JXB Advance Access originally published online on January 30, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Experimental Botany, Vol. 55, No. 397, pp. 585-594, March 1, 2004
© 2004 Oxford University Press
Cell and Molecular Biology, Biochemistry and Molecular Physiology |
Effect of salt and osmotic stresses on the expression of genes for the vacuolar H+-pyrophosphatase, H+-ATPase subunit A, and Na+/H+ antiporter from barley*
Received 16 May 2003; Accepted 13 November 2003


1 National Institute of Agrobiological Sciences, Kannondai 2-1-2, Tsukuba, Ibaraki 305-8602, Japan
2 Institute of Biological Sciences, University of Tsukuba, Tennoudai 1-1-1, Tsukuba, Ibaraki 305-8572, Japan
3 Laboratory of Cell Dynamics, Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601, Japan
* The nucleotide sequences reported in this paper have been submitted to the DDBJ/EMBL/GenBank with accession numbers AB032839 (HVP1), AB032840 (HvVHA-A), and AB089197 (HvNHX1).
To whom correspondence should be addressed. Fax: +81 29 838 8347. E-mail: fukuda{at}affrc.go.jp
Present address: Brewing Group, Takasaki Plant, Kirin Brewery Company, Limited, Miyahara-cho, Takasaki, Gunma 370-1202, Japan.
Abbreviations: ORF, open reading frame; RACE, rapid amplification of cDNA ends; UTR, untranslated region; V-ATPase, vacuolar H+-ATPase; V-PPase, vacuolar H+-inorganic pyrophosphatase.
| Abstract |
|---|
|
|
|---|
Two cDNA clones encoding vacuolar H+-inorganic pyrophosphatase (HVP1 and HVP10), one clone encoding the catalytic subunit (68 kDa) of vacuolar H+-ATPase (HvVHA-A), and one clone encoding vacuolar Na+/H+ antiporter (HvNHX1) were isolated from barley (Hordeum vulgare), a salt-tolerant crop. Salt stress increased the transcript levels of HVP1, HVP10, HvVHA-A, and HvNHX1, and osmotic stress also increased the transcript levels of HVP1 and HvNHX1 in barley roots. The transcription of HVP1 in response to salt stress was regulated differently from that of HVP10. In addition, the HVP1 expression changed in a pattern similar to that of HvNHX1 expression. These results indicate that the expression of HVP1 is co-ordinated with that of HvNHX1 in barley roots in response to salt and osmotic stresses.
Key words: Barley (Hordeum vulgare), Na+/H+ antiporter, salt stress, vacuolar H+-ATPase (EC 3.6.1.3), vacuolar H+-inorganic pyrophosphatase (EC 3.6.1.1).
| Introduction |
|---|
|
|
|---|
The Na+/H+ antiporter (exchanger) catalyses the exchange of Na+ for H+ across membranes. Although the antiporters are found in animals, yeasts, bacteria, and plants, antiporter activity in the vacuolar membranes has only been reported in yeast, algae, and plants (Blumwald et al., 2000). In plants, the Na+/H+ antiporter in vacuolar membranes transports Na+ from the cytoplasm to vacuoles using the electrochemical H+ gradient generated by two H+-pumps, vacuolar H+-inorganic pyrophosphatase (V-PPase, EC 3.6.1.1 [EC] ) and vacuolar H+-ATPase (V-ATPase, EC 3.6.1.3 [EC] ). The plant cells treated with high salinity must maintain a higher K+/Na+ ratio in the cytoplasm and control the osmotic balance of the cell with the environment by accumulating Na+ in the vacuoles. In this process, the vacuolar Na+/H+ antiporter is thought to play an important role(s).
A vacuolar Na+/H+ antiporter gene (AtNHX1) has been cloned from Arabidopsis thaliana as the first plant homologue to a vacuolar Na+/H+ exchanger gene (ScNHX1) in Saccharomyces cerevisiae (Gaxiola et al., 1999). Several Na+/H+ antiporter genes have now been reported in Oryza sativa (Fukuda et al., 1999), Mesembryanthemum crystallinum (Chauhan et al., 2000), Ipomoea nil (Fukuda-Tanaka et al., 2000), and Atriplex gmelini (Hamada et al., 2001). The increased expression of the antiporter genes by salt stress has been reported in the glycophytes, A. thaliana and O. sativa, and in the halophytes, M. crystallinum and A. gmelini. Antiporter activity is also activated by salt stress in salt-tolerant plants, such as barley (Hordeum vulgare) (Garbarino and DuPont, 1988, 1989; Fukuda et al., 1998) and Beta vulgaris (Blumwald et al., 1985). These results indicate that the vacuolar Na+/H+ antiporters play important roles in the salt-tolerance of a wide variety of plants. In fact, overexpression of AtNHX1 increased salt-tolerance in A. thaliana, Lycopersicon esculentum, and Brassica napus (Apse et al., 1999; Zhang and Blumwald, 2001; Zhang et al., 2001).
