenic plants. The Chl-MnSOD plants did not differ in MnSOD activity, but had numerically lower Cu/ZnSOD activity compared to non-transgenic plants. The plants containing both the Mit-MnSOD and Chl-MnSOD transgenes had numerically higher Cu/ZnSOD activity which was also reflected in a numerically higher total SOD activity.


View this table:
[in this window]
[in a new window]
 
Table 2.  SOD isozyme activity, average shoot and storage organ (crown+root) biomass (g DM plant-1), and significance of mean contrasts for F1 alfalfa genotypes generated from cross-pollination of two hemizygous transgenic plants, N4-Mit-MnSOD and S4-Chl-MnSOD

Biomass was measured at two locations, Elora and New Liskeard in 1999.

 
Plants with either the Mit-MnSOD or the Chl-MnSOD transgene had higher shoot and storage organ biomass compared to their non-transgenic siblings. Plants which contained both the Mit-MnSOD and Chl-MnSOD transgene did not differ in biomass compared to members of the non-transgenic class. Plants containing both transgenes were significantly lower in biomass production compared to plants which had only one of the two transgenes.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The primary transgenic plants selected for this study each had a single site of insertion of the mit-MnSOD and chl-MnSOD transgenes. Segregation patterns of the two transgenes followed the expected Mendelian segregation patterns. This result is also consistent with other transgene test crosses performed by this research group. Although this study is not the first analysis of transgenic plants overexpressing two transgenes associated with stress tolerance, it is the first report of the sexual hybridization of alfalfa genotypes having unlinked transgene insertion events involving different enzymes associated with stress tolerance.

Leaf extracts from non-transgenic plants contained five SOD isozyme bands: a slow moving Mn-SOD, an Fe-SOD, and three Cu/Zn-SOD isozymes. Inhibition studies using H2O2, to inhibit Fe- and Cu/Zn-SOD, and HCN, to inhibit Cu/Zn-SOD confirmed the classification of the SOD isozyme type. Previous studies had revealed that the slower moving Cu/Zn-SOD was a cytosolic form and the two faster moving were chloroplastic forms (McKersie et al., 1993Go).

Plants containing the mit-MnSOD cDNA expressed an additional MnSOD isozyme of slightly lower molecular weight, but not resolvable from the endogenous MnSOD isozyme. Genotypes containing chl-MnSOD expressed a unique, slightly faster moving MnSOD isozyme. These results agreed with those obtained from previously characterized transgenic alfalfa genotypes transformed with the same transgenes (McKersie et al., 1999Go; Murnaghan, 1999Go). The SOD isozyme banding pattern in the F1 progeny was consistent with a blended phenotype expected based on the two parents. Plants having both mit-MnSOD and chl-MnSOD had a wide MnSOD isozyme band that extended over the region expected for the native and transgenic isozyme bands.

Since the MnSOD transgenes had sequence homology and were controlled by a strong constitutive promoter (35S), genotypes having both transgenes were possible candidates for sequence homology gene silencing. Promoter homology could lead to transcriptional silencing and sequence homology could lead to post-transcriptional silencing (Matzke and Matzke, 1998Go). Within the genotypes sampled, transgene silencing did not appear to be operative since there was no apparent loss in transgene expression when the two transgenes were together in the same genome.

The effects of the individual transgenes on SOD activity corresponded to previous studies (McKersie et al., 1999Go). As a proportion of total SOD activity, the relative expression of MnSOD was higher (23.7% mit-MnSOD, 17.5% chl-MnSOD) compared the non-transgenic group (16.7%). The expression of the chl-MnSOD also led to a numerical reduction in cytosolic and chloroplastic Cu/ZnSOD activity. The joint expression of the transgenes resulted in a reduction in MnSOD as a percentage of total activity (13%) and higher Cu/ZnSOD activity. This reduction was not a result of transgene silencing, but probably a reduction in expression of the native MnSOD genes or reduction in activity of their gene product.

