Journal of Experimental Botany, Vol. 55, No. 397, pp. 557-569, March 1, 2004
© 2004 Oxford University Press
Cell and Molecular Biology, Biochemistry and Molecular Physiology |
Cloning and characterization of a putative fructosyltransferase and two putative invertase genes from the temperate grass Lolium temulentum L.
Received 30 July 2003; Accepted 4 November 2003
Institute of Grassland and Environmental Research, Plas Gogerddan, Aberystwyth, Ceredigion SY23 3EB, UK
* To whom correspondence should be addressed. Fax: +44 (0) 1970 823243. E-mail: joe.gallagher{at}bbsrc.ac.uk
| Abstract |
|---|
|
|
|---|
The invertases of Lolium temulentum have been characterized at the enzyme level. However, studies on the expression of the genes coding for these enzymes have been lacking. To elucidate the role of acid invertase-like genes in sucrose metabolism and carbon partitioning in Gramineae further, three invertase-like homologous clones were isolated from L. temulentum cDNA expression libraries based on leaf tissue, using maize soluble invertase probes. The effect of developmental stage and alterations in carbohydrate status on the expression and tissue distribution of these genes was investigated. The three highly homologous genes (Inv 1:2, Inv 1:4, and FT 2:2) show different patterns of expression and different tissue distribution. Inv 1:2 was predominantly expressed in root tissue. Expression increased during the dark in root and tiller base tissue. Minimal variations in gene expression were observed in leaf tissue following changes in carbohydrate status. Inv 1:4 was predominantly expressed in tiller bases, leaf sheath, and leaf base, with increased expression in tissue samples in the dark period. FT 2:2 was also predominantly expressed in tiller bases, leaf sheath, and leaf base. Higher expression was observed in leaf tissue following increases in carbohydrate content, in a manner that paralleled the regulation and spatial occurrence of fructan in the leaf tissue. Whilst invertases and fructosyltransferases are difficult to distinguish at the level of the whole sequence, analysis of 5' sequence and specific amino acids allows discrimination which correlates with patterns of expression within the tissue. Based on expression patterns and sequence characteristics, it is proposed that Inv 1:2 and Inv 1:4 code for soluble acid invertases, whilst FT 2:2 codes for a fructosyltransferase.
Key words: cDNA, fructan, fructosyltransferase, gene expression, invertase, sucrose.
| Introduction |
|---|
|
|
|---|
The invertase gene family in grasses comprises genes that code for enzymes involved in both anabolic and catabolic reactions with sucrose. These include the acid and neutral/alkaline invertases (EC 3.2.1.26 [EC] ) and the fructosyltransferases. The acid invertases are predominantly degradative enzymes, but are capable of synthesizing oligosaccharides in vitro (reviewed by Kingston-Smith et al., 1999). They vary in their biochemical properties, subcellular localization, and modes of gene regulation. The neutral/alkaline invertases have pH optima at neutral or alkaline pH and reside in the cytoplasm (Copeland, 1990; Ricardo and ap Rees, 1970). At the sequence level, they show little homology with acid invertases and fructosyltransferases (Gallagher and Pollock, 1998). The acid invertases which account for the majority of invertase activity in plants, have an acid pH optimum and can be subdivided into two classes, the cell-wall-bound (insoluble) and the vacuolar (soluble). Acid invertases function in rapidly growing tissues where there is a high demand for hexoses, such as dividing cells (Schaffer et al., 1987), young developing fruits and seeds (Sung et al., 1994; Yelle et al., 1991), or ripening tissue (Iwatsubo et al., 1976; Klann et al., 1993; Sato et al., 1993). Soluble (vacuolar) invertases are believed to be involved in the regulation of hexose levels in mature tissue and the utilization of vacuolar stored sucrose (Leigh et al., 1979; Ricardo, 1974). They are also believed to be involved in the regulation of stored sucrose via futile cycling in source tissue (Huber et al., 1992). Antisense experiments with invertases have demonstrated a role in plant development (Tang et al., 1999). Cell-wall invertases are believed to be involved in phloem unloading, the regulation of sink strength, and hexose production following pathogen attack (Ehness and Roitsch, 1997; Ho, 1988; Miller and Chourey, 1992; Roitsch et al., 1995; Sturm and Chrispeels, 1990; Weber et al., 1995; Weil and Rausch, 1990; Zhang et al., 1996).
The fructosyltransferases are highly homologous to acid invertases at the gene level. It has been suggested that fructosyltransferases evolved from invertases (Vijn and Smeekens, 1999). These enzymes transfer the fructosyl group of donor sucrose or donor fructan to acceptor sucrose or acceptor fructan. This reaction is similar to that of invertase-mediated sucrose hydrolysis, where fructose is transferred from donor sucrose to acceptor water. Fructans are polymers of fructose and are the main storage carbohydrate in temperate grasses (Cairns, 1993; Cairns et al., 2002; Pollock et al., 1999). The main storage sites of fructans in grasses are the leaf sheath and, to a lesser extent, the leaf base (Housley and Volenec, 1988; Morvan-Bertrand et al., 2001; Morvan et al., 1997; Roth et al., 1997; Volenec, 1986). Fructans have been implicated in conferring tolerance to drought and cold stress (De Roover et al., 2000; Housley and Pollock, 1993; Pilon-Smits et al., 1995; Thomas and James, 1999; Volaire and Lelievre, 1997). Their synthesis occurs de novo in carbohydrate accumulating tissue, with sucrose as the major or sole precursor (Cairns and Pollock, 1988a; Cairns et al., 1999; Wagner et al., 1983). In L. temulentum, fructosyltransferase activity has been identified and measured (Pollock, 1984). This activity is induced by light and by sucrose feeding (Cairns et al., 2002; Winters et al., 1995).
Based on the nature of L. perenne fructans which contain both ß(2-6) and ß(2-1) fructosyl linkages, it has been suggested that sucrose:sucrose 1-fructosyltransferase (1-SST; EC 2.4.1.99 [EC] ), fructan:fructan 6-fructosyltransferase (6-FFT), fructan:fructan 6-glucose-fructosyltransferase (6-G-FT) and fructan:fructan 1-fructosyltransferase (1-FFT; EC 2.4.1.100 [EC] ) activities are required to produce the full spectrum of fructan structures found in vivo (Pavis et al., 2001). However, whether there are four distinct enzymes involved is less clear. Fructosyltransferases generally exhibit more than one activity, depending on the environment in which they are active. For example, the 6-sucrose:fructan fructosyltransferase (6-SFT; EC 2.4.10) of barley demonstrates up to five different types of activity (Cairns, 2003).
