Journal of Experimental Botany, Vol. 54, No. 384, pp. 943-950,
March 1, 2003
© 2003 Oxford University Press
The first 238 amino acids of the human lamin B receptor are targeted to the nuclear envelope in plants
Received 15 August 2002; Accepted 4 November 2002
Research School of Biological and Molecular Sciences, Oxford Brookes University, Gipsy Lane, Headington, Oxford OX3 0BP, UK
1 To whom correspondence should be addressed: Fax: +44 (0)1865 483242. E-mail: deevans{at}brookes.ac.uk
Abbreviations: NE, nuclear envelope; ONE, outer nuclear envelope; INE, inner nuclear envelope; GFP, green fluorescent protein; LBR, lamin B receptor, PLT, progressive lowering of temperature.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResults and discussionConclusionsReferences |
|---|
In plants, the nuclear envelope (NE) is one of the least characterized cellular structures. In particular, little is known about its dynamics during the cell cycle. This is due to the absence of specific markers for in vivo studies. To generate such an in vivo marker, the suitability of the human lamin B receptor (LBR) was tested. When the first 238 amino acids of the LBR, fused to the green fluorescent protein (GFP), were expressed in tobacco plants, fluorescence accumulated only at the NE of leaf epidermal cells. This was confirmed by electron microscopy. The protein was shown to be membrane-integral by phase separation. Distribution of fluorescence was compared with two ER markers, GFP-calnexin and GFP-HDEL. While co-localization of all three markers was noted at the NE, only LBR-GFP was specific to the NE, while the other two also showed fluorescence of the cortical ER. These results suggest that common targeting mechanisms to those in animals and fungi exist in plants to direct and locate proteins to the NE. This chimaeric construct is the first available fluorescent integral membrane protein marker to be targeted exclusively to the plant NE and it provides a novel opportunity to investigate the dynamics of this membrane system in vivo. With it, the cell cycle was followed in tobacco BY-2 cells stably expressing the fusion protein. The interphase labelling of the NE altered in metaphase into an ER-like meshwork, suggesting the dispersal of the NE to ER as in animal cells. Finally, the meshwork of fluorescent membranes was lost and new fluorescent NE formed around the daughter nuclei.
Key words: GFP, lamin B receptor, membrane targeting, Nicotiana tabacum, nuclear envelope.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionConclusionsReferences |
|---|
The nuclear envelope (NE) is a unique feature of eukaryotic cells and comprises a concentric double membrane, perforated by nuclear pores. The outer NE (ONE) is a functional continuum with perinuclear endoplasmic reticulum (ER), through ‘junctional’ regions and it has therefore been suggested that the components of this membrane and of the lumen are likely to be identical with it. However, while many proteins are present in both the ER and the ONE, there are functional and physical distinctions between the two membranes, not least because of the highly specialized function of the NE (Franke et al., 1981; Gerace and Blobel, 1982). The inner NE (INE) contains a functionally distinct group of proteins, which includes those involved in maintaining the structure of the nucleus by their interaction with the nuclear lamina (Schuler et al., 1994; Ye and Worman, 1994). To date, knowledge of plant NE organization and protein composition is very limited (see Meier, 2001, for a review). Moreover information on the dynamics of the plant NE during progression through the cell cycle imaged with specific markers in living cells is limited. Progress in this area has been hindered by the absence of a marker uniquely localized to the NE for use in in vivo studies. Markers directed to the NE but also localized with other subcellular structures (e.g. RanGAP, MAF1, MFP1; Rose and Meier, 2001; Gindullis and Meier, 1999) have been constructed as GFP-chimaeras, but lack the specificity needed for exclusive analysis of the properties of the NE. Recent work using RanGAP-GFP fusions in Arabidopsis showed a discontinuous distribution of fluorescence, suggestive of nuclear pore association rather than NE membrane (Pay et al., 2002). Immunofluorescence labelling during mitosis showed RanGAP co-localizing with microtubules. Immunolabelling of the protein degrading 26S proteasome showed NE labelling, in addition to other structures (Yanagawa et al., 2002). During mitosis the proteasome labelling colocalized with the microtubules of the mitotic spindle.
