Skip Navigation


JXB Advance Access originally published online on November 17, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
55/395/151    most recent
erh004v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Saedler, R.
Right arrow Articles by Baldwin, I. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saedler, R.
Right arrow Articles by Baldwin, I. T.
Agricola
Right arrow Articles by Saedler, R.
Right arrow Articles by Baldwin, I. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of Experimental Botany, Vol. 55, No. 395, pp. 151-157, January 1, 2004
© 2004 Oxford University Press


Crosstalk: An Ecological Perspective

Virus-induced gene silencing of jasmonate-induced direct defences, nicotine and trypsin proteinase-inhibitors in Nicotiana attenuata

Received 28 March 2003; Accepted 11 July 2003

Rainer Saedler* and Ian T. Baldwin{dagger}

Max-Planck-Institut für Chemische Ökologie, Hans-Knöll-Str. 8, 07745 Jena, Germany

* Present address: University of Köln, Botanical Institute III, Gyrhof Strasse 15, D-50829 Cologne, Germany.
{dagger} To whom correspondence should be addressed. Fax: +49 3641 571102. E-mail: Baldwin{at}ice.mpg.de
Abbreviations: MeJA, jasmonic acid methyl ester; VIGS, virus-induced gene silencing; TI, trypsin inhibitor; TRV, tobacco rattle virus; PMT, putrescine N-methyltransferase.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Research into the molecular basis of plant–insect interactions is hampered by the inability to alter the expression of individual genes in plants growing under natural conditions. The ability of virus-induced gene silencing (VIGS) to silence the expression of two jasmonate-induced genes known to mediate the expression of two potent direct defences (nicotine and proteinase inhibitors) that are produced in different tissues (roots and shoots, respectively) in Nicotiana attenuata is documented here. Fragments of consensus sequences of N. attenuata’s putrescine N-methyltransferase (PMT) and trypsin inhibitor (TI) genes were cloned in sense, anti-sense and inverted repeat orientations into the Tobacco Rattle Virus (TRV) to trigger post-transcriptional gene silencing by Agrobacterium-mediated inoculation in plants previously elicited with methyl jasmonate (MeJA) or left as controls. MeJA treatment elicited 2.4- and 9.8-fold increases in the concentrations of nicotine and proteinase inhibitors, respectively, and inoculation with constructs containing appropriate genes inhibited these MeJA-induced increases and halved constitutive accumulations, regardless of the orientation of the gene fragment. Root PMT transcript levels were significantly elevated in MeJA-treated plants 10 h after elicitation, but not in plants inoculated with the appropriate TRV constructs 9 d prior to MeJA treatment, demonstrating that VIGS was responsible for the inhibition of these potent direct defences. While additional research is required to minimize the effects on plant growth and the risks of using such constructs in natural settings, it is concluded that VIGS has a potential to manipulate the expression of genes important for ecological interactions.

Key words: Direct defences, nicotine, proteinase inhibitors, Tobacco Rattle Virus, virus-induced gene silencing.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Plants defend themselves from herbivore attack by producing chemicals that directly function as defences because they slow the growth of herbivores (anti-nutritive or anti-digestive compounds) or are poisonous (toxins), as well as compounds (volatile signals or nectar rewards) that indirectly function as defences by making herbivores more apparent to their own predators (Kessler and Baldwin, 2002). These direct and indirect defences can be deployed in concert so that herbivore growth is slowed while increasing the probability that a herbivore is attacked by a predator before it can cause extensive damage. Plant–herbivore interactions are therefore played out on an arena larger than the plant itself and frequently involve components of the plant’s ecological community. This large spatial scale makes the task of rigorously demonstrating the defensive function of specific traits onerous because the traits must be manipulated in complex environments that include the environmental components that determine the defensive function of the trait.

Two molecular biological techniques allow scientists to alter the expression of genes thought to mediate ecological interactions (predation, parasitism, mutualism, competition, etc): stable genetic transformation (Azpiroz-Leehan and Feldmann, 1997), and transient post-transcriptional gene silencing (PTGS: Hamilton and Baulcombe, 1999). These two techniques differ in the ease with which they can be used in the analysis of ecological interactions. While stable transformation offers many advantages regarding phenotype stability, the procedure requires that transformed plants be transplanted into environments in which a particular interaction occurs. PTGS, which like ‘quelling’ in Neurospora and ‘RNA interference’ in Caenorhabditis elegans is based on the homology-dependent degradation of mRNA in the cytoplasm to effect transient silencing of a particular gene (Romano and Macino, 1992; Cogoni et al., 1996; Fire et al., 1998), offers the potential of manipulating gene expression in plants growing in their natural environment with their full complement of ecological interactions. Moreover, because PTGS can be activated in fully-developed plants, an analysis of the expression of genes that function in plant development is also possible.