There have been a number of investigations into invertase activity in grasses (reviewed by Kingston-Smith et al., 1999). Several studies have shown that soluble invertase activity in Gramineae decreases under conditions of fructan synthesis and increases during fructan remobilization (PrudHomme et al., 1992; Simmen et al., 1993; Simpson et al., 1991). However, others report little change in invertase activity during fructan accumulation (Guerrand et al., 1996; Wagner and Wiemken, 1987). Soluble invertase activity in leaves of L. temulentum has been shown to be inversely related to sucrose levels throughout the leaf development cycle (Pollock and Lloyd, 1977). Invertase levels decreased during leaf expansion, reaching a low during ligule formation and leaf maturity, and increased again during senescence. Along the developing leaf, invertase activity has been shown to increase along the growth zone and subsequently decrease along the mature blade (Lüscher and Nelson, 1995; Roth et al., 1997). This activity in Gramineae has been shown to result from multiple isoforms of the enzyme (Bonnett and Simpson, 1993; Simpson et al., 1991; Walker et al., 1997). Of the two soluble acid invertase isoforms identified in L. temulentum leaves, one isoform showed slightly higher activity in the upper leaf while the second showed no gradient of activity (Walker et al., 1997).
Although invertases have been investigated at the enzyme level, studies on the expression of the genes coding for these enzymes have been limited. To enhance the understanding of the role of acid invertase-like genes in sucrose metabolism and carbon partitioning in Gramineae, a number of invertase homologous clones from L. temulentum cDNA expression libraries was isolated. Studies on the effects of developmental stage and carbohydrate status on the expression and tissue localization of these invertase-like genes are described.
| Materials and methods |
|---|
|
|
|---|
Plant material
Unless otherwise stated, L. temulentum L. (Ba 3081) plants were grown from seed in a 16 °C heated greenhouse in trays of John Innes No. 3 compost (Winters et al., 1995).
Feeding/light induction experiments
Prior to feeding/light induction experiments, plants at the 4th leaf stage were maintained at low irradiance (100 µmol m2 s1) and short photoperiod (8 h) for 5 d to deplete the leaves of soluble carbohydrates (Cairns and Pollock, 1988a; Cairns et al., 2002). Depletion down-regulates fructan synthesis and such tissue was designated uninduced. Leaves were subsequently detached and either fed sucrose/sorbitol in the dark or incubated in water in high light as described by Housley and Pollock (1985). Both light and sucrose treatment initiated fructan accumulation and such tissue was designated induced. Detached leaves were harvested at various time intervals, washed with distilled water, the bottom 1 cm removed, and the remainder frozen in liquid N2 and stored at 80 °C.
Leaf development experiment
For developmental studies, approximately 1500 seeds of L. temulentum were sown in soil and placed in a controlled environment cabinet at 20 °C with an 8 h photoperiod, VPD of 0.6 kPa. and a photon flux density of 350 µmol m2 s1. The 4th leaf (1st independent of the seed reserves; Thomas, 1983) was harvested during the stage of linear growth at approximately 12 cm length, prior to emergence of the 5th leaf (Gay and Thomas, 1995). Harvests were taken at 4, 8, 16, and 24 h. Leaves were rapidly dissected into five segments (02 cm, 24 cm, 46 cm, 69 cm (approximately), and 3 cm from the tip) starting at the leaf base (point of emergence from the apical meristem), flash frozen in liquid nitrogen, and stored at 80 °C. Approximately 100 leaves were pooled for each time point.
mRNA extraction and lambda cDNA library synthesis
Total RNA was extracted as described by Thomas (1990). Poly(A)+ RNA was purified with an mRNA purification kit (Dynabeads, product 610.01 Dynal Ltd, Merseyside, UK) according to the manufacturers instructions. Control and sucrose-induced lambda Zap II cDNA libraries were constructed using a uni-directional lambda Zap II cDNA synthesis kit (Stratagene Cambridge, UK) as described by Gallagher and Pollock (1998). These libraries were screened using radiolabelled probes following plaque lifts, according to the manufacturers instructions. Where necessary, full-length clones were isolated either using 5' RACE (GeneRacer Kit; Invitrogen Paisley, UK) with gene-specific primers or, in the case of Inv 1:2, by PCR using a gene-specific primer (5'-CACGAGATCTGCTCCATTTG) from L. perenne fructosyltransferase (AF481763
[GenBank]
; Johnson et al., 2002) and an Inv 1:2 gene-specific primer (5' CACTGAACCTGCACGGAGGC) with L. temulentum genomic DNA as a template. Genomic DNA was isolated by the method of Shure et al. (1983).
Northern analysis
Total RNA (10 µg) was denatured and separated on 1.5% agarose gels containing 17.2% formaldehyde. After separation, RNA was transferred to a Hybond-N+ membrane (Amersham International plc, Buckinghamshire, UK) by capillary transfer and cross-linked by UV light. Pre-hybridization and hydridization were carried out as described by Winters et al. (1995). 3' specific cDNA probes (see below) were labelled with a 32P dATP using high prime random-primed DNA labelling kit (Roche Ltd, Lewes, UK) in accordance with the manufacturers instructions. Final washes were carried out in 0.1x SSC, 0.1% (w/v) SDS at 45 °C.
Transcript analysis by PCR
Transcripts were analysed using a two-step RT-PCR procedure (Roche Kit 1483 188). cDNA was synthesized from either total RNA or poly(A+) selected mRNA. A DNAse treatment (Dnase RQ1, Promega, Southampton, UK) following RNA isolation was carried out to ensure removal of genomic DNA contamination. RNA was subsequently purified using the RNeasy kit (Qiagen Ltd, Crawley, UK). The resulting RNA was tested for possible genomic contamination by PCR amplification using actin primers (samples were incubated as per cDNA synthesis reaction but in the absence of reverse transcriptase).
For analysis of transcripts, cDNA was standardized for the actin transcript. Dilutions of cDNA were amplified using actin-specific primers for a varying number of cycles. From image analysis (using the AlphaImager 1200TM imaging system and software, Alpha Innotech Ltd., Staffordshire, UK), following gel electrophoresis and ethidium bromide staining, the starting template concentrations were adjusted so that bands of equal intensity were obtained (during the linear phase of amplification) for each sample. In most cases, only slight adjustments were needed. Aliquots of cDNA were then used as the template in subsequent PCR reactions. Individual transcript analysis was carried out using gene-specific primers: Actin primers (forward 5'-ATGGAGAAGATTTGGCATCA and reverse 5'-ACACCATCACCAGAATCCA), Inv 1:2 primers (forward 5'-TTCCTCTTCTCTTGGATGCAG and reverse 5'-TTTCCCCA ATAATTTCATTTCC), Inv 1:4 primers (forward 5'-GGACTT CTCCTACAATCAGGCC and reverse 5'-TTCTAAACAACTT GGACTGACG), and FT 2:2 primers (forward 5'-CCAAGCGTT GAAATAATTTACT and reverse 5'-GATTTGTTGTATCTC TGGTG). These primers were also used to synthesize 3'-specific probes (confirmed by sequence analysis) for use in northern analysis.
