Journal of Experimental Botany, Vol. 54, No. 383, pp. 739-747,
February 1, 2003
© 2003 Oxford University Press
Antisense SNF1-related (SnRK1) protein kinase gene represses transient activity of an 
-amylase (-Amy2) gene promoter in cultured wheat embryos
Received 20 May 2002; Accepted 23 October 2002
1 Crop Performance and Improvement, Long Ashton Research Station, Long Ashton, Bristol BS41 9AF, UK
2 Crop Performance and Improvement, Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK
3 To whom correspondence should be addressed. Fax: +44 (0)1582 763 010. E-mail nigel.halford{at}bbsrc.ac.uk
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
A DNA fragment corresponding to part of an SNF1 (sucrose non-fermenting-1)-related protein kinase (SnRK1) transcript was amplified by a polymerase chain reaction (PCR) from a wheat (Triticum aestivum) endosperm cDNA library. It was used to construct a chimaeric gene, pUasSnRKN, comprising a ubiquitin promoter, the SnRK1 PCR product in the antisense orientation and the nopaline synthase (Nos) gene terminator. This construct was used in transient gene expression experiments in cultured wheat embryos together with a series of reporter gene constructs. These included the wheat alpha amylase gene
-Amy2 promoter with UidA (Gus) coding region (p2GT), rice actin promoter with Gus (pActIDGus), ubiquitin promoter with Gus (pAHC25) and actin promoter with green fluorescent protein (GFP) gene (pAct1Is-GFP1). All of the reporter genes were found to be active when bombarded into scutellae isolated from immature grains at 25 d post-anthesis and incubated on MS medium for 24 h prior to bombardment. However, co-bombardment of p2GT with equimolar amounts of pUasSnRKN resulted in no detectable Gus activity, indicating that the antisense SnRK1 construct repressed the -Amy2 promoter. Co-bombardment with pUasSnRKN had no effect on the activity of the other promoters used in the study. A triple bombardment with p2GT, pAct1Is-GFP-1 and pUasSnRKN resulted in clear green fluorescence, indicating that the bombarded cells were still viable, but no Gus activity. RT-PCR analysis showed clearly that the antisense SnRK1 gene was expressing. Northern and RT-PCR analyses confirmed that SnRK1 and both -amylase genes, -Amy1 and -Amy2, are expressed in cultured wheat embryos harvested from grain 25 d post-anthesis. Expression of -Amy1 and -Amy2 was up-regulated by sugar starvation. Key words: Carbohydrate metabolism, gibberellin, phosphorylation, seed development, sugar sensing, Triticum aestivum.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
As well as being a major substrate for growth, sugars can act as signalling molecules that regulate many developmental and physiological processes in plants (for a review see Koch, 1996). Perhaps the clearest evidence for this is the fact that sugars affect the expression of many genes involved in key metabolic processes, including photosynthesis. This was demonstrated by the sugar repression of ribulose 1,5-bisphosphate carboxylase/oxygenase small subunit (rbcS), chlorophyll a/b binding protein (CAB) and ATPase delta subunit gene expression in cell suspension cultures of Chenopodium rubrum (Krapp et al., 1993). Subsequently, the expression of numerous other genes involved in photosynthetic processes have been shown to be under the control of feedback regulation by sugars (reviewed by Sheen, 1994; Pego et al., 2000; Paul et al., 2001).
Genes involved in starch synthesis and breakdown have also been shown to be sugar-modulated. ADP glucose pyrophosphorylase expression, for example, is strongly induced in response to elevated levels of sucrose, and this affects starch levels in potato (Solanum tuberosum) tubers (Muller-Rober et al., 1990; Sweetlove et al., 1999). Accumulation of certain storage proteins is also dependent on sugars, for example sporamin in sweet potato (Ipomoea batatas) (Hattori et al., 1990) and patatin in potato (Martin et al., 1997). In general, sugars up-regulate the expression of genes involved with the biosynthesis and storage of reserves, and down-regulate those associated with photosynthesis and reserve mobilization. Regulation may be at the level of transcription (Lu et al., 1998) or message stability (Chan and Yu, 1998) and the ability of tissues to respond to sugars may be enhanced by hormonal signals such as ABA (Rook et al., 2001).
One gene family that has been the focus of extensive study with respect to the regulation of gene expression is that of the -amylases. Alpha-amylases play a key role in plant metabolism, as they are responsible for starch hydrolysis and, therefore, mobilization of the major carbohydrate storage reserve in most plants. Most studies have examined the effects of hormones on -amylase gene expression. However, several have shown that sugars are involved in the regulation of cereal -amylases. In rice suspension cultures, embryos and germinating grains, for example, -amylase has been shown to be induced by sugar starvation and repressed by feeding with sucrose, fructose or glucose (Yu et al., 1991, 1996; Umemura et al., 1998). A similar result was obtained for the expression of -amylase promoter/reporter gene constructs in transgenic rice cell cultures (Huang et al., 1993). However, the effect of sugar feeding may vary for different -amylase genes (Sheu et al., 1996).