The electrochemical H+ gradient across vacuolar membranes generated by V-PPase and V-ATPase is the driving force for the accumulation of ions and other solutes into the vacuoles (Sze et al., 1992), indicating that the two H+ pumps have essential roles in the response to environmental changes such as salt stress. Although V-ATPase is a widespread membrane protein that is found in all eukaryotes, V-PPase has only been found in plants and a few algae, protozoa, bacteria, and archaebacteria (Maeshima, 2000). In addition, V-PPase is a unique proton pump that consists of a single polypeptide and exists as a dimer of subunits of 7180 kDa (Maeshima, 2000). Several cDNA clones of the V-PPase have been isolated from various plants (Maeshima, 2000). Two V-PPase clones from barley have previously been isolated and one (HVP10) has been described (Tanaka et al., 1993). V-ATPase of plants is a multimeric protein of about 400650 kDa consisting of up to ten subunits which involve a putative catalytic <70 kDa subunit (subunit A) (Sze et al., 1992). Clones of the subunit A of V-ATPase have been isolated from Daucus carota (Zimniak et al., 1988), Gossypium hirsutum (Wilkins, 1993), B. napus (Orr et al., 1995), and B. vulgaris (Lehr et al., 1999).
Salt stress has been reported to increase the activities of the H+-pumps. Salt treatment elevated the activity (Sanchez-Aguayo et al., 1991; Fukuda et al., 1998) and the transcript levels of subunits A and c of V-ATPase (Narasimhan et al., 1991; Perera et al., 1995; Binzel and Dunlap, 1995; Kirsch et al., 1996; Tsiantis et al., 1996; Lehr et al., 1999). Salt treatment also elevated V-PPase activity in D. carota (Colombo and Cerana, 1993) and Acer pseudoplatanus (Zingarelli et al., 1994). However, the effect of salt treatment on the transcript levels of V-PPase is unknown. In addition, there have been no reports on the simultaneous analysis of the effects of salt stress on the transcript levels of the two H+-pumps and Na+/H+ antiporter.
In this paper, the effects are reported of salt and osmotic stresses on the expression of V-PPase genes, the subunit A (68 kDa) gene of V-ATPase, and a Na+/H+ antiporter gene from barley.
| Materials and methods |
|---|
|
|
|---|
Plant materials
Barley (Hordeum vulgare cv. Kashima) seeds were imbibed overnight and placed on a cotton mesh suspended over an aerated nutrient solution (Tanaka et al., 1993). The composition of the solution was as follows: 1 mM NH4H2PO4, 2 mM KNO3, 1 mM MgSO4, 25 µM Fe-EDTA, 1 mM CaCl2, and micronutrients. The imbibed seeds were grown for 6 d over the half-diluted solution and then grown over the undiluted solution in a growth chamber with a light/dark cycle of 13/11 h at 27/22 °C under a relative humidity of 74% with a photon flux density of 100 µmol m2 s1. The plants which were grown for 7 d after sowing were stressed as indicated.
Yeast strains and media
The two strains, K601 (wild type) and R100 (
nhx1::URA3) (kindly provided by Dr R Rao, Johns Hopkins University, USA), used in this study are isogenic to W303 (ade2-1 can1-100 his3-11, 15 leu2-3, 112 trp1-1 ura3-1) and have been described previously (Nass et al., 1997). Cells were grown in YPD [1% (w/v) yeast extract/2% (w/v) peptone/2% (w/v) glucose), SD (0.67% (w/v) Yeast Nitrogen Base (Difco Laboratory, Detroit, MI) with 2% (w/v) glucose], or APG medium containing 10 mM arginine, 8 mM phosphoric acid, 2 mM MgSO4, 1 mM KCl, 0.2 mM CaCl2, 2% (w/v) glucose, and trace vitamins and minerals, at pH 6.5 with arginine (Nass et al., 1997). Where indicated, NaCl or hygromycin-B was added, or the pH was adjusted to 4.0 with acetic acid.
Isolation of HVP1, HVP10, and HvVHA-A
Two cDNA clones encoding V-PPase and one clone encoding the subunit A (68 kDa) of V-ATPase were isolated from a cDNA library which was constructed from poly(A+) RNA prepared from barley roots, and the cDNA clones of the H+-pumps were detected by immunoscreening using antibodies raised against V-PPase and the subunit A of V-ATPase from Vigna radiata, as previously reported (Tanaka et al., 1993).
Isolation of HvNHX1
First-strand cDNA was synthesized by reverse transcription (AMV Reverse Transcriptase, Amersham Pharmacia Bitotech, Cleveland, OH) of poly(A+) RNA prepared from barley roots and subsequently amplified with two degenerated oligonucleotides based on the sequence of AtNHX1 and OsNHX1. The sequences of the primers were: 5'-primer d(GAGGTTGCCCTTATGATGCT) and 3'-primer d(GTGCTAAAAAGANNGACAGT). The PCR product (536 bp) was subcloned into pBluescript II KS+ (Stratagene, San Diego, CA) and sequenced. The partial clone had homology to AtNHX1 and OsNHX1. Based on the sequence of the clone, and 5'- and 3'-rapid amplification of cDNA ends (RACE), cDNA was synthesized with 5'-RACE Systems (Life Technologies, Rockville, MD) and a Marathon cDNA Ampification Kit (Clontech Laboratories, Palo Alto, CA). The cDNA clones obtained were sequenced, and had the sequence identical to the partial clone. The cDNA including the full length of the gene was synthesized by PCR using 5' and 3' end-primers based on the 5'- and 3'-RACE cDNAs. The full cDNA clone obtained was subcloned and sequenced.