Extraction of water-soluble carbohydrates
Frozen leaf tissue was ground, subsampled, and freeze-dried. Water-soluble carbohydrates were extracted as described by Pollock and Jones (1979). TLC analysis was carried out as described by Cairns and Pollock (1988a).
| Results |
|---|
|
|
|---|
Isolation of invertase-like clones
Plants of L. temulentum were grown in a low light and short photoperiod environment to deplete leaves of non-structural carbohydrates. The leaves were excised and placed in either 200 mM sucrose (sucrose-induced) or water (non-induced) in the dark. Leaves were harvested at 3 h intervals over a 12 h period. mRNA was extracted and pooled for each treatment and used to construct lambda phage cDNA libraries. These sucrose-induced and non-induced libraries were screened using maize invertases Ivr 1 (accession number U16123 [GenBank] ) and Ivr 2 (accession number U31451 [GenBank] ) as probes. The resulting positives were isolated and sequenced. Full-length clones were isolated using 5' RACE and gene-specific primers. Difficulties in isolating the 5' coding sequence of Inv 1:2 (accession number AJ532551 [GenBank] ) were overcome by cloning the remaining 360 bases by PCR using a gene-specific primer from L. perenne fructosyltransferase (AF481763 [GenBank] ; Johnson et al., 2002) and an Inv 1:2 gene specific primer using L. temulentum genomic DNA as a template. A 1381 bp product (accession number AJ532552 [GenBank] ) was isolated, from which the 5' coding sequence was determined. Sequence analysis revealed that three of these clones were highly homologous to each other and to known invertases and fructosyltransferases in the database (Table 1). The three cDNAs showed the greatest homology to recently isolated fructosyltransferases from L. perenne: AF481763 [GenBank] (Johnson et al., 2002); AY082350 [GenBank]
(Lidgett et al., 2002), and AF494041
[GenBank]
(Lasseur et al., 2002). These clones were designated Inv 1:2, Inv 1:4 (accession number AJ532549
[GenBank]
) and FT 2:2 (6-FT; accession number AJ532550
[GenBank]
). Sequence homology (at the amino acid level) between Inv 1:2 and Inv 1:4 using GAP (GCG software) showed 75% similarity (with 71% identical), between Inv 1:2 and FT 2:2, 75% similarity (with 70% identical), and between Inv 1:4 and FT 2:2, 67% similarity (with 63% identical) (Fig. 1). Deduced amino acids from the open reading frame showed that Inv 1:2 encodes a 645 amino acid polypeptide, Inv 1:4 encodes a 677 amino acid polypeptide, and FT 2:2 encodes a 625 amino acid polypeptide. All three proteins were predicted to contain five putative N-glycosylation sites each, signal peptides (Nielsen et al., 1997; SignalP 2.0) and N-terminal extensions (Tymowska-Lalanne and Kreis, 1998) with the mature proteins starting at position 107 for Inv 1:2, 118 for Inv 1:4, and 76 for FT 2:2 (Fig. 1), as predicted for invertases and fructosyltransferases (Kawakami and Yoshida, 2002; Sprenger et al., 1995; Unger et al., 1994). The predicted theoretical pI values for the mature peptide of Inv 1:2, Inv 1:4, and FT 2:2 were 4.6, 5.5, and 5.0, with molecular weights of 60 kDa, 61 kDa, and 61 kDa, respectively, comparable to the molecular weight observed for purified plant invertases (Tymowska-Lalanne and Kreis, 1998). The regions containing the signal peptides are less well conserved. All three polypeptides contained the conserved motifs for catalytic sites, including the ß-fructosidase motif NDPNG (Sturm and Chrispeels, 1990) and the motif WECI/VD characteristic of soluble (vacuolar) acid invertases (Roitsch et al., 1995). The Asp (D) in the NDPNG motif and the Glu (E) in the WECID motif are known to be involved in sucrose hydrolysis (Reddy and Maley, 1990, 1996).
|
|
Distribution of gene expression in the whole plant and mature leaf blade
The expression of these genes in root, tiller base (02 cm), and leaf tip (top 4 cm) revealed that Inv 1:2 was predominantly expressed in the root, and to a lesser extent in the tiller base and upper leaf (Fig. 2). Greater expression was observed in the tissue at the end of the dark period. Inv 1:4 was predominately expressed in the tiller base at the end of the dark period with some expression in the root. FT 2:2 was expressed in the tiller base and showed enhanced expression at the end of the light period.
|
Similar results were obtained from mature leaf tissue (Fig. 3). Inv 1:4 and FT 2:2 were predominantly expressed in leaf sheath tissue and, to a much lesser extent, in tissue from the basal region of the mature leaf. Inv 1:4 showed greater expression at the end of the dark period while FT 2:2 showed greater expression at the end of the light period. Inv 1:2 showed similar expression in all three tissue samples over the diurnal cycle.
|
Leaf development
To investigate the link between invertase gene expression and leaf development, the expression of the three invertase-like cDNAs was determined along the developing leaf blade over the diurnal cycle. Leaves were harvested at the end of the light, middle of the dark, end of the dark, and middle of the light periods during the phase of linear growth. Leaves were segmented along a gradient representing zones of division and differentiation through to mature photosynthetic tissue. Figure 4 shows the changes in gene expression (Fig. 4A) and sugar distribution (Fig. 4B) in these tissues along the leaf gradient. Overall the results showed a gradation in carbohydrates (particularly fructan) along the leaf length. At the end of the dark period, little sucrose was apparent in the upper portion of the leaf (Fig. 4B). Fructan was observed in the lower leaf segments. By the end of the light period sucrose concentrations were high in the upper portion of the leaf and there was an increase in fructan content in the lower leaf zone. The three cDNAs showed different patterns of expression in these tissues (Fig. 4A). Inv 1:2 appears to be constitutively expressed along the leaf blade, with no change over the sampling period. Inv 1:4 showed changes in expression during the diurnal cycle. At the end of the light period very little transcript was observed in the leaf tissue. However, by the end of the dark period transcript was detected, suggesting that this gene is down-regulated during the photoperiod. No correlation was apparent between transcript levels and leaf development/fructan accumulation. FT 2:2 showed a different pattern of expression. There was a gradient of expression along the leaf blade. There was also a change in expression in the upper portion of the leaf during the diurnal cycle. More transcript was detected during the light period compared with the dark. The implication is that there was both a developmental gradient as well as a light effect. Expression of this gene also correlated with the carbohydrate gradient along the leaf.