To date, the dynamics of the mammalian NE have been successfully investigated using a GFP-fusion with the N-terminal lamin-B receptor domain (Ellenberg et al., 1997). The LBR is a constituitively expressed, 58 kDa integral membrane protein of the INE (Worman et al., 1990; Holmer et al., 1998). It is present in animal, but not plant or fungal cells. The protein has eight transmembrane domains, and a large N-terminus in the nucleoplasm to which the lamins and chromatin bind (Ye and Worman, 1994; Schuler et al., 1994; Takano et al., 2002). These protein–protein and protein–DNA interactions are responsible, in part, for retention in the INE (Soullam and Worman, 1993, 1995). The carboxyl-terminal domain binds to B-type lamins and HP1-type chromatin proteins (Ye and Worman, 1994, 1996; Ye et al., 1997). It also shares similarity in sequence to yeast and plant sterol reductases (Schuler et al., 1994; Ye et al., 1997). Studies using truncated LBR indicate that the N-terminus contains a bipartite nuclear location signal (NLS) and that the first transmembrane domain is necessary and sufficient for protein targeting to the INE (Soullam and Worman, 1993, 1995; Smith and Blobel, 1994). The NE targeting of human LBR has also been demonstrated in yeast (Smith and Blobel, 1993).
The N-terminal domain of the LBR, comprising the nucleoplasmic N terminal region and one transmembrane domain, has been fused to the enhanced GFP and localized to the NE, and to a lesser extent the ER of COS-7 cells (Ellenberg et al., 1997). The LBR-GFP chimaera has allowed the in vivo dynamics of interphase and mitotic cells in mammalian cells to be followed (Ellenberg et al., 1997; Gerlich et al., 2001; Beaudouin et al., 2002).
Extensive searching of the higher plant protein and DNA sequence databases indicates that there is no plant homologue to the N-terminal domain of the mammalian LBR (SL Irons and DE Evans, unpublished results), although nuclear lamin-like proteins have been reported to exist in plants (Beven et al., 1991; McNulty and Saunders, 1992; Minguez and Moreno Diaz de la Espina, 1993; Gindullis et al., 2002).
To obtain an in vivo marker for studying the dynamics of the plant NE, the suitability was tested of the human LBR-GFP chimaera (Ellenberg et al., 1997) optimized for plant expression. The protein fusion was expressed in stably transformed tobacco plants and cells and followed the subcellular localization of the LBR-GFP5 fusion. It was found that it localizes at the membrane of the NE in interphase. This chimaeric LBR construct is the first specific fluorescent marker for the study of the dynamics of the plant NE in vivo. With it, it has been possible to follow the in vivo dynamics of the NE in actively dividing cells. The fate of components of the NE during NE breakdown and re-formation is of particular importance and has not previously been investigated in living plant cells. In this paper, the migration of the LBR-GFP5 construct is described during both NE breakdown and re-formation. Together, these results suggest that plants may share common signals for NE targeting with animal and yeast cells, and/or that the LBR may have structural and functional plant homologues.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionConclusionsReferences |
|---|
Molecular cloning
Standard molecular biology techniques were adopted (Sambrook et al., 1989). To generate a lamin B receptor-GFP fusion with plant optimized expression, the coding region of the first N-terminal 238 amino acids of the human LBR (Ellenberg et al., 1997) was fused to GFP5 (Haseloff et al., 1997), which lacks the aberrant cryptic intron, and then spliced into pVKH18EN6 (Batoko et al., 2000) at the BamHI-SacI sites. To do so, PCR was performed using oligonucleotides SI16 (5'-gtcggcggatccatgccaagtaggaaattt gcc) and SI13 (5'-ccagtcgacgtgggatctttctgtttac acatcaacagc) to amplify LBR and SI17 (5'-gcgtccga gctcttatttgtatagttcatccatgcc) and SI14 (5'-cag aaagatcccacgtcgactggagaacttgtttcaaatgg) to amplify GFP5. The overlapping PCR was finally performed using the amplified DNA sequences as template using the oligonucleotides SI16 and SI17. The overlapping PCR product was designed to contain a glycosylatable region (N-glyc.; Batoko et al., 2000). Therefore the final LBR-GFP5 fusion was generated as follows: BamHI–LBR–Nglyc.–GFP5–SacI.