A powerful means of eliciting PTGS in plants is with viruses harbouring parts of plant genes to elicit virus-induced gene silencing (VIGS: Ruiz et al., 1998). While VIGS has been successfully used to manipulate the expression of genes mediating pathogen resistance at the scale of an individual leaf (Rommens et al., 1995), its utility for the analysis of genes involved in plant–herbivore interactions will depend on its ability to silence genes on a whole-plant (WP) spatial scale. Due to the physiological independence of herbivores from their host plants, plants respond to herbivore attack with defence responses that decrease herbivore performance, not only in the attacked tissues but also systemically in plant parts of high fitness value to which the herbivore might relocate. Moreover, plants attract predators to the attacking herbivores with systemically-released volatile signals and hence the relevant spatial scale for most plant–herbivore interactions is minimally whole-plant and frequently extends beyond the plant to include components of a plant’s community (Kessler and Baldwin, 2002). The ability of VIGS to silence the expression of genes that are known to mediate the expression of potent direct defences that function on a WP level in protecting plants against herbivore attack is examined here.

Nicotiana attenuata Torr. Ex Watts. (Solanaceae) (Baldwin, 2001) is a native tobacco species, which is attacked by more than 20 different taxa of herbivore species in its natural habitat, the Great Basin Desert of south-west USA. In response to attack from many of these species, the plant systemically increases the production of two direct defences: proteinase inhibitors (Glawe et al., 2003; van Dam et al., 2001) and nicotine (Baldwin, 2001). Nicotine binds to acetylcholine receptors, interferes with the signal transmission in acetylcholine-based nervous systems and can slow the growth of nicotine-adapted herbivores (due to the metabolic demands of detoxification) or kill unadapted herbivores (references in Voelckel et al., 2001). Trypsin inhibitors (TIs) target a major proteolytic digestive enzyme family of herbivores and herbivores grow faster on natural mutants lacking the ability to produce TIs (Glawe et al., 2003). Both of these direct defences are herbivore-, wound- and jasmonate-induced and both are likely to be under transcriptional control since alterations in Nati (coding for N. attenuata trypsin inhibitor) and Napmt (coding for N. attenuata putrescine N-methyl transferase) transcripts are known to result in corresponding alterations in nicotine and TI activity (Winz and Baldwin, 2001; Glawe et al., 2003). However, these two genes are expressed in different tissues (root: Napmt and shoot: Nati) and hence are ideal candidates with which to examine the utility of VIGS in the analysis of plant–herbivore interactions. For this study, constructs were used based on the Tobacco Rattle Virus (TRV; Ratcliff et al., 2001), which belongs to the Tobraviruses and has a bipartite single-stranded sense RNA genome. RNA1 of TRV is integrated in a plasmid called pTV00 in which fragments of plant genes can be cloned. RNA2 is located on pBINTRA, and both plasmids are co-inoculated via Agrobacterium into plants.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
TRV-vector construction
PCR was used to generate a 160 bp fragment of the phytoene desaturase (pds) gene from Nicotiana benthamiana in sense (S) orientation (with respect to the pds promoter) with the primer pair (listed from 5' to 3'): GCGGCGATCGATGCCGATTGTGGAAC ATATTG and GCGGCGGTCGACTGGCCTGTTGGGCCCACTG GAGTGGCAAACAC and in anti-sense (AS) orientation with the primer pair, GCGGCGGTCGACATGCCGATTGTGGAACATA TTG and GCGGCGGGCCTAACAGGCCCACTGGAGTGGCAA ACAC. For the construction of an inverted repeat vector (IRI), these fragments were cloned into pTV00 (AS: GCAATTGGACTCTT GCCAGCAATGC; GGGCAATCTTATGTTGAAGCTC) and separated by a 196 bp intron (GCGGCGTCTAGAGGGCCCAGG GTAAATTTCTAGTTTTTCTCC; GCGGCGGGCCTAACAGGC CGGTTCTGTAACTATCATCATC) originating from the Ricinus communis catalase gene, which was known to be spliced in N. attenuata (K Gase and IT Baldwin, unpublished results). This construct was used to optimize the inoculation conditions for VIGS in N. attenuata.