|
Effect of light
The effect of light on the expression of all three invertase-like genes was measured. Figure 5 shows gene expression in excised leaf tissue after 24 h in either the dark or the light. Inv 1:2 shows little change in expression at the end of 24 h in the light compared with the dark. There was a slight reduction in Inv 1:4 transcript at the end of the light treatment compared to the dark treatment. FT 2:2 was not detected in the dark after 24 h, but was detected at the end of the light period.
|
Effect of carbohydrates
To separate the effects due to carbohydrate accumulation from light and the effects of leaf development, plants were grown in a low light/short photoperiod. Under these conditions sucrose and fructan are fully degraded (Cairns and Pollock, 1988a; Cairns et al., 2002). Leaves were excised, placed in sucrose or sorbitol (osmotic control) and the expression of all three clones was monitored (Fig. 6). Separation of water-soluble carbohydrates by TLC (Fig. 6a) showed that there was no sucrose in the tissue at the beginning of the feed. In the sucrose-fed tissue, sucrose and monosaccharides were observed after the first 3 h and continued to accumulate over 12 h. Fructans began to appear following sucrose accumulation. Transcript analysis (Fig. 6b) shows that FT 2:2 was expressed de novo only in the sucrose-fed tissue and expression correlated with the appearance of fructan. Inv 1:2 and Inv 1:4 were detected in both the sucrose- and sorbitol-fed tissues and were present at time 0. There appeared to be a slight decline in Inv 1:2 transcript as sucrose accumulated in the tissue.
|
| Discussion |
|---|
|
|
|---|
The invertases of L. temulentum have been studied at the enzyme level (Pollock and Lloyd, 1977; Walker et al., 1997). However, little is known about the expression of the genes which encode these enzymes. Three cDNA clones have been isolated from L. temulentum. The three highly homologous genes showed different patterns of expression and different tissue distribution. All three were isolated from leaf tissue. Inv 1:2 showed a more constitutive pattern of expression during changes in light and carbohydrate status. This homologue was predominantly expressed in the root tissue. Inv 1:4 showed greater expression in the dark and was predominantly expressed in the tiller base, leaf sheath, and leaf base. It appeared to be down-regulated during conditions of sucrose accumulation. FT 2:2 was up-regulated by both changes in carbohydrate status and light and was predominantly expressed in the tiller base, leaf sheath and leaf base.
Sequence homology and deduced amino acids identifies all three cDNAs as being members of the acid invertase gene family, showing little homology to the alkaline/neutral invertases (Gallagher and Pollock, 1998; Sturm et al., 1999). All three contain the conserved invertase motifs DPNG and WEC(I/V/P)D (Roitsch et al., 1995; Sturm and Chrispeels, 1990). Consistent with all plant acid invertases, they have a predicted signal peptide and a N-terminal pro-peptide, which are believed to be cleaved during transport and protein maturation (Tymowska-Lalanne and Kreis, 1998). Further analysis shows that while they are members of the invertase gene family, they are soluble (vacuolar) rather than cell-wall invertases. They do not contain the distinctive proline in the motif WECPD present in all cell-wall invertases (Roitsch et al., 1995) and, unlike cell-wall invertases which have a basic pI, all three cDNAs are predicted to code for peptides with an acidic pI characteristic of vacuolar invertases (Kim et al., 2000). Furthermore the length of the predicted signal peptide and N-terminal extension is similar to vacuolar invertases rather than cell-wall invertases (Fig. 7) which are much shorter (Tymowska-Lalanne and Kreis, 1998). Although homologous to invertases, Inv 1:4 and Inv 1:2 show greatest homology to AY082350 [GenBank] and AF481763 [GenBank] , respectively, which have been classified as fructosyltransferases from L. perenne (Johnson et al., 2002; Lidgett et al., 2002). FT 2:2 also shows greatest homology to a fructosyltransferase from L. perenne (AF494041 [GenBank] , classified as a fructan 6-fructosyltransferase; Lasseur et al., 2002). Thus, based on sequence homology with these genes in the database, all three may be described as fructosyltransferases. However, the pattern of expression of two of these genes as well as sequence characteristics suggests that 1:2 and 1:4 are soluble acid invertases rather than fructosyltransferases. Studies with excised leaf systems, using inhibitors of transcription, have shown that there is a requirement for both sucrose accumulation and de novo gene expression for fructan synthesis to occur (Cairns and Pollock, 1988b; Cairns et al., 2002; Wagner et al., 1986; Winters et al., 1994). Indeed, Muller et al. (2000) have shown that genes encoding the fructosyltransferases of barley are induced by sucrose. In a similar experiment it was demonstrated that Inv 1:4 and Inv 1:2 transcripts are present in tissue containing neither fructan nor sucrose (Fig. 5). This is consistent with the findings of Simmen et al. (1993) who observed high levels of constitutive invertase activity in excised barley leaves placed in conditions which did not induce fructan synthesis. When excised leaves are placed in fructan-inducing conditions, either placed in sucrose solution (Fig. 6) or in high light (Fig. 5), Inv 1:2 shows no change in expression as a result of fructan induction, while Inv 1:4 appears to be down-regulated by conditions which induce fructan accumulation. This strongly suggests that neither Inv 1:2 nor Inv 1:4 are directly involved in fructan synthesis. On the other hand, FT 2:2 was strongly induced under conditions of fructan accumulation.
|
The invertase gene family members can be characterized based on sequence analysis. Over the entire sequence, invertases and fructosyltransferases are extremely homologous to each other, making classification difficult based on the properties of the entire sequence. However, analysis of their 5' sequence, which contains the signal sequence and N-terminal extensions (Sturm, 1999; Tymowska-Lalanne and Kreis, 1998) can aid in discriminating between these gene types on the basis of function. Figure 8 shows a comparison of a number of invertase and known fructosyltransferase sequences. Based on 5' sequence homology, the invertases Inv 1:2 (L. perenne AF481763 [GenBank] ) and Inv 1:4 (L. perenne AY082350 [GenBank] ) group with the soluble acid invertases while FT 2:2 (L. perenne AF494041 [GenBank] ) groups with the fructan 6-fructosyltransferases. This difference in 5' sequence could reflect differences in target destination or route of targeting and/or have influence on the modulation of enzyme function (Cairns, 2003).