A GFP5-calnexin fusion (spGFP5CX) was generated by overlapping PCR. GFP5 fused at the 5' end to a sporamin signal peptide and bearing a glycosylatable region (Batoko et al., 2000) was amplified with primers FB60 (5'-cgagacggatccatgaaagccttcac actcgctctcttcttagc) and FB78 (5'-ctctttctcaac atctagatctagagtttctgctcctttg). The last 236 base pairs of arabidopsis calnexin (Huang et al., 1993) were amplified with oligonucleotides FB80 (5'-gcgccggagctcctaattat cacgtctcggttgcc) and FB79 (5'-gaaactctagatc tagatgttgagaaagagaaacaaaaggcagaagagg). A spacer of seven amino acids was inserted between the GFP5 and the calnexin sequence. The overlapping amplification was performed with oligonucleotides FB60 and FB80. The overlapping PCR product was designed to contain a glycosylatable region between the signal peptide and the coding region of calnexin (Batoko et al., 2000). The construct was inserted between the BamHI and SacI sites of pVKH18En6 (Batoko et al., 2000).
The ER-targeted yellow fluorescent protein (spYFP-HDEL) was generated by amplification of a c-myc tagged EYFP (Clontech) with oligonucleotides FB116 (5'-cgccaggcaacgtcgactggcg aggagctgttcaccggggtgg) and FB90A (5'-gcgccgga gctcctaaagctcatcatgcaaatcctcctcagagataa gtttctgc). The amplified product was inserted downstream of a sporamin signal peptide at a SalI/SacI site of an existing sporamin signal peptide-GFP5-HDEL construct cloned into pVKH18En6 binary vector.
Stable expression
Stably transformed plants were generated via Agrobacterium tumefaciens-mediated transformation as described by Hadlington and Denecke (2001). Stable BY-2 cell transformation was achieved as described in Saint-Jore et al. (2002). Double transformation was achieved as in Saint-Jore et al. (2002) with the following amendment: wild type BY-2 cells were incubated with 50 µl each of LBR-GFP5 and spYFP-HDEL transformed agrobacteria for 2 d, the cells were washed and plated onto antibiotic plates, and selected as previously described (Saint-Jore et al., 2002).
Synchronization
Stationary phase cells, maintained in 20 ml volumes at 27 °C on an orbital shaker at 130 rpm, were transferred (1 ml) into 20 ml fresh BY-2 medium, supplemented with 5 µg ml–1 aphidicolin in DMSO and 40 µg ml–1 hygromycin (final concentrations). Cells were returned to the shaker at 130 rpm for 24 h at 27 °C. After 24 h the cells were washed by gentle agitation in a sterile fine mesh filter in fresh BY-2 medium containing no aphidicolin or antibiotics and the washing medium was changed several times (final volume 500 ml). The washed cells were resuspended in 20 ml fresh medium plus hygromycin and shaken for 11 h prior to viewing with a confocal microscope.
Imaging
Confocal imaging was performed using an inverted Zeiss LSM 510 Laser Scanning Microscope with a 40x oil immersion objective. For imaging expression of GFP constructs alone or in combination with YFP, the single- and multi-track facilities of the confocal microscope were used, respectively, as previously described (Brandizzi et al., 2002b). For imaging GFP and ethidium bromide (EtBr), the 488 nm excitation line of an argon ion laser (GFP) and the 543 nm excitation line of the helium laser (EtBr) were used alternately. Fluorescence was detected using a 488/543 nm dichroic beam splitter and 505–530 nm band pass filter for GFP and 560 nm long pass filter for EtBr. Post-acquisition image processing was with an LSM 5 Image Browser (Zeiss) and Adobe Photoshop 5.5 software.
Ethidium bromide staining involved the incubation of leaf tissue or BY-2 suspension cultures with EtBr (50 µg ml–1) and 50 µg ml–1 RNase for 30 min (Brandizzi and Caiola, 1998).
For imaging expression in leaves, roughly 1 cm2 of leaf tissue was mounted in water on a slide. For imaging BY-2 cells, 50–100 µl of cells were taken from a suspension culture and put on a slide prior to confocal observations. Samples were analysed at room temperature.
Electron microscopy
Leaf material was prepared for electron microscopy using the progressive lowering of temperature (PLT) technique as described by Gunawardena et al. (2001) with the exception of the fixative used. For this study, leaf material was fixed for 1 h in 1% paraformaldehyde/1% glutaraldehyde in 0.1 M Na-cacodylate buffer (pH 6.9).
