JXB Advance Access originally published online on August 8, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Experimental Botany, Vol. 54, No. 391, pp. 2239-2244,
October 1, 2003
© 2003 Oxford University Press
Expression analysis of five tobacco EIN3 family members in relation to tissue-specific ethylene responses
Received 13 March 2003; Accepted 12 June 2003
Department of Experimental Botany, Graduate School of Experimental Plant Sciences, University of Nijmegen, Toernooiveld 1, 6525 ED Nijmegen, The Netherlands
* To whom correspondence should be addressed. Fax: +31 243652490. E-mail: koenw{at}sci.kun.nl
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Ethylene induces different sets of genes in different tissues and at different stages of development. To investigate whether these differential responses are caused by differential expression of members of the EIN3 family transcription factors, five tobacco family members were isolated. They can be divided into three subgroups, which is probably due to the amphidiploid nature of tobacco. In phylogenetic analysis, each of the subgroups clustered with one of the three tomato EIL proteins and all NtEILs proved to be most homologous to Arabidopsis EIN3 and EIL1. Although organ-specific ethylene responses have been observed before, northern blot analysis showed that all NtEILs were expressed in all organs. To study differential NtEIL expression at the cellular level, in situ hybridization was used on the tobacco ovary. It was found that different ovary tissues displayed variable ethylene-induced expression of two ethylene-responsive marker genes. By contrast, no differences were found in expression level or tissue-specificity for any of the NtEILs in the ovary, before or after ethylene treatment. This indicates that the organ and tissue-specific ethylene responses are not caused by differential expression of NtEIL family members. These results support a model in which the developmental signals that regulate the tissue-specific responses are integrated with the ethylene signal downstream of a common primary ethylene-signalling pathway.
Key words: Ethylene, ETHYLENE-INSENSITIVE3 (EIN3), ETHYLENE-INSENSITIVE3-LIKE (EIL), Nicotiana tabacum, signal-transduction pathway, tissue-specific response.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The plant hormone ethylene regulates a variety of processes, such as the ‘triple response’ of germinating seedlings, root hair formation, leaf expansion, fruit ripening, and petal senescence after fertilization. In addition, ethylene is known to induce defence responses in reaction to biotic and abiotic stresses (Abeles et al., 1992). Initiation of these processes involves complex regulation of ethylene biosynthesis and depends on the ability of cells to respond in an appropriate manner. Over the last decades considerable progress has been made towards the elucidation of both the ethylene-biosynthesis pathway and the ethylene-response pathway. In higher plants, ethylene is synthesized from methionine via the formation of S-adenosyl-L-methionine (AdoMet) and 1-aminocyclopropane-1-carboxylate (ACC). The individual reactions of this biosynthetic pathway are catalysed by the enzymes AdoMet synthase, ACC synthase and ACC oxidase, respectively (Yang and Hoffman, 1984; Kende, 1993). Analysis of Arabidopsis thaliana mutants with an aberrant triple response, either absent or constitutive, has led to the identification of a number of components of the primary ethylene-signalling pathway (reviewed by Johnson and Ecker, 1998). Ethylene is perceived by a family of integral membrane receptors that are similar to bacterial two-component histidine kinase receptors and includes ETR1, ERS1, EIN4, ETR2, and ERS2 (Bleecker et al., 1988; Chang et al., 1993; Hua et al., 1995, 1998; Sakai et al., 1998). A Raf-like protein kinase called CTR1 acts downstream of the receptors (Kieber et al., 1993). The receptors and CTR1 actively repress the downstream pathway in the absence of ethylene (Kieber et al., 1993; Hua and Meyerowitz, 1998). The ethylene signal is propagated via a MAPK pathway (Ouaked et al., 2003) to EIN2, which is a membrane protein with homology to Nramp metal-ion transporters (Alonso et al., 1999). The unknown gene products of EIN5, EIN6 and EIN7 also act downstream of CTR1 (Roman et al., 1995). Finally, the signal is transmitted to the EIN3 family of transcription factors. Out of this six-member family, only for EIN3 and EIN3-LIKE1 (EIL1) was a function in the ethylene-signalling pathway demonstrated conclusively (Chao et al., 1997; Alonso et al., 2003). EIN3 has been shown to act as a transcriptional activator and bind to the primary ethylene-response element present in the promoter of the ethylene-responsive ERF1 gene (Chao et al., 1997; Solano et al., 1998).