Yield enhancement due to expression of antioxidant genes was predicted previously (Allen, 1995Go). He speculated that frequent, mild oxidative stresses occur in a field situation and that these stresses inhibit photosynthesis and, therefore, yield. Different SOD transgenes have also been expressed in transgenic plants with varying results (reviewed by Foyer et al., 1994Go; Allen, 1995Go). Some authors found no improvement (Pitcher et al., 1991Go; Tepperman and Dunsmuir, 1990Go; Payton et al., 1997Go), while others found significant improvements to oxidative stress tolerance (Bowler et al., 1991Go; Van Camp et al., 1994Go, 1996Go; Perl et al., 1993Go; McKersie et al., 1993Go, 1996Go, 1999Go, 2000Go). This disparity has usually been attributed to the complexity of the detoxification system because changing one enzyme may not change the capacity of the pathway as a whole.

In agreement with previous studies of the effect of either the mit-MnSOD or chl-MnSOD in alfalfa, the presence of a single transgene resulted in greater plant and storage organ biomass. However, when two elite selected T0 plants were hybridized, progeny containing both transgenes had lower shoot and storage organ biomass compared to siblings having only one or the other transgene. This result was unexpected and did not support the hypothesis that the simultaneous expression of two SOD isozymes would confer greater performance than the expression of only one.

The alteration of SOD activity has a number of other possible physiological effects since the product of the SOD reaction is hydrogen peroxide. H2O2 has potential toxicity in plants, but it also has a number of regulatory roles. H2O2 is required for successful cell division, perhaps because of its function in cross-linking cell walls (de Marco and Roubalakis-Angelakis, 1996Go). It also produces a transient Ca2+ surge, which is a known signalling component (Price et al., 1994Go). H2O2 also may play a role in the increased activity of antioxidant enzymes during acclimation (Prasad et al., 1994Go). Overexpressing SOD led to increases in ascorbate peroxidase specific activity in Nicotiana (Gupta et al., 1993Go) and Gossypium (Payton et al., 1997Go). By contrast, analyses of the chl-MnSOD and mit-MnSOD T0 transgenic alfalfa indicated that there was no difference in the activity of ascorbate peroxidase (Murnaghan, 1999Go).

It is possible that by combining these two SOD transgenes the stress tolerance or H2O2 signalling pathway may have been altered too drastically for optimal growth and development. Earlier evaluations of independent transgenic plants revealed that transgenic plants with very high levels of SOD expression were not as productive as those with a lower level of SOD expression. For instance, an analysis of two mit-MnSOD transgenic plants, RA3-Mit-MnSOD-5 and RA3-Mit-MnSOD-38 indicated that T0 plant 5 had the higher level of total SOD activity, but T0 plant 38 had the higher herbage yield and persistence in a 3 year field trial (McKersie et al., 1996Go). Similarly, an evaluation of four independent Fe-SOD transgenic plants revealed that the most productive and persistent individuals were those having intermediate levels of total SOD activity (Fig. 5Go, derived from Murnaghan, 1999Go).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5.  Relationship between herbage yield and total SOD activity of FeSOD transgenic alfalfa plants. Herbage yield was measured over two years at Elora, Ontario (adapted from Murnaghan, 1999Go); se yield=3.0, se activity=0.15.

 
It is probable that the combination of the two MnSOD transgenes resulted in too high an expression which cancelled the benefit derived from the single expression of either of the transgenes. Since the transgene products affect a critical pathway associated with stress tolerance, maintenance of redox potential, and cell signalling; a high level of activity of an introduced transgene may cause too much disruption and lead to a negative overall effect. In retrospect, perhaps a tissue specific or a less strongly expressed promoter than 35S should have been used in order to alter the expression of SOD. Reduced expression of the individual transgenes may have avoided the loss in phenotypic performance when combined in the same plant. This change of gene regulation should be considered in order to pyramid transgenes which affect a metabolic pathway. A strong constitutive promoter may not be a problem, however, if the transgenes affect different pathways. Evaluation of segregating families involving the co-segregation of MnSOD with transgenes affecting other metabolic pathways are now in progress to investigate this relationship.