For immunogold labelling, sections were treated as described in Gunawardena et al. (2001) using as primary antibody anti-GFP (Molecular Probes, Leiden, The Netherlands) diluted 1:3000 in PBS BSA (1%). Control grids were incubated in the absence of primary antibody. Sections were then washed (3x10 min) in PBS BSA 1% fish gelatin before incubation for 1 h at room temperature in secondary antibody (10 nm gold conjugated goat anti-rabbit secondary antibody, British Biocell, Cardiff, UK) diluted 1:20 with 1% fish gelatin in PBS BSA (1%). Sections were then viewed using a JEOL 1200 EXII transmission electron microscope. Sections were then post-stained using uranyl acetate and lead citrate (Reynolds, 1963) before examination.
Phase partition
The membrane location of the LBR-GFP5 construct was assessed using Triton X-114 (TX-114) partition as described by Bordier (1981) using 0.2–1.0 mg ml–1 of proteins extracted from leaf tissue and BY-2 cells in 10 mM TRIS-HCl, 150 mM NaCl, 0.5–1.0% TX-114.
Protein concentration
The total, soluble and integral membrane proteins from the phase partition were concentrated by incubation with saturated ammonium sulphate solution (1 ml protein sample to 1.5 ml ammonium sulphate solution) overnight at 4 °C. Tubes were centrifuged at 13 000 rpm in a microfuge for 10 min, the supernatant removed and protein resuspended in TE (50 mM TRIS, 2 mM EDTA). Determination of protein concentration was carried out using the Bio-Rad Protein assay following the manufacturer’s instructions.
SDS polyacrylamide gel electrophoresis
Electrophoresis was performed in denaturing conditions using a discontinuous buffer system (Laemmli, 1970). SDS polyacrylamide gels (12%, pH 8.8) with stacking gels (pH 6.8) were prepared using the Bio-Rad Mini Protean II unit. 15 µl of each protein sample, diluted 1:1 with 2x SDS PAGE loading buffer (Sambrook et al., 1989), were loaded on the gels and run at 100 V until the dye front reached the end of the gel. Western blotting (Sambrook et al., 1989) was performed using the Bio-Rad mini-blot system for wet blotting, blotting for 1 h at 100 V onto Schliecher and Schuell 0.45 µm nitrocellulose membrane. The blotted membranes were blocked with PBST 5% skimmed milk powder, then immersed in primary antibody in PBST 5% skimmed milk powder (anti-GFP 1:3000 dilution) overnight at 4 °C. Primary antibody was washed off and a secondary antibody added (goat anti-rabbit conjugated to horseradish peroxidase (HRP) 1:10 000 in PBST 5% milk). Proteins were visualized using an ECL detection system (Amersham Pharmacia, UK) as per the manufacturer’s instructions.
|
Results and discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionConclusionsReferences |
|---|
LBR-GFP5 localizes exclusively to the NE in tobacco leaves
In this study, a GFP5 (Haseloff et al., 1997) fusion construct of the first 238 amino acids of the mammalian LBR was generated and expressed in tobacco leaves and BY-2 cells under the control of an enhanced 35S promoter.
Tobacco epidermal cells stably expressing LBR-GFP5 and stained with ethidium bromide showed intense red fluorescence localized at the nucleoplasm (Fig. 1A). When the same plant material was analysed with the imaging settings for GFP fluorescence, bright fluorescence was localized at the rim of the nuclei, strongly indicating labelling of the NE (Fig. 1B, C). No fluorescence was detected in the cortical endoplasmic reticulum (Fig. 1D).
|
To compare the subcellular distribution of LBR-GFP5 with ER markers, tobacco leaf epidermal cells expressing a GFP5-calnexin fusion (spGFP5CX, Fig. 1E, F) and ER targeted/retained GFP5 (spGFP5-HDEL; Fig. 1G, H), which are ER membrane and soluble markers, respectively, were analysed. spGFP5CX and spGFP5-HDEL accumulated at the NE. However, strong labelling was easily detectable at the cortical ER (Fig. 1F, H). These results indicate exclusive fluorescence location at the NE, unlike spGFP5CX and spGFP5-HDEL.