PMT and TI vectors were constructed with endogenous gene sequences from N. attenuata. A 675 bp PCR fragment of the pmt gene was cloned into pTV00 by using BamHI and HindIII cloning sites to produce S (GCGGCGGGATCCGCCTGGTTGGTTTTC AGAG; GCGGCGAAGCTTGTTGGAACAGTAGTCCAAGC) and AS (GCGGCGAAGCTTGCCTGGTTGGTTTTCAGAG; GCGG CGGGATCCGTTGGAACAGTAGTCCAAGC) constructs. To produce the IRI construct, the HindIII site of the S construct was used to clone the 196 bp PCR (GCGGCGAAGCTTAGGGTAAATT TCTAGTTTTTCTCC; GCGGCGGTCGACGGTTCTGTAACTA TCATCATC) fragment of the catalase intron, followed by the cloning of the AS (GCGGCGGTCGACGTTGGAACAGTAGTCC AAGC; CCCCCCGGTACCGCCTGGTTGGTTTTCAGAG) construct into SalI and KpnI sites to complete the construct. A 174 bp PCR fragment of the repeat region of the N. attenuata ti gene, was used to create an S (GCAATTGGACTCTTGCCAGCAATGC; GGGCAATCTTATGTTGAAGCTC) and an AS (GGGATAAG TGTTAAGGACTGGATG; GGAATCTCTTTCCAGTCTTCAGG) constructs with the BamHI and HindIII cloning sites of pTV00. The IRI construct was created as previously described (Intron: GCGGCGAAGCTTAGGGTAAATTTCTAGTTTTTCTCC; GCG GCGGTCGACGGTTCTGTAACTATCATCATC; AS: GCGGCG GGTACCAAGGCTTGTCCTCGGAATTGTG; GCGGCGGTCG ACTGGATTTCTAGGATCAGACTCTCC). Graphical representations of the constructs are shown in Fig. 1. The pTV00 vector is a 5.5 kb plasmid with an origin of replication for E. coli and A. tumefaciens and a gene for kanamycin resistance (Ratcliff et al., 2001).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1. Design of the various TRV-based silencing vectors (derived from pTV00 described in Ratcliff et al., 2001) used in this study. Left and right borders indicate the region which is thought to be integrated into the plant genome, and contains a promoter (Pcamp), the virus coat protein, the N. attenuata gene fragments in sense (S), anti-sense (AS) or inverted-repeat-with-intron (IRI) orientations (with respect to the genes’ endogenous promoters), and a terminator (TNos). The Nicotiana attenuata pmt and ti gene fragments used were 675 and 174 bp long, respectively.

 
Plasmid inserts were sequenced on a ABI Prism 310 DNA sequencer with the Big Dye terminator kit (PE-Applied Biosystems, Weiterstadt, Germany), and analysed with the Lasergene software package (DNASTAR, Madison WI). Agrobacterium tumefaciens cells, strain GV3101, were transformed with all plasmids by electroporation (1.8 kV for 4.9–5.6 ms in a Biorad MicroPulser) and maintained on LB media containing glycerol.

Plant growth, inoculations and analysis
N. attenuata seeds from eleventh and twelfth greenhouse-grown generation of a collection originating from Utah (Baldwin, 1998) were germinated in smoke-treated (Baldwin et al., 1994a) soil. Plants slated for the VIGS of nicotine production were grown hydroponically as described in Ohnmeiss and Baldwin (1994) in order to facilitate the harvesting of the nicotine-producing roots, while those slated for the VIGS of TI production were grown in soil. All plants were grown under a 32/27 °C 16/8 h light/dark regime until they were 3–4-weeks-old and in the rosette-stage of growth. Growth conditions at the start of the experiments were 22/22 °C 16/8 h light/dark at 65% relative humidity and approximately 100 µmol m–2 s–1 for 2 d after inoculation, after which light levels were returned to normal high light levels (400–1000 µmol m–2 s–1).