Expression of HvNHX1 in yeast
The open reading frame (ORF) of HvNHX1 was obtained from the cDNA including the full length of the gene by PCR using the 5'-primer d(CGGAATTCATGGCGTTCGAAGTGGTGGC) and 3'-primer d(ACGCGTCGACAGCTGTAATGGCTTTTCTCT) which included EcoRI and SalI restriction sites, respectively on the 5' ends. The resulting fragment was subcloned into pBluescript II KS+ and sequenced to verify the reliability of the PCR product. The HvNHX1 ORF was inserted into the EcoRI/SalI site of pKT10+HIS3, which was derived from the yeastE. coli shuttle vector pKT10 (Tanaka et al., 1990) by inserting HIS3 downstream of the GAP promoter, producing the plasmid pHvNHX1. K601 and R100 were transformed using the lithium acetate method (Gietz and Schiestl, 1995).
Tonoplast preparation and measurement of proton-translocating activity by V-PPase
Tonoplast vesicles were isolated from barley roots stressed as indicated using the method described previously (Fukuda et al., 1998). Proton-translocating activity by V-PPase in tonoplast vesicles was measured using the modified method of Maeshima and Yoshida (1989). The pH gradient generated by V-PPase was formed in 25 mM MOPS-KOH, pH 7.3, containing 50 mM KCl, 1 mM MgCl2, 1 mM EGTA, 3 µM acridine orange, and 0.25 M sorbitol. Tonoplast vesicles were added to 400 µl of the assay buffer, and the reaction was started by adding 1 mM K-PPi. Changes in fluorescence were monitored with an Hitachi MPF-2A fluorescence spectrometer set at 492 nm for excitation and 540 nm for emission. Activity was expressed as % quench (Q).
Southern and northern blot analyses
Southern and northern blot analyses were performed using standard procedures (Sambrook et al., 1989). After gel electrophoresis, and blotting of total RNA and digested genomic DNA onto a nylon membrane (Biodyne A; Pall Corporation, Port Washington, NY), hybridization was performed with 32P-labelled cDNA fragments of the 3'-untranslated region (UTR) prepared using a random primer labelling kit (Random Primers System; Takara, Tokyo, Japan) at high stringency. The membrane was exposed to an imaging plate, and the radioimage of the plate was analysed (BAS2000, Fuji, Tokyo). The northern experiments were performed at least twice. Equal loading of RNA blots was assessed by scanning the signals of ribosomal RNA detected with SYBR Green II RNA gel stain (FMC Bioproducts, Rockland, ME).
| Results |
|---|
|
|
|---|
Cloning of the genes for V-PPase and the subunit A of V-ATPase from barley
Two different cDNAs for V-PPase (HVP1 and HVP10) and one cDNA for the subunit A (68 kDa) of V-ATPase (HvVHA-A) were isolated from barley cDNA libraries as described in the Materials and methods. The nucleotide and deduced amino acid sequences of HVP10 (accession number D13472 [GenBank] , Tanaka et al., 1993) have previously been reported (a part of the nucleotide sequence was misread and has recently been revised). The nucleotide sequences of HVP1 and HVP10 have 79.8% identity in their ORF, but 53.3% and 47.7% identities in their 5' and 3' UTRs, respectively. The deduced amino acid sequences of HVP1 and HVP10 contain 771 and 762 amino acid residues, respectively, and have 86.2% identity (Fig. 1). The sequence of the HVP1 protein is similar to the sequences of V-PPases in other plants, such as A. thaliana (AVP1), B. vulgaris, V. radiata, Nicotiana tabacum, O. sativa, and Cucurbita moschata with 8391% identities (Sarafian et al., 1992; Kim et al., 1994; Hung et al., 1995; Lerchl et al., 1995; Sakakibara et al., 1996; Maruyama et al., 1998).
|
The sequence of HvVHA-A is 2281 bp with a 5'- UTR of 55 bp, an ORF of 1866 bp, a 3'-UTR of 340 bp, and a poly A tail of 20 bp. The amino acid sequence deduced from the ORF contains 621 amino acid residues with a calculated molecular weight of 68 452, and has about 90% identity with those from D. carota (accession number AAA33139 [GenBank] Zimniak et al., 1988), G. hirsutum (AAA33050 [GenBank] Wilkins, 1993), B. napus (AAA82881 [GenBank] Orr et al., 1995), and B. vulgaris (CAA67305 [GenBank] Lehr et al., 1999). In addition, the calculated molecular weight is similar to that (68 kDa) of a purified subunit A protein of barley V-ATPase (DuPont and Morrissey, 1992). The sequences of 249GAFGC GKT257.. ^..278GER280.. ^..331GITIAEYFRDMG342 in the HvVHA-A protein are highly conserved within plant and fungal V-ATPases (Sze et al., 1992).