In order to investigate further the subcellular localization of the LBR-GFP5 chimaera, an ultrastructural study was undertaken by electron microscopy. Antibodies to GFP and immunogold immunocytochemistry were used to detect the location of the expressed protein in the transformants. Gold particles were localized at the NE in cells expressing the construct (Fig. 2A), but not in non-transformed controls (Fig. 2B). It was not possible to discriminate between INE, ONE and NE lumenal staining because the indirect immunostaining technique used a secondary antibody for detection. The GFP domain of the construct is anticipated to be NE lumenal, anchored to the membrane by the LBR domain and the combined size of the primary and secondary antibodies limit the resolution of the technique.
|
The LBR-GFP5 construct is an integral membrane protein
LBR is an integral membrane protein in mammalian cells (Soullam and Worman, 1993, 1995). As plant cells were used as a heterologous system for LBR-GFP5 expression, a mislocation of the chimaeric protein in the endomembrane system had to be excluded. Therefore, a phase separation assay (Bordier, 1981) was carried out in order to assess the cellular distribution of the LBR-GFP5 fusion. The assay is based on partitioning total cellular extracts between an aqueous phase and a detergent phase obtained with extraction in Triton X-114; membrane integral proteins partition into the detergent-enriched phase, while soluble proteins partition with the aqueous phase. As membrane and soluble markers of the endomembrane system spGFP5CX and sp-GFP5-HDEL, were adopted respectively. Figure 3 shows that LBR-GFP5 and spGFP5CX partitioned in the detergent phase. The spGFP-HDEL fusion partitioned in the aqueous phase, as expected, while LBR-GFP5 was absent from it. These results indicated that the construct was membrane integral. The lower molecular weight bands seen in the aqueous and Triton fractions may originate from GFP5 clipping from the LBR-GFP5 construct. Such GFP cleavage has been observed in other GFP membrane protein constructs expressed in tobacco cells (Brandizzi et al., 2002a) and with soluble protein GFP fusions in tobacco protoplasts (Frigerio et al., 2001).
|
Taken together, the results from confocal and electron microscopy and biochemical investigations indicate that LBR-GFP5 fusion is a membrane integral protein that locates at the NE membrane in plant cells as it does in animal cells.
LBR-GFP5 highlights NE dynamics in BY-2 cells
The LBR-GFP5 fusion was then used as a vital marker specifically to follow NE dynamics during the cell cycle in plant cells in vivo. As far as is known, this has never been achieved before. To do so, BY-2 cells were stably transformed (Fig. 4) and followed though the cell cycle.
|
In BY-2 cells stably expressing LBR-GFP5 the presence of bright fluorescence was observed, localizing mainly at the NE (Fig. 1I). Faint ER was also detected. Thus young cultures resembled stably transformed plants with a high specificity of NE staining. Similar ER labelling with LBR-GFP5 was also found in mammalian cells (Ellenberg et al., 1997). The ER labelling intensified in BY-2 cultures that had been repeatedly transferred.
BY-2 cells co-expressing LBR-GFP5 (Fig. 1J) and spYFP-HDEL (Fig. 1K), a soluble ER marker, show much brighter YFP fluorescence of the ER in comparison to LBR-GFP5. In addition to the NE, the construct decorated punctate structures (Fig. 1L). In yeast, the chicken lamin B receptor was found to be located at the NE and was also noted in stacks of membrane formed in the transformants. It was suggested that these membrane stacks were the result of accumulation of membrane containing over-expressed LBR when the NE was saturated with the protein (Smith and Blobel, 1993). The fluorescent spot-like structures found in BY-2 cells may be analogous to this. These structures were also present during interphase and cell division (Fig. 1L).
The distribution of the LBR-GFP5 was then followed during mitosis (Fig. 4). At interphase, specific NE labelling was present. At metaphase the LBR-GFP5 labels a membraneous meshwork which is continuous with ER as if the NE disperses into the ER as in animal cells (Ellenberg et al., 1997). Later, LBR-GFP5 fluorescence was observed in tubular structures resembling tubular ER (Fig. 4, arrows) at the division plate between the two daughter nuclei. Similar labelling of the ER during mitosis has been shown in plant cells with immunolabelled RanGAP and calreticulin (Pay et al., 2002; Denecke et al., 1995). During phragmoplast assembly, fluorescence increases in the re-forming NE that form amongst the membraneous networks and fluorescence of the networks decreases. This resembles the situation in animal cells, where the NE proteins migrate from ER meshwork into the newly forming NE (Ellenberg et al., 1997). The results therefore strongly suggest that components of plant and animal NE migrate to the ER pool after NE breakdown and the new NE of daughter cells re-form from that pool. The possibility of protein breakdown and synthesis contributing to NE breakdown cannot be discounted, however, the continued high level and steady presence of fluorochrome throughout mitosis would suggest that the original protein pool is present through mitosis, as in animal cells (Ellenberg et al., 1997).