Ethylene induces different sets of genes in different tissues, and the response also depends on the developmental stage of the tissue (Lincoln and Fischer, 1988; Raghothama et al., 1997; Ruperti et al., 2002; Verlinden et al., 2002). Currently, it is not known how developmental information of the cells is integrated with the ethylene signal to obtain these tissue-specific ethylene responses. One possibility is that the developmental signal acts upstream of the ethylene-signalling pathway and regulates its composition. A potential target for such a regulatory mechanism is represented by EIN3, which is the last component of the primary signalling pathway. Because the EIN3 family members may each act on specific target genes, differential expression of the EIN3 genes could be responsible for the tissue-specific ethylene responses. Although recent silencing experiments suggest redundancy within the tomato (Lycopersicon esculentum) EIN3 family (Tieman et al., 2001), a detailed analysis of gene expression has not been reported so far.
In order to investigate the role of the EIN3 family in the ethylene-signalling pathway in tobacco (Nicotiana tabacum), the family members have been isolated, designated NtEILs, and their expression pattern studied at the organ and cellular levels. Although there are organ-specific ethylene responses in tobacco, all NtEILs were found to be expressed in all organs. In addition, using two ethylene-response marker genes, tissue-specific ethylene responses were identified within the ovary. However, mRNA of all NtEILs was detected in all cells of the ovary. Together, these data suggest that developmental cues that cause the tissue-specific ethylene responses are integrated downstream of the primary ethylene-signalling pathway.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Plant material and treatments
Seeds of Nicotiana tabacum L. cv. Petit Havana SR1 were derived from the Solanaceae germplasm collection of the Botanical garden of the University of Nijmegen, The Netherlands (http://www-bgard.sci.kun.nl). Plants were grown under standard greenhouse conditions with additional lighting. Plant tissues were harvested, frozen in liquid nitrogen and stored at –80 °C. For experiments with ethylene treatments, flowers at stage 9 (according to Koltunow et al., 1990) were harvested, placed in a desiccator with the petioles submerged in water and incubated for 24 h with air or with air containing 1 µl l–1 ethylene. The ethylene concentration was confirmed by gas chromatography at the beginning and at the end of the treatment.
Isolation of NtEIL cDNAs
A tobacco ovary cDNA library was constructed from poly(A)+ RNA purified from ovaries at stage 1 to stage 6. cDNA synthesis and cloning was preformed by using the ZAP Express cDNA synthesis and cloning kit from Stratagene (La Jolla, CA, USA) according to the manufacturer’s instructions.
A partial cDNA was amplified from this cDNA library by PCR, using the following degenerated primers: GTMYARRGCHCAAGAYGG and GMHGTCATYTTVTCCTGY. The resulting fragment was used to screen the same cDNA library under low stringency conditions according to the manufacturer’s instructions. The cDNA clones were sequenced using vector and gene-specific synthetic primers. The 5'-end of the NtEIL1 cDNA was extended with 254 bp by PCR amplification of a 648 bp fragment from the cDNA library, using an upstream primer based on the highly homologous NtEIL2 sequence (GGGAAGTCATCAATTTGAG) and a downstream primer specific for NtEIL1 (GAAGCTCCTGCAAAGTG). To extend the 5'-end of the NtEIL4 cDNA with 110 bp, a 1038 bp fragment was amplified with a primer based on the highly homologous NtEIL3 sequence (GAGGATTTTGGGTATTATCTGG) and an NtEIL4-specific primer (ACCAGCTGAGGACAAGGC). The large overlapping part of the resulting fragments was used to ensure that the fragments belonged to the desired cDNA clone. All five NtEILs were sequenced completely at least twice. The presence of the stop codon in NtEIL3 was confirmed by sequencing a clone obtained independently by RT-PCR. Genbank accession numbers are AY248903 [GenBank] (NtEIL1), AY248904 [GenBank] (NtEIL2), AY248905 [GenBank] (NtEIL3), AY248906 [GenBank] (NtEIL4), and AY248907 [GenBank] (NtEIL5).