Cloning of a vacuolar Na+/H+ antiporter gene from barley
A cDNA clone (HvNHX1) encoding vacuolar Na+/H+ antiporter in barley was isolated. The sequence of HvNHX1 was 2564 bp with a 5'- UTR of 391 bp, an ORF of 1617 bp, and a 3'-UTR of 556 bp. The amino acid sequence deduced from the ORF revealed that the cDNA encodes a protein of 538 amino acids with a calculated molecular weight of 59 244. The deduced amino acid sequence (HvNHX1) had high similarity to OsNHX1 (90%) (Fukuda et al., 1999) and AtNHX1 (72%) (Gaxiola et al., 1999), and 27% identity with ScNHX1 (Nass et al., 1997). The amino acid sequence of HvNHX1 also had 70% identity with HvNHX2 (accession number AAO91943
[GenBank]
which was recently submitted to the DDBJ/EMBL/GenBank. In addition, the deduced amino acid sequence of HvNHX1 had a sequence of 86LFFIYLLPPI95 that is highly conserved within plant, yeast, and mammalian Na+/H+ antiporters (Fig. 2). The region was identified as the binding site of amiloride that inhibits the eukaryotic Na+/H+ antiporter (Counillon et al., 1993).
|
Yeast complementation of HvNHX1
The ability of HvNHX1 to suppress the Na+, Li+, and hygromycin sensitivity of yeast nhx1 mutants was tested. Overexpression of HvNHX1 increased the tolerance to Na+ and Li+ of nhx1 mutants to an extent similar to the wild type under conditions in which the K+ concentration was reduced (APG medium containing 1 mM K+), and also increased the tolerance to hygromycin of nhx1 mutants (Fig. 3). These results indicate that the HvNHX1 gene encodes a vacuolar Na+/H+ antiporter that has a function similar to ScNHX1 protein.
|
Southern blot analysis
Southern blot analyses of genomic DNA digested with some restriction enzymes were performed in order to determine the number of genes for HVP1, HVP10, HvVHA-A, and HvNHX1 in barley, using the specific probes for the each gene. A single band was detected in the analysis with the restriction enzymes, indicating that the barley genome possesses a single copy for each gene of HVP1, HVP10, HvVHA-A, and HvNHX1 (Fig. 4).
|
Effect of salt stress on V-PPase activity in barley
It has been reported that the Na+/H+ antiport activity and proton-translocating activity by V-ATPase in tonoplast vesicles from barley roots were increased by salt stress (Fukuda et al., 1998). Proton-translocating activity by V-PPase in tonoplast vesicles from barley roots was also increased within 1 h by the addition of 100 mM NaCl to the roots and the activity was higher than that of the control after 1 d of treatment (Fig. 5).
|
Expression of HVP1, HVP10, HvVHA-A, and HvNHX1 in barley
Total RNAs extracted from roots and shoots of barley were subjected to a northern blot analysis. The transcripts of HVP10 were more abundant in roots than in shoots, while that of HVP1 was more abundant in shoots than in roots (Fig. 6).
|
To examine the effect of salt and osmotic stresses on the expression of the H+-pump and Na+/H+ antiporter genes, total RNAs from roots and shoots of 7-d-old barley, after 5 h and 24 h of treatment in a nutrient solution including 200 mM NaCl or 400 mM mannitol, were subjected to a northern blot analysis. Both of the stresses stimulated the transcript levels of the H+-pump and Na+/H+ antiporter genes in roots (Fig. 6). On the other hand, the transcript levels did not change in shoots. As estimated by density scanning, the level of HVP1 transcripts increased 4-fold and 2-fold relative to the controls after 5 h and 24 h, respectively, of treatment with NaCl in roots, and was also stimulated 2-fold relative to the control after 5 h of treatment with mannitol. The increase in the level of HVP1 transcripts due to the salt stress was more than that due to the osmotic stress. The level of HvNHX1 transcripts also increased 5-fold and 2-fold relative to the control after 5 h and 24 h, respectively, of treatment with NaCl in roots, and was stimulated 4-fold relative to the control after 5 h of treatment with mannitol (Fig. 6). In roots, the change of HvNHX1 expression has a pattern similar to that of HVP1 expression. By contrast, the transcript levels of HVP10 and HvVHA-A only increased due to the ionic stress in roots, and the increase was less pronounced than in the case of HVP1 (Fig. 6). The level of HVP10 transcripts increased 1.5-fold relative to the control after 24 h of treatment with NaCl. That of HvVHA-A transcripts increased 1.7-fold relative to the control after 5 h of the treatment with NaCl, and showed a negligible increase after 24 h. In addition, the transcript levels of HVP10 and HvVHA-A in roots decreased after 24 h of the treatment with the osmotic stress.
| Discussion |
|---|
|
|
|---|
Two isoforms (HVP1 and HVP10) encoding V-PPase from barley were cloned. The deduced amino acid sequences of HVP1 and HVP10 have a sequence of DVGADLVGKVE which has been found in plants, Chara, Acetabularia, and Rhodospirillum as a conserved segment and a putative catalytic site of V-PPase (Maeshima, 2000) (Fig. 1). HVP1 also has Cys-635 for N-ethylmaleimide-binding residue, Glu-306, Asp-505, and Glu-752 for N,N'-dicyclohexylcarbodiimide-binding residues, Glu-428 for a putative H+-carrying residue as indicated in Arabidopsis, and these residues were also found in HVP10. In addition, HVP1 and HVP10 have a sequence of EYYTS which is a motif, [DE]YYTS, conserved in most of other V-PPases, but replaced by KYYTD in AVP2, a K+-insensitive (type II) V-PPase (Drozdowicz and Rea, 2001) (Fig. 1). These results indicate that the products of HVP1 and HVP10 have functions of V-PPase and are K+-activated AVP1-like (type I) V-PPases.