NE re-forms in the middle of the membraneous networks partitioned in the two daughter cells and the two new nuclei get closer to the phragmoplast (Fig. 4).
|
Conclusions |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionConclusionsReferences |
|---|
The subcellular distribution of the LBR-GFP5 raises several questions on the molecular targeting of proteins to NE in plants. Plants do not have identifiable molecular homologues of LBR. This may suggest that plant NE has a unique composition, which could have arisen differently from yeast and animals. However, targeting the amino-terminal 238 amino acids of the human LBR to the higher plant NE suggests that at least one NE protein targeting and anchoring mechanism, as yet unknown, may be common in plants, animals and yeast. Positive protein targeting of heterologous proteins in plants has been previously reported. For example, the last 52 amino acids of the rat sialyl-transferase are sufficient to locate a GFP fusion to the plant Golgi in tobacco plants and BY-2 cells (Saint-Jore et al., 2002; Boevink et al., 1998), despite the absence of such a protein in plants. This example again suggests that proteins may share similar targeting and retention mechanisms in animal and plant cells.
Our studies continue to determine what domains of the N-terminal LBR are necessary and sufficient for NE targeting in plants. Initially, the efforts will concentrate on determining if the LBR-GFP5 targets the INE or the ONE or both. Finally, the availability of this novel tool will allow completion of the investigations of NE dynamics during mitosis in relation to other subcellular components.
|
Acknowledgements |
|---|
We are grateful to Dr J Ellenberg for the kind gift of the LBR-EGFP construct. Dr H Batoko is acknowledged for allowing us to use tobacco plants expressing spGFP5-HDEL. We thank Mr B Martin and Mrs A Kearns for help with electron microscopy and cell culture. We acknowledge the Leverhulme Trust for partial funding of this work.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionConclusionsReferences |
|---|
Batoko H, Zheng HQ, Hawes C, Moore I. 2000. A rab1 GTPase is required for transport between the endoplasmic reticulum and Golgi apparatus and for normal Golgi movement in plants. The Plant Cell 12, 2201–2217.
Beaudouin J, Gerlich D, Daigle N, Eils R, Ellenberg J. 2002. Nuclear envelope breakdown proceeds by microtubule-induced tearing of the lamina. Cell 108, 83–96.[CrossRef][Web of Science][Medline]
Beven A, Guan Y, Peart J, Cooper C, Shaw P. 1991. Monoclonal-antibodies to plant nuclear matrix reveal intermediate filament-related components within the nucleus. Journal of Cell Science 98, 293–302.
Boevink P, Oparka K, Cruz SS, Martin B, Betteridge A, Hawes C. 1998. Stacks on tracks: the plant Golgi apparatus traffics on an actin/ER network. The Plant Journal 15, 441–447.[CrossRef][Web of Science][Medline]
Bordier C. 1981. Phase separation of integral membrane proteins in Triton X-114 solution. Journal of Biological Chemistry 256, 1604–1607.
Brandizzi F, Caiola MG. 1998. Flow cytometric analysis of nuclear DNA in Crocus sativus and allies (Iridaceae). Plant Systematics and Evolution 211, 149–154.[CrossRef]
Brandizzi F, Frangne N, Marc-Martin S, Hawes C, Neuhaus J-M, Paris N. 2002a. The destination for single-pass membrane proteins is influenced markedly by the length of the hydrophobic domain. The Plant Cell 14, 1077–1092.
Brandizzi F, Snapp E, Roberts A, Lippincott-Schwartz J, Hawes C. 2002b. Membrane protein transport between the endoplasmic reticulum and the Golgi in tobacco leaves is energy dependent but cytoskeleton independent: evidence from selective photobleaching. The Plant Cell 14, 1293–1309.
Denecke J, Carlsson LE, Vidal S, Höglund A-S, Ek B, van Zeijl MJ, Sinjorgo KMC, Palva ET. 1995. The tobacco homologue of mammalian calreticulin is present in protein complexes in vivo. The Plant Cell 7, 391–406.[Abstract]
Ellenberg J, Siggia ED, Moreira JE, Smith CL, Presley JF, Worman HJ, Lippincott-Schwartz J. 1997. Nuclear membrane dynamics and reassembly in living cells: targeting of an inner nuclear membrane protein in interphase and mitosis. Journal of Cell Biology 138, 1193–1206.