Phylogenetic analysis
Protein sequences were aligned using the ClustalW program (version 1.82 at http://www.ebi.ac.uk/clustalw/index.html; Thompson et al., 1994). The Phylip package (version 3.5c at http://bioweb.pasteur.fr/seqanal/phylogeny/phylip-uk.html; Felsenstein, 1989) was used to calculate a distance matrix and to generate a tree using the bio-Neighbor–Joining method (Gascuel, 1997). An unrooted tree was plotted using the drawtree program of the package.
RNA analysis
Total RNAs were extracted using the method of van Eldik et al. (1995). 10 µg of total RNA was separated on a formaldehyde agarose gel and blotted on Hybond-N membrane (Amersham Biosciences, Buckinghamshire, UK). Northern hybridization was carried out according to the instructions for Hybond-N. Washing was done with a 1x SSC buffer at 57 °C. NtEIL probes were prepared from restriction fragments corresponding to bp 2004–2392 of NtEIL1 (EcoRV/ScaI), bp 1987–2277 of NtEIL3 (BglII/MscI) and bp 1907–2241 of NtEIL5 (EcoRI/HindIII).
In situ hybridization studies were performed as described by Cox and Goldberg (1988) with minor modifications. Immediately after ethylene-treatment the ovaries were excised and fixed overnight at 4 °C in 1% glutaraldehyde, 4% paraformaldehyde solution prepared in 0.1 M phosphate buffer (pH 7.0), dehydrated, cleared, and embedded in paraffin. Eight-micrometer-thick sections were hybridized to 33P-labelled antisense RNA probes at a specific activity of 4–5x108 dpm µg–1. Probes were transcribed from a tobacco ACC-oxidase cDNA clone (Weterings et al., 2002), a cloned PCR fragment corresponding to bp 1753–2068 of the tobacco ERS homologue (Terajima et al., 2001) and from clones of the NtEIL fragments described above. Hybridization with sense probes was used to determine the background signal. After hybridization and emulsion development, digital photographs were taken with a CoolSNAP CCD camera (Roper Scientific, USA) using bright-field illumination on a Leitz Orthoplan (LSM, Wetzlar, Germany). The images were enhanced using Adobe Photoshop 5.0 (San Jose, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The tobacco EIN3 family
To identify tobacco EIN3 family members, a PCR-based approach was taken using degenerate oligonucleotides based on the sequence of the four Arabidopsis EIN3 family proteins (Chao et al., 1997). A 570 bp fragment was amplified from a cDNA library made from tobacco ovaries. This fragment was 97% homologous to TEIL, a recently identified tobacco EIN3 family member (Kosugi and Ohashi, 2000) and was used to screen the same tobacco cDNA library under low stringency. The 17 positive clones that resulted from this screening corresponded to five different EIN3-like cDNAs, which were named NtEIL1 (Nicotiana tabacum EIN3-LIKE1; previously TEIL) to NtEIL5. The cDNAs of NtEIL1 and NtEIL4 were extended to obtain full-length clones (see Materials and methods). The sequence identity between the NtEIL cDNAs ranges from 48% to 96%, with NtEIL1/2 and NtEIL3/4 being highly homologous pairs. Analysis of the NtEIL cDNAs revealed that they share predicted amino acid sequence similarity to the Arabidopsis EIN3 protein, with the exception that NtEIL3 has a premature stop codon. Figure 1A shows that the NtEIL proteins possess many of the structural features found in the Arabidopsis EIN3 family. All proteins have an acidic domain at the N-terminus and, with the exception of the shorter NtEIL3 protein, contain five basic domains, a proline-rich region and a C-terminus rich in asparagine. The mono-amino acid repeats of asparagine and glutamine present in the C-terminus of Arabidopsis EIN3 and EIL1, respectively, are absent in the NtEILs. As in AtEIN3, the amino acids between the acidic N-terminus and the basic domain II are predicted to form a coil (Lupas, 1996). To examine the relationship between the EIN3-like proteins from tobacco, tomato and Arabidopsis, a phylogenetic analysis was performed. Figure 1B shows that each branch containing a tomato EIL also contained one or two of the tobacco EILs. Furthermore, all tobacco and tomato proteins proved to be more related to Arabidopsis EIN3 and EIL1 than to the other EILs.