The two isoforms of the barley V-PPase gene showed expression that was differently regulated in the tissues (Fig. 6). Results similar to this study have been reported in B. vulgaris and N. tabacum (Kim et al., 1994; Lerchl et al., 1995). These studies showed that the transcripts of V-PPase genes were differentially expressed in leaves and roots of B. vulgaris, or in midribs, stems, and roots of N. tabacum. In these three plants, the nucleotide sequence of the different clones is highly homologous in the ORF, but differs strongly in the UTRs. Maeshima (2000) suggested that the difference in the UTRs caused the different and individual regulation of the V-PPase genes. The expressions of HVP1 and HVP10 may be regulated by the systems similar to the cases in B. vulgaris and N. tabacum.
Salt stress increased the activity of V-PPase in barley roots (Fig. 5). The increased activity of V-PPase by salt stress has also been reported from D. carota (Colombo and Cerana, 1993) and A. pseudoplatanus (Zingarelli et al., 1994). Figure 6 shows that salt stress also increased the transcript levels of HVP1 and HVP10, supporting the results of the activity of V-PPase. Although salt stress increased the transcript level of HvVHA-A like HVP1 and HVP10, the stress slightly affected that of HvVHA-A, compared with the case of HVP1 (Fig. 6). Anoxia or chilling reportedly increased the transcription, the amount, and the activity of V-PPase in seedlings of O. sativa and anoxia only slightly affected the activity of V-ATPase (Carystinos et al., 1995). In the report, the authors suggested that V-PPase complemented the activity of V-ATPase. From these results it is conjectured that V-PPase complements the activity of V-ATPase to sustain the total vacuolar H+-pumping activity increased by salt stress.
Salt stress increased the transcript level of HVP1 in roots for a short time (5 h), and subsequently increased that of HVP10 after treatment for 24 h (Fig. 6). In addition, the osmotic stress (mannitol) increased the transcript level of HVP1, although the stress did not increase that of HVP10. These results indicate that the two isoforms of V-PPase are expressed differently in response to ionic and osmotic stresses. Although the characteristics of the enzymes encoded by the HVP1 and HVP10 genes are unknown, each of the two isoforms might play a unique role in the tolerance to ionic and osmotic stresses. Further investigations will be needed to determine whether the characteristics of the isozymes of V-PPase are different.
HvNHX1 shares high similarity with plant, yeast, and mammalian Na+/H+ antiporters within predicted transmembrane segments (data not shown) and a putative amiloride-binding domain (Fig. 2). In addition, HvNHX1 had the ability to suppress the Na+, Li+, and hygromycin sensitivity of yeast nhx1 mutants (Fig. 3). From these results it is conjectured that the HvNHX1 product is localized in vacuolar and/or prevacuolar membranes of the yeast and functions as a Na+/H+ antiporter. However, the nhx1 mutants overexpressing HvNHX1 had lower tolerance to Na+ and hygromycin than the wild type, as reported for AtNHX1 and AgNHX1 (Gaxiola et al., 1999; Quintero et al., 2000; Hamada et al., 2001). Darley et al. (2000) suggested that the N-terminal sequence of ScNHX1 played a role in targeting the ScNHX1 protein to its correct location or in modifying the protein for functional regulation. In their report, the nhx1 mutants overexpressing AtNHX1 ORF fused with the N-terminal sequence had higher tolerance to hygromycin than the mutants overexpressing only the AtNHX1 ORF. Judging from their finding, the lack of the N-terminal sequence in the construction of the yeast expression vectors used in this study might explain why the nhx1 mutants overexpressing HvNHX1 showed lower tolerance to Na+ and hygromycin than the wild type.
Although the transcript level of HvNHX1 in roots increased greatly after salt stress for 5 h and 24 h, the transcript level in shoots showed a negligible increase in response to the stress (Fig. 6). By contrast, the transcript level of a Na+/H+ antiporter gene in O. sativa, OsNHX1, increased after 24 h of treatment with 100 mM NaCl both in roots and shoots (Fukuda et al., 1999). Similar results were obtained in O. sativa treated with 200 mM NaCl (data not shown). These results indicate that the HvNHX1 expression in roots and shoots treated with salt stress changed differently from that of OsNHX1. Garbarino and DuPont (1988) suggested that Na+ was stored in the vacuoles of barley roots, and the flow of Na+ to the shoot was decreased. In addition, the Na+ transport rate from root to shoot was higher in O. sativa than in salt-tolerant reed (Matsushita and Matoh, 1991). According to these results, the greater increase of HvNHX1 expression in roots treated with salt than in shoots might be due to the high limitation of Na+ transport from root to shoot by accumulating Na+ in the root vacuoles, and play an important role in the high salt-tolerance of barley.
The treatment with osmotic stress increased the level of HvNHX1 transcripts (Fig. 6). It has been reported that AtNHX1 protein was able to mediate K+/H+ exchange (Venema et al., 2002). The HvNHX1 protein may transport K+ or other ions from the cytoplasm to vacuoles as an osmoticum.