    Notes
 
3 To whom correspondence should be addressed. E-mail: sbowley{at}uoguelph.ca Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Allen RD. 1995. Dissection of oxidative stress tolerance using transgenic plants. Plant Physiology 107, 1049–1054.[ISI][Medline]

Bowler C, Slooten L, Vandenbranden S, de Rycke R, Botterman J, Sybesma C, Van Montagu M, Inzé D. 1991. Manganese superoxide dismutase can reduce cellular damage mediated by oxygen radicals in transgenic plants. EMBO Journal 10, 1723–1732.[ISI][Medline]

Bowler C, Van Camp W, Van Montagu M, Inzé D. 1994. Superoxide dismutase in plants. Critical Reviews in Plant Science 13, 199–218.

De Marco A, Roubelakis-Angelakis KA. 1996. The complexity of enzymic control of hydrogen peroxide concentration may affect the regeneration potential of plant protoplasts. Plant Physiology 110, 137–145.[Abstract]

D'Halluin K, Botterman J, De Greef W. 1990. Engineering of herbicide-resistant alfalfa and evaluation under field conditions. Crop Science 30, 866–871.[Abstract/Free Full Text]

Foyer CH, Halliwell B. 1976. The presence of glutathione and glutathione reductase in chloroplasts: a proposed role in ascorbic acid metabolism. Planta 133, 21–25.[ISI]

Foyer CH, Descourvieres P, Kunert KJ. 1994. Protection against oxygen radicals: an important defense mechanism studied in transgenic plants. Plant, Cell and Environment 17, 507–523.

Gupta AS, Webb RP, Holaday AS, Allen RD. 1993. Overexpression of superoxide dismutase protects plants from oxidative stress. Induction of ascorbate peroxidase in superoxide dismutase-overexpressing plants. Plant Physiology 103, 1067–1073.[Abstract]

Hetherington PR, Broughton HL, McKersie BD. 1987. Ice encasement injury to microsomal membranes from winter wheat crowns. I. Comparison of membrane properties after lethal ice-encasement and during a post-thaw period. Plant Physiology 85, 1068–1072.[Abstract/Free Full Text]

Hetherington PR, Broughton HL, McKersie BD. 1988. Ice encasement injury to microsomal membranes from winter wheat crowns. II. Changes in membrane lipids during ice-encasement. Plant Physiology 86, 740–743.[Abstract/Free Full Text]

Matzke AJM, Matzke MA. 1998. Position effects and epigenetic silencing of plant transgenes. Current Opinions in Plant Biology 1, 142–148.[ISI][Medline]

McKersie BD, Bowley SR, Harjanto E, Leprince O. 1996. Water-deficit tolerance and field performance of transgenic alfalfa overexpressing superoxide dismutase. Plant Physiology 111, 1177–1181.[Abstract]

McKersie BD, Bowley SR, Jones KS. 1999. Winter survival of transgenic alfalfa overexpressing superoxide dismutase. Plant Physiology 119, 839–847.[Abstract/Free Full Text]

McKersie BD, Chen Y, de Beus M, Bowley SR, Bowler D, Inzé D, D'Halliun K, Botterman J. 1993. Superoxide dismutase enhances tolerance of freezing stress in transgenic alfalfa (Medicago sativa L.). Plant Physiology 103, 1155–1163.[Abstract]

McKersie BD, Murnaghan J, Bowley SR. 1997. Manipulating freezing tolerance in transgenic plants. Acta Physiologiae Plantarum 19, 485–495.