In the barley scutellum, detailed work showed that sugar repressed -amylase activity in the embryo (probably in the epithelial layer of the scutellum), but not in the aleurone (Perata et al., 1997). Repression was seen with a variety of sugars, and the effect was not osmotic as it was not observed with equi-osmolar concentrations of mannitol or sorbitol. The aleurone did not respond to sugars in the same way, since embryo-less half-grains showed no repression of -amylase activity even at concentrations of glucose up to 200 mM. The differential regulation of -amylase by sugars and hormones is suggested to allow a functional switch for the epithelium from a role in -amylase secretion early in germination to a role later on in absorption by the aleurone of sugars produced by starch degradation in the endosperm.
Wheat -amylase genes fall into three classes: -Amy1 and 2 (Lazarus et al., 1985) and -Amy3 (Baulcombe et al., 1987). -Amy1 and -Amy2 are expressed in the seed aleurone during germination and they encode high and low pI isoforms of the enzyme, respectively (Sargeant, 1980; Jacobsen and Higgins, 1982). They are not expressed in cultured de-embryonated seeds, but can be induced in such seeds by treatment with gibberellic acid (GA), indicating that their expression in whole seeds is dependent on the production of GA by the embryo (Appleford and Lenton, 1997). -Amy2 is also expressed in developing grain along with -Amy3 (Baulcombe et al., 1987; Huttly et al., 1988). A wheat -Amy2 promoter has been used to drive expression of a reporter gene, UidA (Gus), in a GA-dependent manner in oat aleurone protoplasts (Huttly and Baulcombe, 1989). However, sugar regulation of wheat -amylase gene expression has not been reported previously.
Understanding of the processes involved in sugar sensing and signalling in plants is far from complete. Nevertheless, a few proteins have been proposed to be involved and these include SNF1-related protein kinase-1 (SnRK1). As its name suggests, SnRK1 has a catalytic domain similar to that of SNF1 (Sucrose Non-fermenting-1) of yeast. SNF1 is a global regulator of carbon metabolism and is activated in response to low cellular glucose levels (reviewed by Gancedo, 1998; Dickinson, 1999). It acts through the regulation of expression of a number of genes that are repressed by glucose, and the direct modulation of the phosphorylation state of several metabolic enzymes.
Animal cells contain a closely related protein kinase, AMPK (AMP-activated protein kinase), which is activated in response to a high AMP:ATP ratio, a characteristic of animal cells under a variety of stresses, including metabolic stress (Hardie and Carling, 1997). The exact nature of the signal that brings about changes in SnRK1 gene expression or activation state is not known. However, phosphorylation and inactivation of spinach SnRK1 has been found to be inhibited by low concentrations of 5'-AMP (Sugden et al., 1999). There is also evidence that SnRK1 may be inhibited by glucose-6-phosphate (Toroser et al., 2000).
SnRK1 genomic clones, cDNAs and PCR products have now been cloned from many plant species and purified SnRK1 enzyme has been shown to phosphorylate 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase, nitrate reductase and sucrose phosphate synthase in vitro (reviewed by Halford et al., 2000; Halford and Hardie, 1998). SnRK1 is also required for normal pollen development (Zhang et al., 2001), for sucrose synthase (SuSy) gene expression in potato tubers and for sucrose induction of SuSy gene expression in excised potato leaves (Purcell et al., 1998). The aim of the present study was to investigate a role for SnRK1 in regulating the wheat -Amy2 promoter.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Plant material and embryo culture
Ears of wheat (variety Axona) were collected from the greenhouse when they had reached 15, 25 or 35 d post-anthesis (dpa) and immature seeds were separated from the ear. If RNA was to be extracted, embryos were excised and frozen immediately in liquid nitrogen. For bombardment and sugar incubation the seeds were surface-sterilized by rinsing with 70% ethanol and incubation in 1.5% (v/v) bleach (Parazone) for 20 min. They were then rinsed three or four times with sterile distilled water. Immature embryos were dissected aseptically from the grain, and placed on solid MS medium (Murashige and Skoog, 1962) supplemented with gibberellic acid (GA3) at a final concentration of 2 µM and 2% (w/v) sucrose, glucose or mannitol. The axis surface was kept in contact with the medium.
For bombardment, embryos were arranged in six groups of five on sucrose or mannitol-supplemented plates and incubated on this medium for 48 h prior to bombardment. After bombardment, the material was incubated for a further 24 h before Gus assay. For the sugar incubation experiments, embryos were excised, arranged in an even spread on the plate, and incubated at a density of 30 per plate on MS medium with either mannitol, sucrose or glucose at 2% and GA3 at a concentration of 2 µM After 48 h incubation the embryos were harvested and poly(A)+ RNA was extracted.