Inoculations of the plants were performed as described in Ratcliff et al. (2001), with the modification that Agrobacterium cells were immediately used after re-suspension and that plants were inoculated with Agrobacterium cells transformed with pBINTRA and one of the pmt- or ti-containing constructs (Fig. 1) in a 1:1 ratio. Inoculations were performed on fully-expanded node-2 and/or node-3 leaves with the youngest fully-expanded leaf defining node 1. For each experiment, a set of 100 plants were used: 20 plants remained uninoculated, 20 plants were inoculated with the empty virus vector (EV) construct and 20 plants were separately inoculated with each of the different silencing constructs. Nine days after inoculation, 10 plants of each group were elicited with 250 µg jasmonic acid methyl ester (MeJA) per plant. For nicotine measurements, whole plants (WP: roots and shoots) were harvested 5 d after MeJA-elicitation. Plant material was freeze-dried, pulverized and analysed for WP nicotine content by HPLC as described in Keinänen et al. (2001). Shoots from the TI experiment were harvested 4 d after MeJA elicitation and PI activity was determined as described in van Dam et al. (2001). Nicotine concentrations were also determined in the shoot extracts. To determine the effects of VIGS on mRNA levels in the nicotine experiment, northern blot analysis using a 339 bp cDNA probe from the 3' end of pmt was conducted on mRNA harvested from roots 10 h after MeJA elicitation, the time of maximum elicitation of pmt transcripts (Winz and Baldwin, 2001).


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Silencing of phytoene desaturase (Fray and Grierson, 1993), a gene which oxidizes and cyclizes phytoene to {alpha}- and ß-carotene, which are subsequently converted into xanthophylls of the antenna pigments of the photosystems of plants, results in visible bleaching of green tissues and hence is an ideal phenotype with which to monitor the progress of VIGS. Inoculation of Nicotiana attenuata with PVX-based vectors (Chapman et al., 1992) harbouring a fragment of N. benthamiana pds inconsistently produced bleaching that was limited to tissues located between major veins in the lamina of inoculated leaves (R Saedler and IT Baldwin, unpublished results). By contrast, inoculation with the TRV-based constructs containing a pds fragment with an IRI orientation (pTVPDS5) resulted in extensive bleaching that covered all parts of a leaf’s lamina and spread systemically toward younger tissues from the inoculated leaf. The ratios of pBINTRA and pTVPDS5, the time of incubation of transformed Agrobacterium cells in the acetosyringone (150 µM)-containing resuspension buffer, as well as the plant growth conditions were systematically varied and it was found that only the latter had significant effects on the bleaching response. When plants were grown at low temperatures (22 °C) and low light after inoculation, the frequency and extent of the bleaching dramatically increased and these growing conditions were used for the experiments in which the two direct defences were silenced. Much is known about the mechanisms involved in the activation of these direct defences that are relevant to the interpretation of the data presented here.

Nicotine is a potent inducible defence of N. attenuata and a secondary metabolite ideally suited for a stringent test of the ability of VIGS to silence an ecologically relevant trait on a whole-plant (WP) basis. Nicotine biosynthesis is sequestered in root tissues, but this water-soluble alkaloid accumulates in all plant parts, largely due to transport from the roots in the xylem stream, with subsequent redistribution among above-ground parts probably via movement in the phloem (reviewed in Baldwin, 2001). Herbivore attack or wounding to shoot tissues increases the accumulation of transcripts in the roots for the enzyme catalysing the rate-limiting step in nicotine biosynthesis, the methylation of putrescine by putrescine N-methyl transferase (PMT) (Winz and Baldwin, 2001) and dramatically increases nicotine biosynthesis and WP accumulation (Baldwin et al., 1994a, 1997). A jasmonate-mediated signal is transported from the wounded leaves to the roots and is responsible for eliciting this WP response (Baldwin et al., 1994a, 1997; Zhang and Baldwin, 1997). Evidence for the importance of pmt transcripts in inducible nicotine production comes from studies demonstrating strong positive correlations among the amount of wounding, the transient accumulation of JA in shoots (peaking at 45 min) and of pmt transcripts in roots (at 10 h), and the long-lasting accumulation of nicotine in the entire plant (peaking at 5 d) (Baldwin et al., 1994a, 1997; Winz and Baldwin, 2001). Moreover, stable anti-sense expression of pmt dramatically decreases pmt transcript accumulation in roots and WP nicotine pools in N. sylvestris, even after MeJA elicitation (Voelckel et al., 2001). Hence the inhibition of induced increases in nicotine accumulation can result from either inhibition of nicotine biosynthesis or the signalling mechanisms that activate it. Inoculation with viruses is known to elicit salicylic acid (SA) accumulation, which in turn is known to inhibit jasmonate signalling. For example, tobacco mosaic virus (TMV) infection of N. sylvestris inhibits jasmonate-induced nicotine increases, likely through signal-cross talk mediated by the SA elicited by TMV infection (Preston et al., 1999).