McKersie BD, Murnaghan J, Jones KS, Bowley SR. 2000. Iron-superoxide dismutase expression in transgenic alfalfa increases winter survival without a detectable increase in photosynthetic oxidative stress tolerance. Plant Physiology 122, 1427–1437.[Abstract/Free Full Text]

Murnaghan JMW. 1999. Winter survival in transgenic alfalfa (Medicago sativa L.) expressing superoxide dismutase. MSc thesis, University of Guelph.

Payton P, Allen RD, Trolinder N, Holaday AS. 1997. Overexpression of chloroplast-targeted Mn superoxide dismutase in cotton (Gossypium hirsutum L., cv. Coker 312) does not alter the reduction of photosynthesis after short exposures to low temperature and high light intensity. Photosynthetic Research 52, 233–244.

Perl A, Perl Treves R, Galili S, Aviv D, Shalgi E, Malkin S, Galun E. 1993. Enhanced oxidative-stress defense in transgenic potato expressing tomato Cu, Zn superoxide dismutases. Theoretical and Applied Genetics 85, 568–576.

Pitcher LH, Brennan E, Hurley A, Dunsmuir P, Tepperman JM, Zilinskas BA. 1991. Overproduction of petunia chloroplastic copper/zinc superoxide dismutase does not confer ozone tolerance in transgenic tobacco. Plant Physiology 97, 452–455.[Abstract/Free Full Text]

Prasad TK, Anderson MD, Martin BA, Stewart CR. 1994. Evidence for chilling-induced oxidative stress in maize seedliongs and a regulatory role for hydrogen peroxide. The Plant Cell 6, 65–74.[Abstract]

Price AH, Taylor A, Ripley SJ, Griffiths A, Trewavas AJ, Knight MR. 1994. Oxidative signals in tobacco increase cytosolic calcium. The Plant Cell 6, 1301–1310.[Abstract]

Pukacki PM, Kendall EJ, McKersie BD. 1991. Membrane injury during freezing stress to winter wheat Triticum aestivum L. crowns. Journal of Plant Physiology 138, 516–521.

Schubert BK. 1994. Glutathione, glutathione reductase and freezing stress in alfalfa Medicago sativa L. MSc thesis, University of Guelph.

Senaratna T, McKersie BD, Borochov A. 1984. Association between membrane phase properties and dehydration injury in soybean axes. Plant Physiology 76, 759–762.[Abstract/Free Full Text]

Tepperman JM, Dunsmuir P. 1990. Transformed plants with elevated levels of chloroplastic SOD are not more resistant to superoxide toxicity. Plant Molecular Biology 14, 501–511.[ISI][Medline]

Van Camp W, Capiau K, Van Montagu M, Inzé M, Slooten L. 1996. Enhancement of oxidative stress tolerance in transgenic tobacco plants overproducing Fe-superoxide dismutase in chloroplasts. Plant Physiology 112, 1703–1714.[Abstract]

Van Camp W, Willekens H, Bowler C, Van Montagu M, Inzé D, Reupold-Popp P, Sandermann H, Langbarrels C. 1994. Elevated levels of superoxide dismutase protect transgenic plants against ozone damage. Biotechnology 12, 165–168.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Crop Sci.Home page
V. Chinnusamy, A. Jagendorf, and J.-K. Zhu
Understanding and Improving Salt Tolerance in Plants
Crop Sci., January 31, 2005; 45(2): 437 - 448.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
M. A. Schmidt, G. S. Martin, B. J. Artelt, and W. A. Parrott
Increased Transgene Expression by Breeding and Selection in White Clover
Crop Sci., May 1, 2004; 44(3): 963 - 967.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
R. G. Alscher, N. Erturk, and L. S. Heath
Role of superoxide dismutases (SODs) in controlling oxidative stress in plants
J. Exp. Bot., May 15, 2002; 53(372): 1331 - 1341.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Samis, K.
Right arrow Articles by McKersie, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samis, K.
Right arrow Articles by McKersie, B.
Agricola
Right arrow Articles by Samis, K.
Right arrow Articles by McKersie, B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?