Cloning of a partial wheat SnRK1 sequence and construction of a chimaeric gene for expression of antisense SnRK1
Degenerate oligonucleotides ACTGGAATTCRTMAARRTYCTB AAYCGYCG and ACTGGGATCCATRTTBTCRTCRAAAWGG, corresponding to sequences that are highly conserved in SnRK1 genes (Crawford et al., 2001), were used to prime a polymerase chain reaction (PCR) using a wheat (cv. Chinese Spring) seed cDNA library (Hey et al., 2000) as template. A single PCR product comprising 596 nucleotides, including EcoRI and BamHI sites at each end, was amplified and cloned in plasmid vector pGEM-T (Promega, UK). The PCR product was then excised, the ends were filled in and it was ligated in the antisense orientation into plasmid pUPLN to make pUasSnRKN. Plasmid pUPLN had been produced by replacing the rbcS promoter in plasmid pRPLN (Massiah et al., 2001) with the maize ubiquitin promoter from pAHC25 (Christensen and Quail, 1996). pUasSnRKN therefore contained the wheat SnRK1 fragment between the maize ubiquitin promoter and the Nos terminator.
Particle bombardment
The Helios Gene Gun system (Biorad) was used for transient expression studies in the wheat embryos. A variety of different promoter–reporter constructs were used in the bombardments. These were p2GT (Huttly and Baulcombe, 1989), pActIDGus (McElroy et al., 1990), pCaIDGus (kindly provided by Chris Warren, Stanford University Ca), pAct1IsGFP-1 (kindly provided by Dr PG Lemaux), pAHC25 (Christensen and Quail, 1996) and pUasSnRK1N.
Gold bullets were prepared as described in the manufacturer’s protocol (Biorad UK), using equimolar concentrations of DNA for co-transformations and PVP at a concentration of 0.02%. A helium pressure of 200 psi was used for firing the gold and the embryos were held in place with sterile nylon mesh.
Histochemical analysis of ß-glucuronidase (Gus) activity
Embryos were incubated in Gus assay mix containing 5-bromo-4-chloro-3-indolyl-ß-D-glucuronide using the method of McCabe et al. (1988). Blue coloration developed in the tissue after incubation for 24 h at 37 °C.
Fluorescence (green fluorescent protein (GFP) activity)
Fluorescence was visualized using a fluorescence Leica stereomicroscope model MZ FLIII (Leica UK) with a GFP2 filter set (excitation range 480/40 nm, barrier filter 510 nm).
Northern analyses and RT-PCR
Total RNA was isolated from embryos using the Ambion RNAqueous small scale RNA isolation kit (Ambion, Austin, Texas, USA). When used in RT-PCR, RNA was precipitated with LiCl2 solution (Ambion, Austin, Texas, USA) and treated with RQ1 RNase-free DNase (Promega, Southampton, UK) before checking by agarose gel electrophoresis for DNA contamination. Additionally, a non-RT control was used to confirm that the product was not derived from contaminating DNA. Poly(A)+ RNA was extracted for Northern analysis as previously described (Rushton et al., 1995). It was separated on 1% MOPS-formaldehyde gels and was transferred onto Magnacharge membranes (Micron Separations Inc., Westborough, MA, USA) using standard procedures (Sambrook et al., 1989).
Probe synthesis was carried out using the Prime-It II Random Primer Labelling kit (Stratagene) to produce DNA fragments labelled with [-32P]dATP for the detection of corresponding mRNAs. Probes were purified using NucTrap Probe Purification columns (Stratagene). Hybridization conditions were 50% (v/v) formamide, 6x SSPE, 5x Denhardt’s solution, 0.2% (w/v) SDS, 100 µg ml–1 denatured herring sperm DNA, 5% (w/v) dextran sulphate at 42 °C for 16 h (Sambrook et al., 1989). Filters were washed at a range of stringencies from 2x SSC, 0.1% (w/v) SDS for 30 min at 42 °C, to 0.1x SSC, 0.1% (w/v) SDS for 30 min at 60 °C, depending on the probe used. Hybridization was visualized by autoradiography.