V-PPase and V-ATPase are important for salt tolerance and osmotic adjustment in plants because the proton-gradient that they produce are the driving force for a Na+/H+ antiporter and other transporters on the vacuolar membranes. Recently, it has been reported that the overexpression of a V-PPase gene, AVP1, increased the salt- and drought-tolerance of A. thaliana accumulating several ions (Gaxiola et al., 2001). In this study, salt and osmotic stresses increased the level of HVP1 transcripts in barley roots in a pattern similar to that of HvNHX1 (Fig. 6). This result indicates that the expression of HVP1 is co-ordinated with that of HvNHX1 in barley roots treated with ionic and osmotic stresses. The experiment with 31P-NMR showed that the vacuolar pH in barley roots increased in response to 100 mM NaCl treatment (Fan et al., 1989; Fukuda et al., 1998). In addition, Fan et al. (1989) showed that Na+ influx into the root cells was accompanied by the vacuolar alkalinization. From these results it has been suggested that a vacuolar Na+/H+ antiporter, but not cationic channels on the vacuolar membranes, mainly functions to accumulate Na+ into the vacuoles, and the stimulated activity of the Na+/H+ antiporter causes the increase of the vacuolar pH which stimulates the activity of the vacuolar H+-pumps. According to the suggestion, the expression of the H+-pump genes may be regulated in response to the vacuolar pH. The transcript level of HVP10 and HvVHA-A increased in barley roots treated with salt stress only, in addition to the increased expression of HVP1 (Fig. 6). The transcript level of HvNHX1 in the salt stress was higher than in the osmotic stress with osmotic potential equal to the salt stress. From these results it is conjectured that the total increased activity of the vacuolar H+-pumps may acidify the vacuolar pH which is increased by the stimulated activity of the HvNHX1 protein in response to salt stress.
The overexpression of a single gene, AtNHX1, has been reported to improve the salt-tolerance of several plants (Apse et al., 1999; Zhang and Blumwald, 2001; Zhang et al., 2001). However, the expression and activity of V-PPase and V-ATPase in the transgenic plants was not reported. Although the activity of the vacuolar H+-pumps may be sufficient to support the increased activity of a vacuolar Na+/H+ antiporter in the transgenic plants, the overexpression of the H+-pumps, in addition to the antiporter, may increase the salt-tolerance of plants more than in the case of the overexpression of the antiporter only. The present results support this possibility.
| Acknowledgements |
|---|
We are grateful to Dr Yoh Wada of Osaka University for the revision of the nucleotide sequence of HVP10. We also thank Kaoru Saeki for technical assistance.
| References |
|---|
|
|
|---|
Apse MP, Aharon GS, Snedden WA, Blumwald E. 1999. Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis thaliana. Science 285, 12561258.
Binzel ML, Dunlap JR. 1995. Abscisic acid does not mediate NaCl-induced accumulation of 70-kDa subunit tonoplast H+-ATPase message in tomato. Planta 197, 563568.
Blumwald E, Aharon GS, Apse MP. 2000. Sodium transport in plant cells. Biochimica et Biophysica Acta 1465, 140151.[Medline]
Blumwald E, Cragoe EJ, Poole RJ. 1985. Na+/H+ antiport in isolated tonoplast vesicles from storage tissue of Beta vulgaris. Plant Physiology 78, 163167.
Carystinos GD, MacDonald HR, Monroy AF, Dhindsa RS, Poole RJ. 1995. Vacuolar H+-translocating pyrophosphatase is induced by anoxia or chilling in seedlings of rice. Plant Physiology 108, 641649.[Abstract]
Chauhan S, Forsthoefel N, Ran Y, Quigley F, Nelson DE, Bohnert HJ. 2000. Na+/myo-inositol symporters and Na+/H+-antiport in Mesembryanthemum crystallinum. The Plant Journal 24, 511522.[CrossRef][Web of Science][Medline]
Colombo R, Cerana R. 1993. Enhanced activity of tonoplast pyrophosphatase in NaCl-grown cells of Daucus carota. Journal of Plant Physiology 142, 226229.[Web of Science]
Counillon L, Franchi A, Pouysségur J. 1993. A point mutation of the Na+/H+ exchanger gene (NHE1) and amplification of the mutated allele confer amiloride resistance upon chronic acidosis. Proceedings of the National Academy of Sciences, USA 90, 45084512.
Darley CP, Wuytswinkel OCM, Woude K, Mager WH, Boer AH. 2000. Arabidopsis thaliana and Saccharomyces cerevisiae NHX1 genes encode amiloride sensitive electroneutral Na+/H+ exchangers. Biochemical Journal 351, 241249.[CrossRef][Web of Science][Medline]
Drozdowicz YM, Rea PA. 2001. Vacuolar H+ pyrophosphatases: from the evolutionary backwaters into the mainstream. Trends in Plant Science 6, 206211.[CrossRef][Web of Science][Medline]
DuPont FM, Morrissey PJ. 1992. Subunit composition and Ca2+-ATPase activity of the vacuolar ATPase from barley roots. Archives of Biochemistry and Biophysics 294, 341346.[CrossRef][Web of Science][Medline]
Fan TWM, Higashi, RM, Norlyn J, Epstein E. 1989. In vivo 23Na and 31P NMR measurement of a tonoplast Na+/H+ exchange process and its characteristics in two barley cultivars. Proceedings of the National Academy of Sciences, USA 86, 98569860.
Fukuda A, Nakamura A, Tanaka Y. 1999. Molecular cloning and expression of the Na+/H+ exchanger gene in Oryza sativa. Biochimica et Biophysica Acta 1446, 149155.[Medline]
Fukuda A, Yazaki Y, Ishikawa T, Koike S, Tanaka Y. 1998. Na+/H+ antiporter in tonoplast vesicles from rice roots. Plant and Cell Physiology 39, 196201.