|
Further sequence analysis of invertases and fructosyltransferases reveals a difference in amino acid sequence around the active site DPNG (ß-fructosidase motif; Sturm and Chrispeels, 1990; Wei and Chatterton, 2001). Plant genes classified as acid invertases contain the amino acid triplet WMN or WIN, while no plant fructosyltransferases isolated to date have this triplet. By contrast, they possess a range of different amino acids (Table 2). The only two exceptions are the fructosyltransferases reported for L. perenne (Inv 1:4 and Inv 1:2 homologues) both of which have the acid invertase amino acids WMN. According to this studys sequence analysis these genes should be classified as acid invertases and not as fructosyltransferases. FT 2:2 does not contain the amino acid triplet WMN or WIN, which supports the theory that this gene codes for a fructosyltransferase. Although the WMN and WIN amino acid triplet are specific to invertases, it must be noted that there is no evidence to show that these sequences are functionally important.
|
Physiological and developmental distribution of expression, coupled with the sequence analysis (5' homology and characteristic three amino acids at the active site) suggest that FT 2:2 encodes a fructosyltransferase (possibly of the 6-FT type) while Inv 1:4 and Inv 1:2 encode for soluble acid invertases. Another enzyme believed to be required for fructan synthesis is 1-SST which is involved in the initial steps (Koops and Jonker, 1996; Lüscher et al., 1996; Van den Ende and Van Laere, 1996). Inv 1:2 and Inv 1:4 are unlikely to be 1-SSTs based on the above criteria, but also the 1-SST has been cloned from L. temulentum (based on 92% sequence homology with Festuca 1-SST which has been characterized at the enzyme level; Lüscher et al., 2000). 1-SST from this laboratory also shows de novo expression when water-soluble carbohydrate depleted leaves are excised and placed in high light (data not shown).
The developing leaf exhibits a gradient of cell age and a transition from heterotrophy at the base to autotrophy at the tip. Under controlled environmental conditions its growth is highly predictable, the first segment (2 cm) representing the zone of cell division and elongation (Ougham et al., 1987). In the developing leaf fructans are predominantly localized in this zone (Fig. 4B) where the fructosyltransferase FT 2:2 is predominantly expressed (Fig. 4A). This is consistent with findings for other Gramineae (Lüscher and Nelson, 1995; Pavis et al., 2001; PrudHomme et al., 1992; Roth et al., 1997; Schnyder et al., 1988). Lüscher et al. (2000) showed that the fructosyltransferase 1-SST was predominantly expressed in the first 3 cm from the leaf base. Invertase activity has been shown to alter along the developing leaf (Lüscher and Nelson, 1995; Roth et al., 1997; Walker et al., 1997). In this work little change in expression was observed for Inv 1:2 and Inv 1:4 along the developing leaf at the end of the light period. However, changes in transcript levels may not reflect enzyme activity due to post-translational regulation (Kingston-Smith et al., 1999).
The role of the invertases Inv 1:4 and 1:2 identified in this study is difficult to deduce. The physiological roles of invertases are diverse and their function varies depending on the organ/tissue in which they are expressed. The expression profile of Inv 1:4 is consistent with invertase enzyme activity profiles observed in leaves of Gramineae. Decreased expression during fructan synthesis with enhanced expression during fructan remobilization is consistent with patterns of invertase activity reported by PrudHomme et al. (1992), Simmen et al. (1993) and Simpson et al. (1991). This suggests that Inv 1:4 may play a role during fructan remobilization providing hexoses as substrates for cell expansion and growth. By contrast, the pattern of expression observed for Inv 1:2 suggests a major role in root tissues. Potential functions include mobilization of imported sucrose providing substrate for use in other metabolic processes, and helping to maintain the sucrose gradient between sink and source tissue (Duke et al., 1991; Sturm et al., 1995).
Different invertase isoforms are expressed in specific cell types. Expression of Inv 1:4 in fructan synthesizing leaf tissue suggests differential localization of synthetic and catabolic enzymes. Invertase activity has been detected in non-fructan synthesizing leaf cell types. Koroleva et al. (1997) and Kingston-Smith et al. (1999) demonstrated that although invertase was present in barley epidermal, mesophyll, and parenchymatous bundle-sheath cells, the majority of the soluble acid invertase activity was in the vascular bundles. Obenland et al. (1993) identified three isoforms of invertase in barley leaf tissue, and found that only one was expressed in epidermal cells. Expression of Inv 1:2 in root tissue may also be limited to specific cell types. Xu et al. (1996) demonstrated differential expression of invertase isoforms in maize root tissue and postulated different physiological roles for each isoform. Tissue localization studies will provide further evidence for the specific roles of these different invertase isoforms.
It must, however, be noted that interpretation of patterns of expression of message are limited as they provide no information about enzyme kinetics or regulation resulting from post-translational modification. An added complexity with invertases is the interpretation of published enzyme activity data due to the similarities between fructolsyltransferase and invertase activities when assayed in vitro (Obenland et al., 1993; Cairns et al., 1999). Without enzymic data and more detailed localization studies, it is difficult to comment with much certainty on the physiological significance of the two invertases identified in this study, other than to state that they have different modes of regulation implying different roles in sugar metabolism within the plant.
| Acknowledgements |
|---|
We wish to thank Professor KE Koch for the maize Ivr 1 and Ivr 2 clones. This work was funded through the BBSRC.
| References |
|---|
|
|
|---|
Bonnett GD, Simpson RJ. 1993. Fructan-hydrolyzing activities from Lolium rigidum Gaudin. New Phytologist 123, 443451.[CrossRef][Web of Science]
Cairns AJ. 1993. Evidence for the de novo synthesis of fructan by enzymes from higher-plantsa reappraisal of the SST/FFT Model. New Phytologist 123, 1524.
Cairns AJ. 2003. Fructan biosynthesis in transgenic plants. Journal of Experimental Botany 54, 549567.
Cairns AJ, Cookson A, Thomas BJ, Turner LB. 2002. Starch metabolism in the fructan-grasses: patterns of starch accumulation in excised leaves of Lolium temulentum L. Journal of Plant Physiology 159, 293305.[CrossRef]
Cairns AJ, Nash R, De Carvalho MAM, Sims IM. 1999. Characterization of the enzymatic polymerization of 2,6-linked fructan by leaf extracts from timothy grass (Phleum pratense). New Phytologist 142, 7991.[CrossRef]
Cairns AJ, Pollock CJ. 1988a. Fructan biosynthesis in excised leaves of Lolium temulentum L. 1. Chromatographic characterization of oligofructans and their labelling patterns following 14CO2 feeding. New Phytologist 109, 399405.[CrossRef]
Cairns AJ, Pollock CJ. 1988b. Fructan biosynthesis in excised leaves of Lolium temulentum L. 2. Changes in fructosyl transferase-activity following excision and application of inhibitors of gene-expression. New Phytologist 109, 407413.[CrossRef]
Copeland L. 1990. Enzymes of sucrose metabolism. In: Lea PJ, ed. Enzymes of primary metabolism. London: Academic Press, 7385.