RT-PCR was performed using the ABgene Reverse-iT one-step protocol (ABgene, Surrey, UK) on poly (A)+ RNA or total RNA isolated from scutellae germinated for 30 h or 45 h. Oligonucleotide primers used for amplification of SnRK1 were 5'-ACGTCTGCA GATAACGATTCTGAATCGTCG (wtpcr1) and 5'-CCTGGGATC CCTCTGGTGCAGCATAGT, with an annealing temperature of 55 °C. Primers used to show expression of the antisense SnRK1 transgene were wtpcr1 and 5'-ATTCGAGCTCTAGAGCGGC, which anneals to a polylinker region that is present in the transgene but not native SnRK1.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Molecular cloning of a partial wheat SnRK1 sequence and construction of an antisense SnRK1 chimaeric gene
A wheat (cv. Chinese Spring) seed cDNA library in
gt11 (Hey et al., 2000) was used as template for a polymerase chain reaction (PCR) using degenerate oligonucleotide primers corresponding to sequences that are highly conserved in SnRK1 genes. These primers had been used successfully to amplify a partial SnRK1 sequence from spinach leaf RNA (Crawford et al., 2001). A single PCR product comprising 527 nucleotides from the wheat SnRK1 cDNA plus ten nucleotides at each end incorporating EcoRI and BamHI restriction sites was cloned. The wheat SnRK1 nucleotide sequence encoded a protein with 81% amino acid sequence identity with the corresponding region (residues 45–223) of barley SnRK1b (Halford et al., 1992; Accession No. X65606), and 94% identity with barley SnRK1a (Hannappel et al., 1995; Accession number X82548) (Fig. 1A). It was submitted to the EMBL database (Accession No. AJ431365).
|
A chimaeric gene, pUasSnRKN, was constructed, comprising a maize ubiquitin promoter, the wheat SnRK1 PCR product in the antisense orientation with respect to the promoter and the nopaline synthase (Nos) gene terminator (Fig. 1B).
Transient expression of p2GT in cultured wheat embryos
Alpha-amylase (-Amy2) promoter activity in cultured wheat embryos was tested by bombarding p2GT (Huttly and Baulcombe, 1989) into the scutellar epithelium of embryos isolated aseptically from immature grain. Plasmid p2GT contains the -Amy2 promoter fused to the reporter gene, UidA (Gus), with the Nos terminator. The grain had been harvested at 15, 20 and 25 dpa. With more mature grain it was difficult to separate the embryo from the endosperm and the material was, therefore, not suitable for bombardment.
Alpha-amylase activity in wheat is maximal in late seed development (Black et al., 1996) and may require a period of drying and gibberellin (GA) treatment for activation. For this reason, the embryos were incubated on MS medium with or without GA3 for 24 h prior to bombardment. After bombardment, they were incubated for a further 24 h at 37 °C in Gus assay mix. Development of distinct blue foci on the tissue surface gave evidence of promoter activity.
No activity was detectable in scutellae with or without GA3 treatment until 25 dpa. At this developmental stage, clear blue foci were visible on more than 50% of scutellae bombarded (Table 1; Fig. 2A). The addition of GA3 to the incubation medium increased the number of blue foci observed, but was not essential for promoter activity.
|
|
In order to provide a number of controls with different promoter–reporter constructs, a variety of plasmids containing constitutive promoters driving reporter genes was tested. These were pAHC25, which contains the ubiquitin promoter driving the Gus reporter gene (Christensen and Quail, 1996); pCaIDGus, which contains the CaMV35S promoter with the maize 1D intron fused to Gus; pActIDGus, which contains the rice actin promoter sequence fused to Gus (McElroy et al., 1990); pAct1IsGFP-1, which contains the rice actin promoter fused to the green fluorescent protein gene. The rice actin and ubiquitin promoters were found to be active, giving rise to blue foci with every bombardment of a promoter–Gus fusion. The percentage of embryos showing clear blue foci after incubation in Gus assay mix was similar to that seen in the p
2GT bombardment (Table 1). Green fluorescent foci were also evident with Act1IsGFP-1 but the CaMV35S–Gus (pCaIDGus) construct did not function well in this system.
Inhibition of -Amy2 promoter activity by antisense SnRK1
Bombardment of 25 dpa scutellae was performed with equimolar concentrations of p2GT and pUasSnRKN. This resulted in no blue foci at all after Gus assay (Fig. 2B), although there was some diffuse blue staining comparable with that seen when uncoated gold was used (not shown). To examine the specificity of the interaction, the double bombardment experiment was repeated using the actin and ubiquitin promoter–Gus fusion constructs with pUasSnRKN. In all controls, incubation of the scutellae in Gus assay mix after the experiment resulted in the appearance of blue foci comparable in number to those produced by bombardment with the promoter–Gus construct on its own (Table 1). An example of the result of a bombardment with pAHC25 and pUasSnRKN is shown in Fig. 2C. The antisense SnRK1 was therefore not affecting promoter activity in these expression constructs.
In a double bombardment with p2GT and pAct1IsGFP-1, live tissue showed green fluorescent spots 24 h after bombardment, and subsequent incubation in Gus assay mix resulted in dark blue foci (Table 1). This indicated that both promoters were active. As a definitive indication of the specificity of the action of SnRK1 on the -Amy2 promoter a triple bombardment was performed with p2GT, pUasSnRKN and pAct1IsGFP-1. Fluorescent green foci were again clearly evident on the scutellum surface (Fig. 2D), indicating that the actin promoter was active. However, subsequent incubation in Gus assay medium gave rise to no blue foci; the -Amy2 promoter was not active and had, therefore, been specifically inactivated by antisense SnRK1.