|
Accumulation of NtEIL mRNA in cells with different ethylene responses
Accumulation of NtEIL mRNA in plant organs was determined by northern analysis. Because of the high homology between the cDNAs of NtEIL1 and NtEIL2 (96%) and between the cDNAs of NtEIL3 and NtEIL4 (96%) the probes used in this experiment did not discriminate between these related NtEILs, but they did discriminate between the other NtEILs as confirmed by dot-blot analysis (data not shown). The probes recognized a single fragment of about 2.6 kb. Figure 2A shows that mRNA of the NtEILs was present at almost similar levels in all plant organs examined, although the NtEIL1/2 signal was somewhat higher in root and the NtEIL3/4 and NtEIL5 signals somewhat lower in seeds.
|
To be able to compare the expression of the NtEILs between cells that have different ethylene responses, in situ hybridization analysis of two genes that were known to be ethylene-inducible, the tobacco ERS gene and ACC-oxidase (ACO) gene (Terajima et al., 2001; Rieu et al., 2003), was performed first. Figure 2B shows that after treatment with ethylene, the cells of the vascular bundles and placental epidermis gave a strongly increased ERS and ACO hybridization signal. By contrast, the cells of the ovules showed a strong increase in ERS hybridization signal and only a weak increase in ACO signal and the cells of the carpel wall did not show an effect of ethylene on the hybridization signal for any of the two marker genes. To see if these different responses could be related to expression patterns of specific NtEILs, sections from the same ovaries were hybridized with probes against NtEIL1/2, NtEIL3/4 and NtEIL5. As shown in Fig. 2C, all NtEILs were expressed throughout the ovary, albeit at a low level. The level and pattern of NtEIL expression were not influenced by ethylene-treatment (data not shown). Taken together, these results show that, although different cells within the ovary respond differently to ethylene, the NtEILs do not show differential expression.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Five different NtEIL cDNAs from tobacco that encode deduced proteins with high similarity to the Arabidopsis EIN3 protein have been isolated (Fig. 1A). The highest homology was found between the N-termini, which contain the DNA-binding domain and the dimerization domain (Kosugi and Ohashi, 2000; Solano et al., 1998). When compared with tomato, a closely related solanaceous species, one or two close homologues for each of the three LeEILs were found (Fig. 1B), which is probably due to the amphidiploid nature of tobacco. The fact that the LeEILs are functionally similar to Arabidopsis EIN3 (Tieman et al., 2001) suggests that the NtEILs fulfil the EIN3 function in tobacco. Indeed, it has been shown that over-expression of NtEIL1 in Arabidopsis causes a constitutive triple response phenotype (Kosugi and Ohashi, 2000). The introduction of an early stop codon in the NtEIL3 gene seems to be a very recent event, as the remainder of the open reading frame on the cDNA is still intact and would generate a protein with 96% identity to NtEIL4. So, although partial transcription factors can have a function as negative regulators (for example, CAPRICE; Lee and Schiefelbein, 2002), this is probably not the case for NtEIL3.
From genetic studies in Arabidopsis it is not clear whether the EIN3 family members are functionally redundant or have distinct functions. Recently, analysis of ein3/eil1 double mutants showed that EIN3 and EIL1 are fully responsible for ethylene-signal transmission during the triple-response of seedlings and act redundantly during this process (Alonso et al., 2003). The inability of the remaining family members to compensate for EIN3/EIL1 deficiency may reflect functions in other tissues or during other stages of development or functions other than in ethylene signalling. In tomato, silencing experiments pointed towards functional redundancy within the EIN3 family of this species (Tieman et al., 2001). If tissue-specificity of ethylene responses is regulated at the level of the EIN3 component, the different EIN3 family members need to be expressed or activated in a tissue-specific manner. It has been observed before that different plant organs react differently to ethylene. In addition, it was demonstrated that even within an organ, different tissues can react differently to ethylene, using the ERS and ACO genes as markers for the ethylene response in the tobacco ovary (Fig. 2B). However, it is shown that all NtEILs are expressed in all organs and in all ovary cells (Fig. 2A, C). Therefore, these results imply that the differences in ethylene response are not due to differences in composition of the primary ethylene-signalling pathway at the level of EIN3. Although it should be noted that almost nothing is known about the accumulation and activity of the EIN3 proteins, all data collected so far on ethylene signalling and responses fit in a model in which the primary signalling pathway is similar in all cells, and in which the unique developmental signals and the ethylene signal are integrated downstream of this primary signalling pathway. Combinatorial control of the expression of ethylene-responsive genes such as those from the Ethylene Response Factor (ERF) family (Solano et al., 1998; Fujimoto et al., 2000) may well be the actual point of regulation.