De Roover J, Vandenbranden K, Van Laere A, Van den Ende W. 2000. Drought induces fructan synthesis and 1-SST (sucrose:sucrose fructosyltransferase) in roots and leaves of chicory seedlings (Cichorium intybus L.). Planta 210, 808814.[CrossRef][Web of Science][Medline]
Duke ER, McCarty DR, Koch KE. 1991. Organ-specific invertase deficiency in the primary root of an inbred maize line. Plant Physiology 97, 523527.
Ehness R, Roitsch T. 1997. Co-ordinated induction of mRNAs for extracellular invertase and a glucose transporter in Chenopodium rubrum by cytokinins. The Plant Journal 11, 539548.[CrossRef][Web of Science][Medline]
Gallagher JA, Pollock CJ. 1998. Isolation and characterization of a cDNA clone from Lolium temulentum L. encoding for a sucrose hydrolytic enzyme which shows alkaline/neutral invertase activity. Journal of Experimental Botany 49, 789795.
Gay AP, Thomas H. 1995. Leaf development in Lolium temulentum L.photosynthesis in relation to growth and senescence. New Phytologist 130, 159168.[CrossRef][Web of Science]
Guerrand D, Prudhomme MP, Boucaud J. 1996. Fructan metabolism in expanding leaves, mature leaf sheaths and mature leaf blades of Lolium perenne. Fructan synthesis, fructosyltransferase and invertase activities. New Phytologist 134, 205214.[CrossRef][Web of Science]
Ho LC. 1988. Metabolism and compartmentation of imported sugars in sink organs in relation to sink strength. Annual Review of Plant Physiology and Plant Molecular Biology 39, 355378.[CrossRef][Web of Science]
Housley TL, Pollock CJ. 1985. Photosynthesis and carbohydrate metabolism in detached leaves of Lolium temulentum L. New Phytologist 99, 499507.[CrossRef]
Housley TL, Pollock CJ. 1993. The metabolism of fructan in higher plants. In: Suzuki M, Chatterton NJ, eds. Science and technology of fructans. Boca Raton: CRC Press, 191225.
Housley TL, Volenec JJ. 1988. Fructan content and synthesis in leaf tissue of Festuca arundinacea. Plant Physiology 86, 12471251.
Huber SC, Huber JLA, McMicheal RW. 1992. The regulation of sucrose synthesis in leaves. In: Pollock CJ, Farrar JF, Gordon AJ, eds. Carbon partitioning. Oxford, UK: Bios, 126.
Iwatsubo T, Sekiguchi K, Tada T, Nakagawa H. 1976. Increase of ß-fructofuranosidase content in tomato fruit during the ripening process. Agricultural Biological Chemistry 40, 12431244.
Johnson XA, Lidgett A, Terdich KM, Chalmers J, Guthridge K, Jones E, Spangenberg G. 2002. Isolation and characterization of a fructosyltransferase homolog cDNA from perennial ryegrass (Lolium perenne). EMBL database AY082350.
Johnson XA, Lidgett A, Chalmers J, Guthridge K, Jones E, Cummings N, Spangenberg G. 2003. Isolation and characterization of invertase cDNA from perennial ryegrass (Lolium perenne). Journal of Plant Physiology 160, 903911.[CrossRef][Web of Science][Medline]
Kawakami A, Yoshida M. 2002. Molecular characterization of sucrose:sucrose 1-fructosyltransferase and sucrose:fructan 6-fructosyltransferase associated with fructan accumulation in winter wheat during cold hardening. Bioscience, Biotechnology and Biochemistry 66, 22972305.[CrossRef][Medline]
Kim J-Y, Mahe A, Guy S, Brangeon J, Roche O, Chourey P, Prioul J-L. 2000. Characterization of two members of the maize gene family, Incw3 and Incw4, encoding cell-wall invertases. Gene 245, 89102.[CrossRef][Web of Science][Medline]
Kingston-Smith AH, Walker RP, Pollock CJ. 1999. Invertase in leaves: conundrum or control point? Journal of Experimental Botany 50, 735743.
Klann EM, Chetelat RT, Bennett AB. 1993. Expression of acid invertase gene controls sugar composition in tomato (Lycopersicon) fruit. Plant Physiology 103, 863870.[Abstract]
Koops AJ, Jonker HH. 1996. Purification and characterization of the enzymes of fructan biosynthesis in tubers of Helianthus tuberosus Colombia. Plant Physiology 110, 11671175.[Abstract]
Koroleva OA, Farrar JF, Tomos AD, Pollock CJ. 1997. Patterns of solute in individual mesophyll bundle sheath and epidermal cells of barley leaves induced to accumulate carbohydrate. New Phytologist 136, 97104.[CrossRef][Web of Science]
Lasseur B, Djoumad A, PrudHomme MP. 2002. Isolation of a putative 6-FT gene from perennial ryegrass (Lolium perenne). EMBL database AF494041 [GenBank] .
Leigh RA, ap Rees T, Fuller WA, Banfield J. 1979. The localization of acid invertase activity and sucrose in the vacuoles of storage roots of beetroot (Beta vulgaris). Biochemical Journal 178, 539547.[Web of Science][Medline]
Lidgett A, Terdich KM, Johnson XA, Guthridge K, Jones E, Spangenberg G. 2002. Isolation and characterization of a fructosyltransferase gene from perennial ryegrass (Lolium perenne). Journal of Plant Physiology 159, 10371043.[CrossRef][Web of Science]
Lüscher M, Erdin C, Sprenger N, Hochstrasser U, Boller T, Wiemken A. 1996. Inulin synthesis by a combination of purified fructosyltransferases from tubers of Helianthus tuberosus. FEBS Letters 385, 3942.[CrossRef][Web of Science][Medline]
Lüscher M, Hochstrasser U, Vogel G, Aeschbacher R, Galati V, Nelson CJ, Boller T, Wiemken A. 2000. Cloning and functional analysis of sucrose:sucrose 1-fructosyltransferase from tall fescue. Plant Physiology 124, 12171228.
Lüscher M, Nelson CJ. 1995. Fructosyltransferase activities in the leaf growth zone of tall fescue. Plant Physiology 107, 14191425.[Abstract]
Miller ME, Chourey PS. 1992. The maize invertase-deficient miniature-1 seed mutation is associated with aberrant pedicel and endosperm development. The Plant Cell 4, 297305.