To confirm that the antisense SnRK1 transgene was being expressed in the bombarded embryos, an RT-PCR experiment was performed on DNaseI-treated total RNA extracted from embryos that had been co-bombarded with pUasSnRKN, p2GT and pAct1Is-GFP1 and, as a negative control, embryos co-bombarded with p2GT and pAct1Is-GFP1. The oligonucleotide primers used in the experiment were designed to anneal to the SnRK1 sequence and to a polylinker region that is present in the transgene, but not in native SnRK1. The results showed clearly that the antisense SnRK1 sequence was expressed after bombardment with pUasSnRKN (Fig. 3).
|
Alpha-amylase and SnRK1 gene expression at different stages of grain development
The evidence from transient expression studies that SnRK1 was required for
-amylase promoter activity prompted further investigation of the pattern of expression of these two genes during grain development. Northern analysis was carried out on poly(A)+-enriched RNA prepared from embryos isolated from grain at 15, 25 and 35 dpa, and from mature germinated scutellae as a control. Blots were probed using the SnRK1 PCR product, and a fragment from the 3' untranslated region of wheat -Amy2 (Lazarus et al., 1985). SnRK1 transcripts were detected in 15 dpa RNA extracts but not in 25 dpa or 35 dpa extracts and not in the germinated scutellae (Fig. 4). There was no evidence of -amylase gene expression at any of the developmental stages analysed, but -amylase transcripts were readily detectable in RNA extracted from mature germinated scutellae.
|
Sugars affect
-amylase gene expression in isolated embryosNorthern analyses were performed using RNA extracted from 25 dpa embryos incubated on MS medium supplemented with mannitol, sucrose or glucose. The presence of
-Amy1 and 2 transcripts in the mannitol-supplemented embryos, but not in the sucrose or glucose treatments showed that sugar starvation (mannitol treatment) significantly induced -amylase gene expression in the isolated embryos for both high and low pI -amylases (Fig. 5A, B). The same material was probed for SnRK1, but SnRK1 transcripts were not detectable by Northern analysis in any of the RNA extracts. However, SnRK1 transcripts were detectable by RT-PCR in all of the extracts (Fig. 5D).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
It has been shown that the wheat
-Amy2 gene promoter is active in cultured wheat embryos after particle bombardment. Hormone dependence for this activity could not be demonstrated, as although GA3 was included in the culture medium, there was no absolute requirement for it to induce -amylase promoter activity in the isolated embryos at this developmental stage. The embryos in the experiments had been incubated for 24 h on plates with the result that endogenous GA production could have stimulated -amylase gene activity, but at earlier stages of grain development it was not possible to induce promoter activity by GA treatment.
Expression analyses of RNA from wheat embryos cultured with or without sugar showed clearly that -Amy1 and -Amy2 expression was induced by sugar starvation. This induction occurred in 25 dpa embryos and was a genuine sugar, rather than an osmotic effect, as mannitol was included in the no-sugar medium. Alpha-amylase promoters have been analysed in detail for regulatory elements and several hormone response elements have been identified (Huttly and Baulcombe, 1989; Rushton et al. 1992, 1995). Several studies have also identified promoter sequences that are conserved between -amylase and other sugar responsive genes. Lu et al. (1998) identified a putative sugar response element in the rice -Amy3 promoter including a G box, GC box and the TATCCA element. Another sugar responsive gene, rbcS2, was found to have a sucrose response element containing two G-boxes that were important for high levels of sucrose-repressible gene expression (Urwin and Jenkins, 1997). This was associated with the presence of an ACT accessory factor (AF) between or just upstream of the G-boxes. The -Amy2 promoter contains a pair of G-box-like sequences, CACGCGGG and CACTTG and an AF sequence, TCCACTGCC. These sequences are only 18, 9 and 37 bp, respectively, upstream of the translation start site, but protein binding in this region of the promoter has been detected and would be likely to affect transcription (Tregear et al., 1995).
Co-bombardment of embryos with the -Amy2–Gus and antisense SnRK1 constructs resulted in complete inhibition of -amylase promoter activity, whereas the other promoters that were tested in the system were not affected by antisense SnRK1. It was concluded that wheat -Amy2 promoter activity is regulated, at least in part, by SnRK1. The only other gene to have been shown to be regulated by SnRK1 so far is the potato sucrose synthase gene, Sus4 (Purcell et al., 1998). Sus4 is sucrose (not glucose)- inducible rather than sugar-repressible (Fu et al., 1995) and SnRK1 has been proposed to be activated by high cellular sucrose and/or low cellular glucose levels (Halford and Dickinson, 2001). This makes the interpretation of sucrose feeding experiments difficult, since the effect of sucrose import into plant cells will depend on the relative activities of those sucrose-metabolizing enzymes present. In the experiments described here, both sucrose and glucose inhibited -amylase gene expression in cultured wheat embryos, and the effects of the two sugars were indistinguishable, suggesting that the embryos were able to import and metabolize the sucrose.