To determine if VIGS could silence pmt expression without the potential confounding effects of Agrobacterium or TRV inoculation on wound-induced signalling, shoot-to-root signalling was short-circuited and the roots of hydroponically-grown plants were elicited with MeJA and pmt transcript accumulation was measured (at 10 h) in the roots and WP nicotine accumulation after 5 d. N. attenuata contains two pmt genes (Winz and Baldwin, 2001) and a 675 bp fragment from a consensus region of NaPMT1and 2 was introduced into TRV constructs in S, AS and IRI orientations (Fig. 1). PMT transcripts (1.6 kb) in the roots of three replicate MeJA-elicited plants increased dramatically in both uninoculated and EV-inoculated plants 10 h after elicitation (Fig. 2B). This increase in transcript accumulation was largely abolished in all plants inoculated with pmt-containing constructs regardless of orientation of the gene fragment. In particular, the three replicate plants inoculated with pmt in an AS orientation contained no detectable 1.6 kb signal even after MeJA elicitation (Fig. 2B). The accumulation of pmt transcripts is known to be variable in unelicited plants and the signals observed in individual replicates (Fig. 1B) are consistent with background expression levels (Winz and Baldwin, 2001). Since plants were inoculated with the TRV-based vectors in the leaves, yet silencing was observed in a root-expressed gene, some component of the TRV-based construct could have been transported to the roots. To test this hypothesis, the RNA gel blots presented in Fig. 2B were stripped and rehybridized with a TRV coat protein probe and strong signals were found in all inoculated plants (data not shown), suggesting that components of the recombinant TRV-constructs had been transported to the roots during the silencing process.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2. (A) Whole-plant nicotine quantities (mean ±SE) of hydroponically-grown Nicotiana attenuata plants 5 d after elicitation with 250 µg methyl jasmonate (MeJA: solid bars) applied to the hydroponic solution or left unelicited (open bars) in plants that were either uninoculated (C), or inoculated with Agrobacterium harbouring TRV constructs containing a an empty vector (EV), or a 675 bp N. attenuata pmt fragment in either sense (S), anti-sense (AS) or inverted-repeat-with-intron (IRI) orientations (see Fig. 1) 9 d prior to elicitation. Inset: whole-plant dry mass (mean ±SE) at time of harvest for nicotine analysis. Ten replicate plants were analysed for each elicitation and inoculation treatments. (B). Northern blot analysis of pmt transcript accumulation in root material 10 h after elicitation in three replicate plants from all treatments listed in (A). Ethidium bromide stain of 18S rRNA served as a loading control.

 
The silencing of pmt transcript accumulation had dramatic effects on nicotine accumulation patterns, from which effects on nicotine production can be inferred, an inference that requires discussion. Nicotine is produced in the roots, accumulates in plant parts at concentrations correlated with the fitness value of the plant part to the entire plant (Baldwin and Karb, 1995; Ohnmeiss and Baldwin, 2000) and is largely unmetabolized, with only a small percentage of the WP pool being demethylated to produce nornicotine and subsequently deprotonated to anatabine, even when growth is limited by nitrogen availability (Baldwin et al., 1994b). The WP pools of nicotine increase as an allometric function of WP biomass as plants grow and these allometric relationships are not isometric (Ohnmeiss and Baldwin, 1994), hence induced increases in nicotine production can not be directly inferred from changes in the concentrations of plants that are not of the same biomass. MeJA elicitation increases nicotine production and accumulation to a new allometrically determined setpoint (defined by the regression of the WP nicotine pool against the WP nicotine-free biomass), which is maintained until subsequent elicitations (Baldwin and Schmelz, 1996). Hence, by measuring changes in WP pools of nicotine, changes in nicotine production during plant growth can be inferred.

MeJA elicitation increased WP nicotine pools in control and EV plants (Fig. 2A) but also significantly (P <0.05) decreased WP plant biomass (Fig. 2A inset). Inoculation with the variously transformed Agrobacterium constructs decreased plant growth still further (Fig. 2A, inset). The MeJA-elicited increase in WP nicotine pools in EV-inoculated plants, while highly significant (P <0.0001), was smaller than that observed in control plants (Fig. 2A). Elicitation of control plants increased WP nicotine pools 1.38-fold (from 24.2 mg to 57.6 mg) while the elicitation-induced increase in plants inoculated with EV constructs was 0.63-fold (from 21.9 mg to 35.7 mg; Fig. 2A). Approximately half of the decrease in the induced response could be attributed to decreases in the allometrically determined setpoint due to decreased plant growth. By contrast, MeJA-elicited increases were completely abolished in all plants inoculated with pmt-containing constructs, regardless of the orientation of the gene fragment (Fig. 2A). Moreover, constitutive WP nicotine pools in these plants was reduced by 8–13 mg, approximately half of the amount found in unelicited plants inoculated with EV constructs (Fig. 2A), consistent with the amount of nicotine that would have been produced and accumulated during growth that occurred after inoculation and before harvest. From the halving of constitutive nicotine pools in unelicited plants as compared with uninoculated controls, it can be inferred that VIGS decreased transcript accumulation and nicotine production soon after inoculation and well before MeJA elicitation, thereby truncating the normal allometically-determined constitutive nicotine accumulation rates in the 9 d before elicitation. Collectively, these results demonstrate VIGS of jasmonate-elicited nicotine production.