Fukuda-Tanaka S, Inagaki Y, Yamaguchi T, Saito N, Iida S. 2000. Colour-enhancing protein in blue petals. Nature 407, 581.[Medline]
Garbarino J, DuPont FM. 1988. NaCl induces a Na+/H+ antiport in tonoplast vesicles from barley roots. Plant Physiology 86, 231236.
Garbarino J, DuPont FM. 1989. Rapid induction of Na+/H+ exchange activity in barley root tonoplast. Plant Physiology 89, 14.
Gaxiola RA, Li JS, Undurraga S, Dang LM, Allen GJ, Alper SL, Fink GR. 2001. Drought- and salt-tolerant plants result from overexpression of the AVP1 H+-pump. Proceedings of the National Academy of Sciences, USA 98, 1144411449.
Gaxiola RA, Rao R, Sherman A, Grisafi P, Alper SL, Fink GR. 1999. The Arabidopsis thaliana transporters, AtNHX1 and Avp1, can function in cation detoxification in yeast. Proceedings of the National Academy of Sciences, USA 96, 14801485.
Gietz RD, Schiestl RH. 1995. Transforming yeast with DNA. Methods in Molecular and Cellular Biology 5, 255269.
Hamada A, Shono M, Xia T, Ohta M, Hayashi Y, Tanaka A, Hayakawa T. 2001. Isolation and characterization of a Na+/H+ antiporter gene from the halopyte Atriplex gmelini. Plant Molecular Biology 46, 3542.[CrossRef][Web of Science][Medline]
Hung S-H, Chiu S-J, Lin L-Y, Pan RL. 1995. Vacuolar H+-pyrophosphatase cDNA (Accession No. U31467 [GenBank] ) from etiolated mung bean seedlings. Plant Physiology 109, 1125.
Kim Y, Kim EJ, Rea PA. 1994. Isolation and characterization of cDNAs encoding the vacuolar H+-pyrophosphatase of Beta vulgaris. Plant Physiology 106, 375382.[Abstract]
Kirsch M, Zhigang A, Viereck R, Löw R, Rausch T. 1996. Salt stress induces an increased expression of V-type H+-ATPase in mature sugar beet leaves. Plant Molecular Biology 32, 543547.[CrossRef][Web of Science][Medline]
Lehr A, Kirsch M, Viereck R, Schiemann J, Rausch T. 1999. cDNA and genomic cloning of sugar beet V-type H+-ATPase subunit A and c isoforms: evidence for coordinate expression during plant development and coordinate induction in response to high salinity. Plant Molecular Biology 39, 463475.[CrossRef][Web of Science][Medline]
Lerchl J, König S, Zrenner R, Sonnewald U. 1995. Molecular cloning, characterization and expression analysis of isoforms encoding tonoplast-bound proton-translocating inorganic pyrophosphatase in tobacco. Plant Molecular Biology 29, 833840.[CrossRef][Web of Science][Medline]
Maeshima M. 2000. Vacuolar H+-pyrophosphatase. Biochimica et Biophysica Acta 1465, 3751.[Medline]
Maeshima M. Yoshida S. 1989. Purification and properties of vacuolar membrane proton-translocating inorganic pyrophosphatase from mung bean. Journal of Biological Chemistry 264, 2006820073.
Maruyama C, Tanaka Y, Takeyasu K, Yoshida S, Sato M. 1998. Structural studies of the vacuolar H+-pyrophosphatase: sequence analysis and identification of the residues modified by fluorescent cyclohexylcarbodiimide and maleimide. Plant and Cell Physiology 39, 10451053.
Matsushita N, Matoh T. 1991. Characterization of Na+ exclusion mechanisms of salt tolerant reed plants in comparision with salt-sensitive rice plants. Physiologia Plantarum 83, 170176.
Narasimhan ML, Binzel ML, Perez-Prat E, Chen Z, Nelson DE, Singh NK, Bressan RA, Hasegawa PM. 1991. NaCl regulation of tonoplast ATPase 70-kilodalton subunit mRNA in tobacco cells. Plant Physiology 97, 562568.
Nass R, Cunningham KW, Rao R. 1997. Intracellular sequestration of sodium by a novel Na+/H+ exchanger in yeast is enhanced by mutations in the plasma membrane H+-ATPase. Journal of Biological Chemistry 272, 2614526152.
Orr W, White TC, Iu B, Robert L, Singh J. 1995. Characterization of a low-temperature-induced cDNA from winter Brassica napus encoding the 70 kDa subunit of tonoplast ATPase. Plant Molecular Biology 28, 943948.[CrossRef][Web of Science][Medline]
Perera IY, Li X, Sze H. 1995. Several distinct genes encode nearly identical 16 kDa proteolipids of the vacuolar H+-ATPase from Arabidopsis thaliana. Plant Molecular Biology 29, 227244.[CrossRef][Web of Science][Medline]
Quintero FJ, Blatt MR, Pardo JM. 2000. Functional conservation between yeast and plant endosomal Na+/H+ antiporters. FEBS Letters 471, 224228.[CrossRef][Web of Science][Medline]
Sakakibara Y, Kobayashi H, Kasamo K. 1996. Isolation and characterization of cDNAs encoding vacuolar H+-pyrophosphatase isoforms from rice (Oryza sativa L.). Plant Molecular Biology 31, 10291038.[CrossRef][Web of Science][Medline]
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sanchez-Aguayo I, Gonzalez-Utor AL, Medina A. 1991. Cytochemical localization of ATPase activity in salt-treated and salt-free grown Lycopersicon esculentum roots. Plant Physiology 96, 153158.