Taken together, and in the context of what is known already about SnRK1 function, these data suggest that SnRK1 is required for the derepression of -amylase gene expression when cellular glucose levels are low. This function is clearly analogous to that of SNF1 in the derepression of glucose-repressible genes in yeast.
|
Acknowledgements |
|---|
IACR receives grant-aided support from the Biotechnology and Biological Sciences Research Council (BBSRC) of the United Kingdom. This work was supported by Advanced Technologies (Cambridge), Biogemma UK and the Cell Engineering Link programme of the BBSRC. The authors would like to thank Dr Alison Huttly for kindly providing the p
2GT construct and for helpful discussions and Professor Mike Burrell and Dr Judy Freeman for their continuing support of this work.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Appleford NEJ, Lenton JR. 1997. Hormonal regulation of alpha-amylase gene expression in germinating wheat (Triticum aestivum) grains. Physiologia Plantarum 100, 534–542.[CrossRef]
Baulcombe DC, Huttly AK, Martienssen RA, Barker RF, Jarvis MG. 1987. A novel wheat alpha-amylase gene (alpha-amy3). Molecular and General Genetics 209, 33–40.[CrossRef]
Black M, Corbineau F, Grzesik M, Guy P, Come D. 1996. Carbohydrate metabolism in the developing and maturing wheat embryo in relation to its desiccation tolerance. Journal of Experimental Botany 47, 161–169.
Chan M-T, Yu S-M. 1998. The 3' untranslated region of a rice alpha-amylase gene functions as a sugar-dependent mRNA stability determinant. Proceedings of the National Academy of Sciences, USA 95, 6543–6547.
Christensen AH, Quail PH. 1996. Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Research 5, 213–218.[CrossRef][Web of Science][Medline]
Crawford RM, Halford NG, Hardie DG. 2001. Cloning of DNA encoding a catalytic subunit of SNF1-related protein kinase-1 (SnRK1-), and immunological analysis of multiple forms of the kinase, in spinach leaf. Plant Molecular Biology 45, 731–741.[CrossRef][Web of Science][Medline]
Dickinson JR. 1999. Carbon metabolism. In: Dickinson JR, Schweizer M, eds. The metabolism and molecular physiology of Saccharomyces cerevisiae. London, Philadelphia PA: Taylor and Francis, 23–55.
Fu H, Kim SY, Park WD. 1995. High-level tuber expression and sucrose inducibility of a potato Sus4 sucrose synthase gene require 5' and 3' flanking sequences and the leader intron. The Plant Cell 7, 1387–1394.[Abstract]
Gancedo JM. 1998. Yeast carbon catabolite repression. Microbiology and Molecular Biology Reviews 62, 334–361.
Halford NG, Bouly J-P, Thomas M. 2000. SNF1-related protein kinases (SnRKs)—regulators at the heart of the control of carbon metabolism and partitioning. Advances in Botanical Research Incorporating Advances in Plant Pathology 32, 405–434.
Halford NG, Dickinson JR. 2001. Sugar sensing and cell cycle control: evidence of cross-talk between two ancient signalling pathways. In: Francis D, ed. The plant cell cycle and its interfaces. Sheffield: Sheffield Academic Press, 87–107.
Halford NG, Hardie DG. 1998. SNF1-related protein kinases: global regulators of carbon metabolism in plants? Plant Molecular Biology 37, 735–748.[CrossRef][Web of Science][Medline]
Halford NG, Vicente-Carbajosa J, Sabelli PA, Shewry PR, Hannappel U, Kreis M. 1992. Molecular analyses of a barley multigene family homologous to the yeast protein kinase gene SNF1. The Plant Journal 2, 791–797.[CrossRef][Web of Science][Medline]
Hannappel U, Vicente-Carbajosa J, Barker JHA, Shewry PR, Halford NG. 1995. Differential expression of two barley SNF1-related protein kinase genes. Plant Molecular Biology 27, 1235–1240.[CrossRef][Web of Science][Medline]
Hardie DG, Carling D. 1997. The AMP-activated protein kinase: fuel gauge of the mammalian cell? European Journal of Biochemistry 246, 259–273.[Web of Science][Medline]
Hattori T, Nakagawa S, Nakamura K. 1990. High-level expression of tuberous root storage protein genes of sweet potato in stems of plantlets grown in vitro on sucrose medium. Plant Molecular Biology 14, 595–604.[CrossRef][Web of Science][Medline]
Hey S, Napier J, Mills C, Brett G, Hook S, Tatham AS, Fido R, Shewry PR. 2000. Characterization of a monoclonal antibody that recognizes a specific group of LMW subunits of glutenin. In: Shewry PR, Tatham AS, eds. Wheat gluten. Cambridge UK: Royal Society of Chemistry, 192–195.