Franke WW, Sheer U, Krohne G, Jarasch E. 1981. The nuclear envelope and the architecture of the nuclear periphery. Journal of Cell Biology 91, 39s–50s.
Frigerio L, Foresti O, Hernández Felipe D, Neuhaus J-M, Vitale A. 2001. The C-terminal tetrapeptide of phaseolin is sufficient to target green fluorescent protein to the vacuole. Journal of Plant Physiology 158, 499–503.[CrossRef][Web of Science]
Gerace L, Blobel G. 1982. Nuclear lamina and the structural organization of the nuclear envelope. Cold Spring Harbor Symposia on Quantitative Biology 46, 967–978.
Gerlich D, Beaudouin J, Gebhard M, Ellenberg J, Eils R. 2001. Four-dimensional imaging and quantitative reconstruction to analyse complex spatiotemporal processes in live cells. Nature Cell Biology 3, 852–855.
Gindullis F, Meier I. 1999. Matrix attachment region binding protein MFP1 is localized in discrete domains at the nuclear envelope. The Plant Cell 11, 1117–1128.
Gindullis F, Rose A, Patel S, Meier I. 2002. Four signature motifs define the first class of structurally related large coiled-coil proteins in plants. BMC Genomics 3, 9. http://www.biomedcentral.com/1471–2164/3/9
Gunawardena AHLAN, Pearce DM, Jackson MB, Hawes CR, Evans DE. 2001. Rapid changes in cell wall pectic polysaccharides are closely associated with early stages of aerenchyma formation, a spatially localized form of programmed cell death in roots of maize (Zea mays L.) promoted by ethylene. Plant, Cell and Environment 24, 1369–1375.[CrossRef]
Hadlington JL, Denecke J. 2001. Transient expression, a tool to address questions in plant cell biology. In: Hawes C, Satiat-Jeunemaitre B, eds. Plant cell biology: a practical approach, 2nd edn. Oxford: Oxford University Press, 107–126.
Haseloff J, Siemering KR, Prasher DC, Hodge S. 1997. Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proceedings of the National Academy of Sciences, USA 94, 2122–2127.
Holmer L, Pezhman A, Worman HJ. 1998. The human lamin B receptor/sterol reductase multigene family. Genomics 54, 469–476.[CrossRef][Web of Science][Medline]
Huang LQ, Franklin AE, Hoffman NE. 1993. Primary structure and characterization of an Arabidopsis thaliana calnexin-like protein. Journal of Biological Chemistry 268, 6560–6566.
Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685.[CrossRef][Medline]
McNulty K, Saunders MJ. 1992. Purification and immunological detection of pea nuclear intermediate filaments: evidence for plant nuclear lamins. Journal of Cell Science 103, 407–414.[Abstract]
Meier I. 2001. The plant nuclear envelope. Cellular and Molecular Life Sciences 58, 1774–1780.[CrossRef][Web of Science][Medline]
Minguez A, Moreno Diaz de la Espina S. 1993. Immunological characterization of lamins in the nuclear matrix of onion cells. Journal of Cell Science 106, 431–439.[Abstract]
Pay A, Resch K, Frohnmeyer H, Fejes E, Nagy F, Nick P. 2002. Plant RanGAPs are localized at the nuclear envelope in interphase and associated with microtubules in mitotic cells. The Plant Journal 30, 699–709.[CrossRef][Web of Science][Medline]
Reynolds ES. 1963. The use of lead citrate at high pH as an electron opaque stain in electron microscopy. Journal of Cell Biology 17, 208–212.
Rose A, Meier I. 2001. A domain unique to plant RanGAP is responsible for its targeting to the plant nuclear rim. Proceedings of the National Academy of Sciences, USA 98, 15377–15382.
Saint-Jore CM, Evins J, Brandizzi F, Batoko H, Moore I, Hawes C. 2002. Redistribution of membrane proteins between the Golgi apparatus and endoplasmic reticulum in plants is reversible and not dependent on cytoskeletal networks. The Plant Journal 29, 661–679.[CrossRef][Web of Science][Medline]
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning, a laboratory manual. USA: Cold Spring Harbor Laboratory Press.