Sarafian V, Kim Y, Poole RJ, Rea PA. 1992. Molecular cloning and sequence of cDNA encoding the pyrophosphate-energized vacuolar membrane proton pump of Arabidopsis thaliana. Proceedings of the National Academy of Sciences, USA 89, 17751779.
Sze H. Ward JM, Lai S. 1992. Vacuolar H+-translocating ATPase from plants: structure, function, and isoforms. Journal of Bioenergetics and Biomembranes 24, 371381.[CrossRef][Web of Science][Medline]
Tanaka K, Nakafuku M, Tamanoi F, Kaijo Y, Matsumoto K, Toh-e A. 1990. IRA2, a second gene of Saccharomyces cerevisiae that encodes a protein with a domain homologous to mammalian ras GTPase-activating protein. Molecular and Cellular Biology 10, 43034313.
Tanaka Y, Chiba K, Maeda M, Maeshima M. 1993. Molecular cloning of cDNA for vacuolar membrane proton-translocating inorganic pyrophosphatase in Hordeum vulgare. Biochemical and Biophysical Research Communications 190, 11101114.[CrossRef][Web of Science][Medline]
Thompson J, Higgins DG, Gibson TJ. 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 46734680.
Tsiantis MS, Bartholomew DM, Smith JAC. 1996. Salt regulation of transcript levels for the c subunit of a leaf vacuolar H+-ATPase in the halophyte Mesembryanthemum crystallinum. The Plant Journal 9, 729736.[CrossRef][Web of Science][Medline]
Venema K, Quintero FJ, Pardo JM, Donaire JP. 2002. The Arabidopsis Na+/H+ exchanger AtNHX1 catalyses low affinity Na+ and K+ transport in reconstituted liposomes. Journal of Biological Chemistry 277, 24132418.
Wilkins TA. 1993. Vacuolar H+-ATPase 69-kilodalton catalytic subunit cDNA from developing cotton (Gossypium hirsutum) ovules. Plant Physiology 102, 679680.[CrossRef][Web of Science][Medline]
Zimniak L, Dittrich R, Gogarten JP, Kibak H, Taiz L. 1988. The cDNA sequence of the 69-kDa subunit of the carrot vacuolar H+-ATPase: homology to the beta-chain of F0F1-ATPases. Journal of Biological Chemistry 263, 91029112.
Zhang HX, Blumwald E. 2001. Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit. Nature Biotechnology 19, 765768.[CrossRef][Web of Science][Medline]
Zhang HX, Hodson JN, Williams JP, Blumwald E. 2001. Engineering salt-tolerant Brassica plants: characterization of yield and seed oil quality in transgenic plants with increased vacuolar sodium accumulation. Proceedings of the National Academy of Sciences, USA 98, 1283212836.
Zingarelli L, Anzani P, Lado P. 1994. Enhanced K+-stimulated pyrophosphatase activity in NaCl-adapted cells of Acer pseudoplatanus. Physiologia Plantarum 91, 510516.[CrossRef]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Marzin, R. Mihaly, J. Pauk, and P. Schweizer A transient assay system for the assessment of cell-autonomous gene function in dehydration-stressed barley J. Exp. Bot., September 1, 2008; 59(12): 3359 - 3369. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Medina, M. L. Ballesteros, and J. Salinas Phylogenetic and functional analysis of Arabidopsis RCI2 genes J. Exp. Bot., December 1, 2007; 58(15-16): 4333 - 4346. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Gao, Q. Gao, X. Duan, G. Yue, A. Yang, and J. Zhang Cloning of an H+-PPase gene from Thellungiella halophila and its heterologous expression to improve tobacco salt tolerance J. Exp. Bot., September 1, 2006; 57(12): 3259 - 3270. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Vera-Estrella, B. J. Barkla, L. Garcia-Ramirez, and O. Pantoja Salt Stress in Thellungiella halophila Activates Na+ Transport Mechanisms Required for Salinity Tolerance Plant Physiology, November 1, 2005; 139(3): 1507 - 1517. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. AGARWAL and A. GROVER Isolation and Transcription Profiling of Low-O2 Stress-Associated cDNA Clones from the Flooding-stress-tolerant FR13A Rice Genotype Ann. Bot., October 1, 2005; 96(5): 831 - 844. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Brett, M. Donowitz, and R. Rao Evolutionary origins of eukaryotic sodium/proton exchangers Am J Physiol Cell Physiol, February 1, 2005; 288(2): C223 - C239. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ohnishi, S. Fukada-Tanaka, A. Hoshino, J. Takada, Y. Inagaki, and S. Iida Characterization of a Novel Na+/H+ Antiporter Gene InNHX2 and Comparison of InNHX2 with InNHX1, Which is Responsible for Blue Flower Coloration by Increasing the Vacuolar pH in the Japanese Morning Glory Plant Cell Physiol., February 1, 2005; 46(2): 259 - 267. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