Huang N, Chandler J, Thomas BR, Koizumi N, Rodriguez RL. 1993. Metabolic regulation of alpha-amylase gene expression in transgenic cell cultures of rice (Oryza sativa L.). Plant Molecular Biology 23, 737–747.[CrossRef][Web of Science][Medline]
Huttly AK, Baulcombe DC. 1989. A wheat alpha-amy2 promoter is regulated by gibberellin in transformed oat aleurone protoplasts. EMBO Journal 8, 1907–1913.[Web of Science][Medline]
Huttly AK, Martienssen RA, Baulcombe DC. 1988. Sequence heterogeneity and differential expression of the -Amy2 gene family in wheat. Molecular and General Genetics 214, 232–240.
Jacobsen JV, Higgins TJV. 1982. Characterization of the alpha-amylases synthesized by aleurone layers of Himalaya barley in response to gibberellic acid. Plant Physiology 70, 1647–1653.
Koch KE. 1996. Carbohydrate-modulated gene expression in plants. Annual Reviews of Plant Physiology and Plant Molecular Biology 47, 509–540.[CrossRef][Web of Science]
Krapp A, Hofmann B, Schafer C, Stitt M. 1993. Regulation of the expression of rbcs and other photosynthetic genes by carbohydrates—a mechanism for the sink regulation of photosynthesis. The Plant Journal 3, 817–828.
Lazarus CM, Baulcombe DC, Martienssen RA. 1985. Alpha-amylase genes of wheat are two multigene families which are differentially expressed. Plant Molecular Biology 5, 13–24.
Lu C-A, Lim E-K, Yu S-M. 1998. Sugar response sequence in the promoter of a rice alpha-amylase gene serves as a transcriptional enhancer. Journal of Biological Chemistry 273, 10120–10131.
Martin T, Hellmann H, Schmidt R, Willmitzer L, Frommer WB. 1997. Identification of mutants in metabolically regulated gene expression. The Plant Journal 11, 53–62.[CrossRef][Web of Science][Medline]
Massiah A, Rong H-L, Brown S, Laurie S. 2001. Accelerated production and identification of fertile, homozygous transgenic wheat lines by anther culture. Molecular Breeding 7, 163–173.
McCabe DE, Swain WF, Martinell BJ, Christou P. 1988. Stable transformation of soybean (Glycine max) by particle acceleration. Bio-Technology 6, 923–926.[CrossRef]
McElroy D, Shang W, Cao J, Wu R. 1990. Isolation of an efficient actin promoter for use in rice transformation. The Plant Cell 2, 163–171.
Muller-Rober BT, Kossmann J, Hannah LC, Willmitzer L, Sonnewald U. 1990. One of two different ADP-glucose pyrophosphorylase genes from potato responds strongly to elevated levels of sucrose. Molecular and General Genetics 224, 36–46.
Murashige T, Skoog F. 1962. A revized medium for rapid growth and bioassays with tobacco tissue cultures. Physiologia Plantarum 15, 473–497.[CrossRef]
Paul M, Pellny T, Goddijn O. 2001. Enhancing photosynthesis with sugar signals. Trends in Plant Sciences 6, 197–200.
Pego JV, Kortstee AJ, Huijser C, Smeekens SC. 2000. Photosynthesis, sugars and the regulation of gene expression. Journal of Experimental Botany 51, 407–416.
Perata P, Guglielminetti L, Alpi A. 1997. Sugar repression of gibberellin-dependant signalling pathway in barley embryos. The Plant Cell 9, 2197–2208.[Abstract]
Purcell PC, Smith AM, Halford NG. 1998. Antisense expression of a sucrose non-fermenting-1-related protein kinase sequence in potato results in decreased expression of sucrose synthase in tubers and loss of sucrose-inducibility of sucrose synthase transcripts in leaves. The Plant Journal 14, 195–202.
Rook F, Corke F, Card R, Munz G, Smith C, Bevan MW. 2001. Impaired sucrose-induction mutants reveal the modulation of sugar-induced starch biosynthetic gene expression by abscisic acid signalling. The Plant Journal 26, 421–33.[CrossRef][Web of Science][Medline]
Rushton PJ, Hooley R, Lazarus CM. 1992. Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated -amylase genes. Plant Molecular Biology 19, 891–901.[CrossRef][Web of Science][Medline]
Rushton PJ, Macdonald H, Huttly AK, Lazarus CM, Hooley R. 1995. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of -Amy2 genes. Plant Molecular Biology 29, 691–702.[CrossRef][Web of Science][Medline]
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning. A laboratory manual, 2nd edn. New York: Cold Spring Harbor Laboratory Press.