As an additional direct defence, N. attenuata produces large quantities of trypsin inhibitors (TIs) systemically after MeJA elicitation and caterpillar attack. These induced increases are associated with increases in transcripts coding for a multi-domain trypsin inhibitor (van Dam et al., 2001; Glawe et al., 2003). The TIs are targeted to the central vacuole and, compared with nicotine, rapidly metabolized, and hence are quantified by activity mg–1 protein. VIGS was also effective in silencing shoot-produced TI activity (Fig. 3) as well as inhibiting the accumulation of TI transcripts in leaves after elicitation (data not shown). Inoculation with EV significantly (P <0.05) increased TI activity of unelicited plants (from 0.4 to 1.2 nmol mg–1, an increase of 0.8 nmol mg–1) but unlike its influence on nicotine production, enhanced the increase of TI activity after MeJA treatment. Elicitation with MeJA increased TI activity in uninoculated plants by 3.5 nmol mg–1 (from 0.4 to 3.9 nmol mg–1; Fig. 3), while in plants inoculation with EV-constructs, TI activity increased by 4.5 nmol mg–1 (from 1.2 to 5.7 nmol mg–1). Inoculation with ti-containing constructs dramatically reduced TI activity in MeJA-elicited plants to levels that were equal to or less than those of unelicited EV-inoculated plants (S, 1.2; AS, 0.6; IRI, 0.9 nmol mg–1; Fig. 3). TI activity of unelicited but silenced plants was lower than that of unelicited EV-inoculated plants.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. Mean (±SE) TI concentrations of soil-grown Nicotiana attenuata plants 4 d after elicitation with methyl jasmonate (MeJA: solid bars) applied in a lanolin paste to two leaf positions or left unelicited (open bars) in plants that were either uninnoculated (C), or inoculated with Agrobacterium harbouring TRV constructs containing an empty vector (EV), or a 174 bp N. attenuata ti fragment in either sense (S), anti-sense (AS) or inverted-repeat-with-intron (IRI) orientations 9 d prior to elicitation. Inset: whole-shoot nicotine quantities (mean ±SE) of the plants at the time of the harvest for TI determinations. Ten replicate plants were analysed for each elicitation and inoculation treatments.

 
The silencing of the TI activity occurred without significantly (all P >0.5) influencing MeJA-elicited nicotine production (Fig. 3, Inset), demonstrating that ti and pmt could be silenced independently. Since both of these direct defences are jasmonate-elicited (Baldwin, 2001; van Dam et al., 2001), require a lypoxygenase (LOX)-derived signal for their activation, and are inhibited in transformed plants with the endogenous LOX expressed in an antisense orientation (R Halitschke, IT Baldwin, unpublished data), their independent silencing is consistent with the silencing of genes (ti and pmt) involved in their biosynthesis, rather than interference with some aspect of their signalling.

These results demonstrate that TRV-based constructs (Ratcliff et al., 2001) can effectively silence two jasmonate-elicited direct defences of N. attenuata: the root-produced nicotine as well as shoot-produced TI activity. These results also suggest that VIGS could be an effective tool for ecological analyses. Two considerations require additional research before the procedure can be adopted. First, inoculation with TRV-based constructs clearly reduced plant growth independently of their ability to elicit VIGS. The decrease in plant-growth would hamper a phytocentric analysis of ecological function, in which plant fitness was used as a measure of plant performance. Whether this decrease in growth is a result of the Agrobacterium, or some attribute of the TRV-based vector remains to be explored. Moreover, the growth conditions that were required for VIGS may be difficult to realize under natural conditions and additional research will be required to identify strains of Agrobacterium that can elicit VIGS under the range of light and temperature conditions found in nature. Second, the potential risks of increasing the host range of TRV by Agrobacterium-mediated inoculation, as well as the risks of transferring new genetic elements into wild-type TRV need to be thoroughly explored before these particular constructs could be used in natural settings.