|
Acknowledgements |
|---|
The authors wish to thank Jelle Eygensteyn for assistance with sequencing, the greenhouse personnel for excellent plant material, and Liesbeth Pierson for help with microscopy. This research was funded by grant 805-22-681 of the Netherlands Organization for Scientific Research.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Abeles FB, Morgan PW, Salveit MEJ. 1992. Ethylene in plant biology, 2nd edn. San Diego, USA: Academic Press.
Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR. 1999. EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 284, 2148–2152.
Alonso JM, Stepanova AN, Solano R, Wisman E, Ferrari S, Ausubel FM, Ecker JR. 2003. Five components of the ethylene-response pathway identified in a screen for weak ethylene-insensitive mutants in Arabidopsis. Proceedings of the National Academy of Sciences, USA 100, 2992–2997.
Arabidopsis Genome Initiative. 2000. Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408, 796–815.[CrossRef][Medline]
Bleecker AB, Estelle MA, Somerville C, Kende H. 1988. Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana. Science 241, 1086–1089.
Chang C, Kwok SF, Bleecker AB, Meyerowitz EM. 1993. Arabidopsis ethylene-response gene ETR1: similarity of product to two-component regulators. Science 262, 539–544.
Chao Q, Rothenberg M, Solano R, Roman G, Terzaghi W, Ecker JR. 1997. Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. Cell 89, 1133–1144.[CrossRef][ISI][Medline]
Cox KH, Goldberg RB. 1988. Analysis of plant gene expression. In: Shaw CH, ed. Plant molecular biology: a practical approach. Oxford: IRL Press, 1–34.
Felsenstein J. 1989. PHYLIP–phylogeny inference package (version 3.2). Cladistics 5, 164–166.
Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M. 2000. Arabidopsis ethylene-responsive element binding factors act as transcriptional activators or repressors of GCC box-mediated gene expression. The Plant Cell 12, 393–404.
Gascuel O. 1997. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Molecular Biology and Evolution 14, 685–695.[Abstract]
Hua J, Chang C, Sun Q, Meyerowitz EM. 1995. Ethylene insensitivity conferred by Arabidopsis ERS gene. Science 269, 1712–1714.
Hua J, Meyerowitz EM. 1998. Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell 94, 261–271.[CrossRef][ISI][Medline]
Hua J, Sakai H, Nourizadeh S, Chen QG, Bleecker AB, Ecker JR, Meyerowitz EM. 1998. EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis. The Plant Cell 10, 1321–1332.
Johnson PR, Ecker JR. 1998. The ethylene gas signal transduction pathway: a molecular perspective. Annual Review of Genetics 32, 227–254.[CrossRef][ISI][Medline]
Kende H. 1993. Ethylene biosynthesis. Annual Review of Plant Physiology and Plant Molecular Biology 44, 283–307.[CrossRef][ISI]
Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR. 1993. CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases. Cell 72, 427–441.[CrossRef][ISI][Medline]
Koltunow AM, Truettner J, Cox KH, Wallroth M, Goldberg RB. 1990. Different temporal and spatial gene expression patterns occur during anther development. The Plant Cell 2, 1201–1224.
Kosugi S, Ohashi Y. 2000. Cloning and DNA-binding properties of a tobacco Ethylene-Insensitive3 (EIN3) homolog. Nucleic Acids Research 28, 960–967.
Lee MM, Schiefelbein J. 2002. Cell pattern in the Arabidopsis root epidermis determined by lateral inhibition with feedback. The Plant Cell 14, 611–618.
Lincoln JE, Fischer RL. 1988. Diverse mechanisms for the regulation of ethylene-inducible gene expression. Molecular and General Genetics 212, 71–75.