Morvan A, Challe G, Prudhomme MP, LeSaos J, Boucaud J. 1997. Rise of fructan exohydrolase activity in stubble of Lolium perenne after defoliation is decreased by uniconazole, an inhibitor of the biosynthesis of gibberellins. New Phytologist 136, 8188.[CrossRef][Web of Science]
Morvan-Bertrand A, Boucaud J, Le Saos J, PrudHomme MP. 2001. Roles of the fructans from leaf sheaths and from the elongating leaf bases in the regrowth following defoliation of Lolium perenne L. Planta 213, 109120.[CrossRef][Web of Science][Medline]
Muller J, Aeschbacher RA, Sprenger N, Boller T, Wiemken A. 2000. Disaccharide-mediated regulation of sucrose:fructan-6-fructosyltransferase, a key enzyme of fructan synthesis in barley leaves. Plant Physiology 123, 265273.
Nielsen H, Engelbrecht J, Brunak S, von Heijne G. 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10, 16.
Obenland DM, Simmen U, Boller T, Wiemken A. 1993. Purification and characterization of three soluble invertases from barley (Hordeum vulgare L.) leaves. Plant Physiology 101, 13311339.[Abstract]
Ougham HJ, Jones WA, Evans M. 1987. Leaf development in Lolium temulentum L.: progressive changes in soluble polypeptide complement and isoenzymes. Journal of Experimental Botany 38, 16891696.
Pavis N, Boucaud J, PrudHomme MP. 2001. Fructans and fructan-metabolizing enzymes in leaves of Lolium perenne. New Phytologist 150, 97109.[CrossRef][Web of Science]
Pilon-Smits EA, Ebskamp MJ, Paul MJ, Jeuken MJ, Weisbeek P, Smeekens S. 1995. Improved performance of transgenic fructan-accumulating tobacco under drought stress. Plant Physiology 107, 125130.[Abstract]
Pollock CJ. 1984. Sucrose accumulation and the initiation of fructan biosynthesis in Lolium temulentum L. New Phytologist 96, 527534.[CrossRef]
Pollock CJ, Cairns AJ, Gallagher JA, Harrison J. 1999. The integration of sucrose and fructan metabolism in temperate grasses and cereals. In: Kruger NJ, Hill SA, Ratcliffe RG, eds. Regulation of Primary metabolic pathways in plants. Proceedings of the Phytochemical Society of Europe, St Hughes College, Oxford, 911 January 1997. The Netherlands: Kluwer Academic Publishers, 195226.
Pollock CJ, Jones T. 1979. Seasonal patterns of fructan metabolism in forage grasses. New Phytologist 83, 915.[CrossRef][Web of Science]
Pollock CJ, Lloyd EJ. 1977. The distribution of acid invertase in developing leaves of Lolium temulentum L. Planta 133, 197200.[CrossRef]
PrudHomme MP, Gonzalez B, Billard JP, Boucaud J. 1992. Carbohydrate content, fructan and sucrose enzyme-activities in roots, stubble and leaves of ryegrass (Lolium perenne L.) as affected by source sink modification after cutting. Journal of Plant Physiology 140, 282291.[Web of Science]
Reddy A, Maley F. 1990. Identification of an active site residue in yeast invertase by affinity labelling and site directed mutagenesis. Journal of Biological Chemistry 265, 1081710820.
Reddy A, Maley F. 1996. Studies on identifying the catalytic role of Glu-204 in the active site of yeast invertase. Journal of Biological Chemistry 271, 1395313958.
Ricardo CP. 1974. Alkaline ß-fructosidases of tuberous roots: possible physiological function. Planta 118, 333343.[CrossRef]
Ricardo CP, ap Rees T. 1970. Invertase activity during the development of carrot roots. Phytochemistry 9, 239247.
Roitsch T, Bittner M, Godt DE. 1995. Induction of apoplastic invertase of Chenopodium rubrum by D-glucose and a glucose analog and tissue-specific expression suggest a role in sink-source regulation. Plant Physiology 108, 285294.[Abstract]
Roth A, Lüscher M, Sprenger N, Boller T, Wiemken A. 1997. Fructan and fructan-metabolizing enzymes in the growth zone of barley leaves. New Phytologist 136, 7379.[CrossRef][Web of Science]
Sato T, Iwatsubo T, Takahashi M, Nagagawa H, Ogura N, Mori H. 1993. Intracellular localization of acid invertase in tomato fruit and molecular cloning of a cDNA for the enzyme. Plant Cell Physiology 34, 263269.
Schaffer AA, Sage O, Goldschridt EE, Goren R. 1987. Invertase and sucrose synthase activity, carbohydrate status and endogenous IAA levels during Citrus leaf development. Physiologia Plantarum 69, 151155.[CrossRef]
Schnyder H, Nelson CJ, Spollen WG. 1988. Diurnal growth of tall fescue leaf blades. (2) Dry matter partitioning and carbohydrate metabolism in the elongation zone and adjacent expanded tissue. Plant Physiology 86, 10771083.
Shure M, Wessler S, Fedoroff N. 1983. Molecular identification and isolation of the waxy locus in maize. Cell 35, 225233.[CrossRef][Web of Science][Medline]
Simmen U, Obenland D, Boller T, Wiemken A. 1993. Fructan synthesis in excised barley leaves: identification of 2 sucrose-sucrose fructosyltransferases induced by light and their separation from constitutive invertases. Plant Physiology 101, 459468.[Abstract]
Simpson RJ, Walker RP, Pollock CJ. 1991. Fructan exohydrolase activity in leaves of Lolium temulentum L. New Phytologist 119, 499507.[CrossRef][Web of Science]
Sprenger N, Bortlik K, Brandt A, Boller T, Wiemken A. 1995. Purification, cloning, and functional expression of sucrose:fructan 6-fructosyltransferase, a key enzyme of fructan synthesis in barley. Proceedings of the National Academy of Sciences, USA 92, 1165211656.
Sturm A. 1999. Invertases. Primary structures, functions, and roles in plant development and sucrose partitioning. Plant Physiology 121, 17.
Sturm A, Chrispeels MJ. 1990. cDNA cloning of carrot extracellular ß-fructosidase and its expression in response to wounding and bacterial infection. The Plant Cell 2, 11071119.
Sturm A, Hess D, Lee HS, Lienhard S. 1999. Neutral invertase is a novel type of sucrose-cleaving enzyme. Physiologia Plantarum 107, 159165.[CrossRef]
Sturm A, Sebkova V, Lorenz K, Hardegger M, Lienhard S, Unger C. 1995. Development- and organ-specific expression of the genes for sucrose synthase and three isoenzymes of acid ß-fructofuranosidase in carrot. Planta 195, 601610.