    Acknowledgements
 
We thank D Baulcombe of the Sainsbury laboratory for the gift of pTV00 and pBINTRA, Dr Klaus Gase for valuable support and advice in all aspects of the project, the Max-Planck-Gesellschaft for financial support, and two anonymous reviewers for substantially improving an earlier version of the manuscript.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Azpiroz-Leehan R, Feldmann KA. 1997. T-DNA insertion mutagenesis in Arabidopsis—going back and forth. Trends in Genetics 13, 152–156.[CrossRef][Web of Science][Medline]

Baldwin IT. 1998. Jasmonate-induced responses are costly but benefit plants under attack in native populations. Proceedings of the National Academy of Sciences, USA 95, 8113–8118.[Abstract/Free Full Text]

Baldwin IT. 2001. An ecologically motivated analysis of plant–herbivore interactions in native tobacco. Plant Physiology 127, 1449–1458.[Free Full Text]

Baldwin IT, Karb, MJ. 1995. Plasticity in the allocation of nicotine to reproductive parts in Nicotiana attenuata. Journal of Chemical Ecology 21, 897–909.[CrossRef]

Baldwin IT, Schmelz E. 1996. Immunological ‘memory’ in the induced accumulation of nicotine in wild tobacco. Ecology 77, 236–246.[CrossRef]

Baldwin IT, Schmelz EA, Ohnmeiss TE. 1994a. Wound-induced changes in root and shoot jasmonic acid pools correlate with induced nicotine synthesis in Nicotiana sylvestris. Journal of Chemical Ecology 20, 2139–2157.[CrossRef]

Baldwin IT, Schmelz EA, Ohnmeiss TE. 1994b. Swords into plowshares? Nicotiana sylvestris does not use nicotine as a nitrogen source under nitrogen-limited growth. Oecologia 98, 385–392.[CrossRef]

Baldwin IT, Zhang ZP, Diab N, Ohnmeiss TE, McCloud ES, Lynds GY, Schmelz EA. 1997. Quantification, correlations and manipulations of wound-induced changes in jasmonic acid and nicotine in Nicotiana sylvestris. Planta 201, 397–404.[CrossRef]

Chapman SN, Kavanagh TA, Baulcombe DC. 1992. Potato virus X as a vector for gene expression in plants. The Plant Journal 2, 549–557.[Web of Science][Medline]

Cogoni C, Ireland T, Schumacher M, Schmidhauser TJ, Selker EU, Macino G. 1996. Transgene silencing of the al-1 gene in vegetative cells of Neurospora is mediated by a cytoplasmic effector and does not depend on DNA: DNA interactions or DNA methylation. EMBO Journal 15, 3153–3163.[Web of Science][Medline]

Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabitis elegans. Nature 391, 806–811.[CrossRef][Medline]

Fray RG, Grierson D. 1993. Identification and genetic analysis of normal and mutant phytoene synthase genes of tomato by sequencing, complementation, and co-suppression. Plant Molecular Biology 22, 589–602.[CrossRef][Web of Science][Medline]

Glawe G, Zavala J, Kessler A, van Dam NM, Baldwin IT. 2003. Ecological costs and benefits with trypsin protease inhibitor production in Nicotiana attenuata. Ecology 84, 79–90.[Web of Science]

Hamilton AJ, Baulcombe DC. 1999. A species of small antisense RNA in post-transcriptional gene silencing in plants. Science 286, 950–952.[Abstract/Free Full Text]

Keinänen M, Oldham NJ, Baldwin IT. 2001. Rapid HPLC screening of jasmonate-induced increases in tobacco alkaloids, phenolics, and diterpene glycosides in Nicotiana attenuata. Journal of Agricultural and Food Chemistry 49, 3553–3558.[CrossRef][Web of Science][Medline]

Kessler A, Baldwin IT. 2002. Plant responses to insect herbivory: the emerging molecular analysis. Annual Review of Plant Biology 53, 299–328.[CrossRef][Medline]

Ohnmeiss TE, Baldwin IT. 1994. The allometry of nitrogen allocation to growth and an inducible defence under nitrogen-limited growth. Ecology 75, 995–1002.[CrossRef]

Ohnmeiss TE, Baldwin IT. 2000. Optimal defence theory predicts the ontogeny of an induced nicotine defence. Ecology 81, 1765–1783.[CrossRef]

Preston CA, Lewandowski C, Enyedi AJ, Baldwin IT. 1999. Tobacco mosaic virus inoculation inhibits wound-induced jasmonic acid-mediated responses within but not between plants. Planta 209, 87–95[CrossRef][Web of Science][Medline]