Schuler E, Lin F, Worman HJ. 1994. Characterization of the human gene encoding LBR, an integral protein of the nuclear envelope inner membrane. Journal of Biological Chemistry 269, 11312–11317.
Smith S, Blobel G. 1993. The first membrane spanning region of the lamin B receptor is sufficient for sorting to the inner nuclear membrane. Journal of Cell Biology 120, 631–637.
Smith S, Blobel G. 1994. Colocalization of vertebrate lamin B and lamin B receptor (LBR) in nuclear envelopes and in LBR-induced membrane stacks of the yeast Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences, USA 91, 10124–10128.
Soullam B, Worman HJ. 1993. The amino-terminal domain of the lamin B receptor is a nuclear envelope targeting signal. Journal of Cell Biology 120, 1093–1100.
Soullam B, Worman HJ. 1995. Signals and structural features involved in integral membrane protein targeting to the inner nuclear membrane. Journal of Cell Biology 130, 15–27.
Takano M, Takeuchi M, Ito H, Furukawa K, Sugimoto K, Omata S, Horigome T. 2002. The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region. European Journal of Biochemistry 269, 943–953.[Web of Science][Medline]
Worman HJ, Evans CD, Blobel G. 1990. The lamin B receptor of the nuclear envelope inner membrane: a polytopic protein with eight potential transmembrane domains. Journal of Cell Biology 111, 1535–1542.
Yanagawa Y, Hasezawa S, Kumagai F, et al. 2002. Cell-cycle dependent dynamic change of 26S proteasome distribution in tobacco BY-2 cells. Plant and Cell Physiology 43, 604–613.
Ye Q, Callebut I, Pezhman A, Courvalin J-C, Worman HJ. 1997. Domain-specific interactions of human HP1-type chromodomain proteins and inner nuclear membrane protein LBR. Journal of Biological Chemistry 272, 14983–14989.
Ye Q, Worman HJ. 1994. Primary structure analysis and lamin B and DNA binding of human LBR, an integral protein of the nuclear envelope inner membrane. Journal of Biological Chemistry 269, 11306–11311.
Ye Q, Worman HJ. 1996. Interaction between an integral protein of the nuclear envelope inner membrane and human chromodomain proteins homologous to Drosophila HP1. Journal of Biological Chemistry 271, 14653–14656.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Gao, F. Brandizzi, C. Benning, and R. M. Larkin A membrane-tethered transcription factor defines a branch of the heat stress response in Arabidopsis thaliana PNAS, October 21, 2008; 105(42): 16398 - 16403. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Strasser, J. S. Bondili, U. Vavra, J. Schoberer, B. Svoboda, J. Glossl, R. Leonard, J. Stadlmann, F. Altmann, H. Steinkellner, et al. A Unique {beta}1,3-Galactosyltransferase Is Indispensable for the Biosynthesis of N-Glycans Containing Lewis a Structures in Arabidopsis thaliana PLANT CELL, July 1, 2007; 19(7): 2278 - 2292. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Goodin, R. Chakrabarty, S. Yelton, K. Martin, A. Clark, and R. Brooks Membrane and protein dynamics in live plant nuclei infected with Sonchus yellow net virus, a plant-adapted rhabdovirus J. Gen. Virol., June 1, 2007; 88(6): 1810 - 1820. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Ma, S. Cai, Q. Lv, Q. Jiang, Q. Zhang, Sodmergen, Z. Zhai, and C. Zhang Lamin B receptor plays a role in stimulating nuclear envelope production and targeting membrane vesicles to chromatin during nuclear envelope assembly through direct interaction with importin beta J. Cell Sci., February 1, 2007; 120(3): 520 - 530. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Meier Composition of the plant nuclear envelope: theme and variations J. Exp. Bot., January 1, 2007; 58(1): 27 - 34. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Runions, T. Brach, S. Kuhner, and C. Hawes Photoactivation of GFP reveals protein dynamics within the endoplasmic reticulum membrane J. Exp. Bot., January 1, 2006; 57(1): 43 - 50. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Patel, A. Rose, T. Meulia, R. Dixit, R. J. Cyr, and I. Meier Arabidopsis WPP-Domain Proteins Are Developmentally Associated with the Nuclear Envelope and Promote Cell Division PLANT CELL, December 1, 2004; 16(12): 3260 - 3273. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||