Sargeant JG. 1980. -Amylase enzymes and starch degradation. Cereal Research Communications 8, 77–86.
Sheen J. 1994. Feedback control of gene expression. Photosynthesis Research 39, 427–438.[CrossRef]
Sheu J-J, Yu T-S, Tong W-F, Yu S-M. 1996. Carbohydrate starvation stimulates differential expression of rice alpha-amylase genes that is modulated through complicated transcriptional and post-transcriptional processes. Journal of Biological Chemistry 271, 26998–267004.
Sugden C, Crawford RM, Halford NG, Hardie DG. 1999. Regulation of spinach SNF1-related (SnRK1) kinases by protein kinases and phosphatases is associated with phosphorylation of the T loop and is regulated by 5'-AMP. The Plant Journal 19, 433–439.[CrossRef][Web of Science][Medline]
Sweetlove LJ, Muller-Rober B, Willmitzer L, Hill SA. 1999. The contribution of adenosine 5'-diphosphoglucose pyrophosphorylase to the control of starch synthesis in potato tubers. Planta 209, 330–337.[CrossRef][Web of Science][Medline]
Toroser D, Plaut Z, Huber SC. 2000. Regulation of a plant SNF1-related protein kinase by glucose-6-phosphate. Plant Physiology 123, 403–411.
Tregear JW, Primavesi LF, Huttly AK. 1995. Functional analysis of linker insertions and point mutations in the -Amy2/54 GA-regulated promoter. Plant Molecular Biology 29, 749–758.[CrossRef][Web of Science][Medline]
Umemura T, Perata P, Futsuhara Y, Yamaguchi J 1998. Sugar sensing and alpha-amylase gene repression in rice embryos. Planta 204, 420–428.[CrossRef][Web of Science][Medline]
Urwin NAR, Jenkins GI. 1997. A sucrose-repressible element in the Phaseolus vulgaris rbcS2 gene promoter resembles elements responsible for sugar stimulation of plant and mammalian genes. Plant Molecular Biology 35, 929–942.[CrossRef][Web of Science][Medline]
Yu S-M, Kuo Y-H, Sheu G, Sheu Y-J, Liu L-F. 1991. Metabolic derepression of alpha-amylase gene-expression in suspension-cultured cells of rice. Journal of Biological Chemistry 266, 21131–21137.
Yu S-M, Lee Y-C, Fang S-C, Chan M-T, Hwa S-F, Liu L-F. 1996. Sugars act as signal molecules and osmotica to regulate the expression of alpha-amylase genes and metabolic activities in germinating cereal grains. Plant Molecular Biology 30, 1277–1289.[CrossRef][Web of Science][Medline]
Zhang Y, Shewry PR, Jones H, Barcelo P, Lazzeri PA, Halford NG. 2001. Expression of antisense SnRK1 protein kinase sequence causes abnormal pollen development and male sterility in transgenic barley. The Plant Journal 28, 431–442.[CrossRef][Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  S. J. Hey, E. Byrne, and N. G. Halford The interface between metabolic and stress signalling Ann. Bot., February 1, 2010; 105(2): 197 - 203. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Polge, M. Jossier, P. Crozet, L. Gissot, and M. Thomas {beta}-Subunits of the SnRK1 Complexes Share a Common Ancestral Function Together with Expression and Function Specificities; Physical Interaction with Nitrate Reductase Specifically Occurs via AKIN{beta}1-Subunit Plant Physiology, November 1, 2008; 148(3): 1570 - 1582. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-A. Lu, C.-C. Lin, K.-W. Lee, J.-L. Chen, L.-F. Huang, S.-L. Ho, H.-J. Liu, Y.-I. Hsing, and S.-M. Yu The SnRK1A Protein Kinase Plays a Key Role in Sugar Signaling during Germination and Seedling Growth of Rice PLANT CELL, August 1, 2007; 19(8): 2484 - 2499. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Gissot, C. Polge, M. Jossier, T. Girin, J.-P. Bouly, M. Kreis, and M. Thomas AKINbeta{gamma} Contributes to SnRK1 Heterotrimeric Complexes and Interacts with Two Proteins Implicated in Plant Pathogen Resistance through Its KIS/GBD Sequence Plant Physiology, November 1, 2006; 142(3): 931 - 944. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. G. Halford, S. Hey, D. Jhurreea, S. Laurie, R. S. McKibbin, Y. Zhang, and M. J. Paul Highly conserved protein kinases involved in the regulation of carbon and amino acid metabolism J. Exp. Bot., January 1, 2004; 55(394): 35 - 42. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. J. Bradford, A. B. Downie, O. H. Gee, V. Alvarado, H. Yang, and P. Dahal Abscisic Acid and Gibberellin Differentially Regulate Expression of Genes of the SNF1-Related Kinase Complex in Tomato Seeds Plant Physiology, July 1, 2003; 132(3): 1560 - 1576. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||