Sung HI, Liu LF, Kao CH. 1994. The induction of alpha-amylase activity by sucrose starvation in suspension-cultured rice cells is regulated by polyamines. Physiologia Plantarum 91, 137140.[CrossRef]
Tang GQ, Lüscher M, Sturm A. 1999. Antisense repression of vacuolar and cell-wall invertase in transgenic carrot alters early plant development and sucrose partitioning. The Plant Cell 11, 177189.
Thomas H. 1983. Analysis of the nitrogen response of leaf extension in Lolium temulentum seedlings. Annals of Botany 51, 363371.
Thomas H. 1990. Leaf development in Lolium temulentum: protein metabolism during development and senescence of attached and excised leaf tissue. Journal of Plant Physiology 136, 4550.
Thomas H, James AR, 1999. Partitioning of sugars in Lolium perenne (perennial ryegrass) during drought and on rewatering. New Phytologist 142, 295305.[CrossRef]
Tymowska-Lalanne Z, Kreis M. 1998. The plant invertases: physiology, biochemistry and molecular biology. Advances in Botanical Research 28, 71117.
Unger C, Hardegger M, Lienhard S, Sturm A. 1994. cDNA cloning of carrot (Daucus carota) soluble acid ß-fructofuranosidases and comparison with the cell-wall isoenzyme. Plant Physiology 104, 13511357.[Abstract]
Van den Ende W, Van Laere A. 1996. De novo synthesis of fructans from sucrose in vitro by a combination of two purified enzymes (sucrose:sucrose 1-fructosyltransferase and fructan: fructan 1-fructosyltransferase) from chicory roots (Cichorium intybus L.). Planta 200, 335342.[Web of Science]
Vijn I, Smeekens S. 1999. Fructan: more than a reserve carbohydrate? Plant Physiology 120, 351359.
Volaire F, Lelievre F. 1997. Production, persistence, and water-soluble carbohydrate accumulation in 21 contrasting populations of Dactylis glomerata L. subjected to severe drought stress in the south of France. Australian Journal of Agricultural Research 48, 933944.[CrossRef]
Volenec JJ. 1986. Non-structural carbohydrates in stem base components of tall fescue during regrowth. Crop Science 26, 122127.
Wagner W, Keller F, Wiemken A. 1983. Fructan metabolism in cereals: induction in leaves and compartmentation in protoplasts and vacuoles. Zeitschrift für Pflanzenphysiologie 112, 359372.[Web of Science]
Wagner W, Wiemken A. 1987. Enzymology of fructan synthesis in grasses. Plant Physiology 85, 706710.
Wagner W, Wiemken A, Matile P. 1986. Regulation of fructan metabolism in leaves of barley (Hordeum vulgare L. cv. Cultivar Gerbel). Plant Physiology 81, 444447.
Walker RP, Winters AL, Pollock CJ. 1997. Purification and characterization of invertases from leaves of Lolium temulentum. New Phytologist 135, 259266.[CrossRef]
Weber H, Borisjuk L, Heim U, Buchner P, Wobus U. 1995. Seed coat-associated invertases of fava bean control both unloading and storage functions; cloning of cDNAs and all type-specific expression. The Plant Cell 7, 18351846.[Abstract]
Wei JZ, Chatterton NJ. 2001. Fructan biosynthesis and fructosyltransferase evolution: expression of the 6-SFT (sucrose:fructan 6-fructosyltransferase) gene in crested wheatgrass (Agropyron cristatum). Journal of Plant Physiology 158, 12031213.[CrossRef][Web of Science]
Weil M, Rausch T. 1990. Cell-wall invertase in tobacco crown gall cellsenzyme properties and regulation by auxin. Plant Physiology 94, 15751581.
Winters AL, Gallagher J, Pollock CJ, Farrar JF. 1995. Isolation of a gene expressed during sucrose accumulation in leaves of Lolium temulentum L. Journal of Experimental Botany 46, 13451350.
Winters AL, Williams JHH, Thomas DS, Pollock CJ. 1994. Changes in gene-expression in response to sucrose accumulation in leaf tissue of Lolium temulentum L. New Phytologist 128, 591600.[CrossRef]
Yelle S, Chetelat RJ, Dorais M, Deverna JW, Bennett AB. 1991. Sink metabolism in tomato fruit. IV. Genetic and biochemical analysis of sucrose accumulation. Plant Physiology 95, 10261035.
Xu J, Avigne WT, McCarthy DR, Koch KE. 1996. A similar dichotomy of sugar modulation and developmental expression affects both paths ofsucrofe metabolism: evidence from a maize invertase gene family. The Plant Cell 8, 12091220.[Abstract]
Zhang L, Cohn NS, Mitchell JP. 1996. Induction of a pea cell-wall invertase gene by wounding and its localized expression in phloem. Plant Physiology 112, 11111117.[Abstract]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
K.-i. Tamura, A. Kawakami, Y. Sanada, K. Tase, T. Komatsu, and M. Yoshida Cloning and functional analysis of a fructosyltransferase cDNA for synthesis of highly polymerized levans in timothy (Phleum pratense L.) J. Exp. Bot., March 1, 2009; 60(3): 893 - 905. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. del Viso, A. F. Puebla, C. M. Fusari, A. C. Casabuono, A. S. Couto, H. G. Pontis, H. E. Hopp, and R. A. Heinz Molecular Characterization of a Putative Sucrose:Fructan 6-Fructosyltransferase (6-SFT) of the Cold-Resistant Patagonian Grass Bromus pictus Associated With Fructan Accumulation Under Low Temperatures Plant Cell Physiol., March 1, 2009; 50(3): 489 - 503. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Skot, J. Humphreys, M. O. Humphreys, D. Thorogood, J. Gallagher, R. Sanderson, I. P. Armstead, and I. D. Thomas Association of Candidate Genes With Flowering Time and Water-Soluble Carbohydrate Content in Lolium perenne (L.) Genetics, September 1, 2007; 177(1): 535 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lasseur, J. Lothier, A. Djoumad, B. De Coninck, S. Smeekens, A. Van Laere, A. Morvan-Bertrand, W. Van den Ende, and M.-P. Prud'homme Molecular and functional characterization of a cDNA encoding fructan:fructan 6G-fructosyltransferase (6G-FFT)/fructan:fructan 1-fructosyltransferase (1-FFT) from perennial ryegrass (Lolium perenne L.) J. Exp. Bot., August 1, 2006; 57(11): 2719 - 2734. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