Ratcliff F, Martin-Hernandez A, Baulcombe DC. 2001. Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal 25, 237–245.[CrossRef][Web of Science][Medline]

Romano N, Macino G. 1992. Quelling: transient inactivation of gene expression in Neurospora crassa by transformation with homologous sequences. Molecular Microbiology 6, 3343–3353.[Web of Science][Medline]

Rommens CMT, Salmeron JM, Baulcombe DC, Staskawicz BJ. 1995. Use of a gene expression system based on potato virus X to rapidly identify and characterize a tomato pto homolog that controls fenthion sensitivity. The Plant Cell 7, 249–257.[Abstract]

Ruiz MT, Voinnet O, Baulcombe DC. 1998. Initiation and maintenance of virus-induced gene silencing. The Plant Cell 10, 937–946.[Medline]

van Dam NM, Horn M, Mares M, Baldwin IT. 2001. Ontogeny constrains systemic protease inhibitor response in Nicotiana attenuata. Journal of Chemical Ecology 27, 547–568.[CrossRef][Web of Science][Medline]

Voelckel C, Krügel T, Gase K, Heidrich N, van Dam NM, Winz R, Baldwin IT. 2001. Anti-sense expression of putrescine N-methyltransferase confirms defensive role of nicotine in Nicotiana sylvestris against Manduca sexta. Chemoecology 11, 121–126.[CrossRef]

Winz RA, Baldwin IT. 2001. Molecular interactions between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural host Nicotiana attenuata. IV. Insect-induced ethylene reduces jasmonate-induced nicotine accumulation by regulating putrescine N-methyltransferase transcripts. Plant Physiology 125, 2189–2202.[Abstract/Free Full Text]

Zhang Z-P, Baldwin IT. 1997. Transport of [2-14C]jasmonic acid from leaves to roots mimics wound-induced changes in endogenous pools in Nicotiana sylvestris. Planta 203, 436–441.[CrossRef]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Plant Physiol.Home page
A. R. Jassbi, K. Gase, C. Hettenhausen, A. Schmidt, and I. T. Baldwin
Silencing Geranylgeranyl Diphosphate Synthase in Nicotiana attenuata Dramatically Impairs Resistance to Tobacco Hornworm
Plant Physiology, March 1, 2008; 146(3): 974 - 986.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
S. Wege, A. Scholz, S. Gleissberg, and A. Becker
Highly Efficient Virus-induced Gene Silencing (VIGS) in California Poppy (Eschscholzia californica): An Evaluation of VIGS as a Strategy to Obtain Functional Data from Non-model Plants
Ann. Bot., September 1, 2007; 100(3): 641 - 649.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
J. Wu, C. Hettenhausen, S. Meldau, and I. T. Baldwin
Herbivory Rapidly Activates MAPK Signaling in Attacked and Unattacked Leaf Regions but Not between Leaves of Nicotiana attenuata
PLANT CELL, March 1, 2007; 19(3): 1096 - 1122.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. P. Giri, H. Wunsche, S. Mitra, J. A. Zavala, A. Muck, A. Svatos, and I. T. Baldwin
Molecular Interactions between the Specialist Herbivore Manduca sexta (Lepidoptera, Sphingidae) and Its Natural Host Nicotiana attenuata. VII. Changes in the Plant's Proteome
Plant Physiology, December 1, 2006; 142(4): 1621 - 1641.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
J.-H. Kang, L. Wang, A. Giri, and I. T. Baldwin
Silencing Threonine Deaminase and JAR4 in Nicotiana attenuata Impairs Jasmonic Acid-Isoleucine-Mediated Defenses against Manduca sexta
PLANT CELL, November 1, 2006; 18(11): 3303 - 3320.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
Y. Lou and I. T. Baldwin
Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores
Plant Physiology, March 1, 2006; 140(3): 1126 - 1136.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
T. Valentine, J. Shaw, V. C. Blok, M. S. Phillips, K. J. Oparka, and C. Lacomme
Efficient Virus-Induced Gene Silencing in Roots Using a Modified Tobacco Rattle Virus Vector
Plant Physiology, December 1, 2004; 136(4): 3999 - 4009.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
55/395/151    most recent
erh004v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Saedler, R.
Right arrow Articles by Baldwin, I. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saedler, R.
Right arrow Articles by Baldwin, I. T.
Agricola
Right arrow Articles by Saedler, R.
Right arrow Articles by Baldwin, I. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?