Lupas A. 1996. Prediction and analysis of coiled-coil structures. Methods in Enzymology 266, 513–525.[ISI][Medline]
Ouaked F, Rozhon W, Lecourieux D, Hirt H. 2003. A MAPK pathway mediates ethylene signaling in plants. EMBO Journal 22, 1282–1288.[CrossRef][ISI][Medline]
Raghothama KG, Maggio A, Narasimhan ML, Kononowicz AK, Wang G, D‘Urzo MP, Hasegawa PM, Bressan RA. 1997. Tissue-specific activation of the osmotin gene by ABA, C2H4 and NaCl involves the same promoter region. Plant Molecular Biology 34, 393–402.[CrossRef][ISI][Medline]
Rieu I, Wolters-Arts M, Derksen J, Mariani C, Weterings K. 2003. Ethylene regulates timing of anther dehiscence in tobacco. Planta 217, 131–137.[ISI][Medline]
Roman G, Lubarsky B, Kieber JJ, Rothenberg M, Ecker JR. 1995. Genetic analysis of ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress response pathway. Genetics 139, 1393–1409.[Abstract]
Ruperti B, Cattivelli L, Pagni S, Ramina A. 2002. Ethylene-responsive genes are differentially regulated during abscission, organ senescence and wounding in peach (Prunus persica). Journal of Experimental Botany 53, 429–437.
Sakai H, Hua J, Qhg C, Cr C, Lj M, Ab B, Em M. 1998. ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis. Proceedings of the National Academy of Sciences, USA 95, 5812–5817.
Solano R, Stepanova A, Chao QM, Ecker JR. 1998. Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1. Genes and Development 12, 3703–3714.
Terajima Y, Nukui H, Kobayashi A, Fujimoto S, Hase S, Yoshioka T, Hashiba T, Satoh S. 2001. Molecular cloning and characterization of a cDNA for a novel ethylene receptor, NT-ERS1, of tobacco (Nicotiana tabacum L.). Plant Cell Physiology 42, 308–313.
Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680.
Tieman DM, Ciardi JA, Taylor MG, Klee HJ. 2001. Members of the tomato LeEIL (EIN3-like) gene family are functionally redundant and regulate ethylene responses throughout plant development. The Plant Journal 26, 47–58.[CrossRef][ISI][Medline]
van Eldik GJ, Vriezen WH, Wingens M, Ruiter RK, Van Herpen MMA, Schrauwen JAM, Wullems GJ. 1995. A pistil-specific gene of Solanum tuberosum is predominantly expressed in the stylar cortex. Sexual Plant Reproduction 8, 173–179.
Verlinden S, Boatright J, Woodson WR. 2002. Changes in ethylene responsiveness of senescence-related genes during carnation flower development. Physiologia Plantarum 116, 503–511.
Weterings K, Pezzotti M, Cornelissen M, Mariani C. 2002. Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles. Plant Physiology 130, 1190–1200.
Yang SF, Hoffman NE. 1984. Ethylene biosynthesis and its regulation in higher plants. Annual Review of Plant Physiology 88, 553–558.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  X.-r. Yin, K.-s. Chen, A. C. Allan, R.-m. Wu, B. Zhang, N. Lallu, and I. B. Ferguson Ethylene-induced modulation of genes associated with the ethylene signalling pathway in ripening kiwifruit J. Exp. Bot., May 1, 2008; 59(8): 2097 - 2108. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Hibi, S. Kosugi, T. Iwai, M. Kawata, S. Seo, I. Mitsuhara, and Y. Ohashi Involvement of EIN3 homologues in basic PR gene expression and flower development in tobacco plants J. Exp. Bot., October 26, 2007; (2007) erm216v1. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Ma, H. Tan, X. Liu, J. Xue, Y. Li, and J. Gao Transcriptional regulation of ethylene receptor and CTR genes involved in ethylene-induced flower opening in cut rose (Rosa hybrida) cv. Samantha J. Exp. Bot., August 1, 2006; 57(11): 2763 - 2773. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Iordachescu and S. Verlinden Transcriptional regulation of three EIN3-like genes of carnation (Dianthus caryophyllus L. cv. Improved White Sim) during flower development and upon wounding, pollination, and ethylene exposure J. Exp. Bot., August 1, 2005; 56(418): 2011 - 2018. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-F. CHEN, N. ETHERIDGE, and G. E. SCHALLER Ethylene Signal Transduction Ann. Bot., May 1, 2005; 95(6): 901 - 915. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. N. Stepanova and J. M. Alonso Ethylene Signaling Pathway Sci. Signal., March 22, 2005; 2005(276): cm3 - cm3. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||