JXB Advance Access originally published online on March 12, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Experimental Botany, Vol. 55, No. 399, pp. 1145-1148, May 1, 2004
© 2004 Oxford University Press
GENE NOTE |
Cloning of a cDNA encoding an ETR2-like protein (Os-ERL1) from deep water rice (Oryza sativa L.) and increase in its mRNA level by submergence, ethylene, and gibberellin treatments
Received 16 December 2003; Accepted 21 January 2004
1 Division of Biological Resource Science, Graduate School of Agricultural Science, Tohoku University, Kawatabi, Naruko Miyagi 989-6711, Japan
2 Division of Life Science, Graduate School of Agricultural Science, Tohoku University, Sendai, Miyagi 981-8555 Japan
* To whom correspondence should be addressed. Fax:+81 229 84 6490. E-mail: watanabe{at}bios.tohoku.ac.jp
 |
Abstract |
|---|
 Top Abstract References |
|---|
A cDNA from deep water rice treated with ethylene, encoding an ethylene receptor homologous to Arabidopsis thaliana ETR2 and EIN4, was isolated using differential display and RACE techniques. The cDNA (2880 bp), corresponding to the Os-ERL1 gene (Oryza sativa ETHYLENE RESPONSE 2 like 1; GenBank accession number AB107219 [GenBank] ), contained an open reading frame of 2289 bp coding for 763 amino acids. The protein Os-ERL1 has 50% and 52% similarity to Arabidopsis ETR2 and EIN4, respectively. The Os-ERL1 gene was up-regulated by flooding, and by treatment with ethylene and gibberellin. These results suggest that deep water rice responds to flooding by increasing the number of its ethylene receptors.
Key words: Deep water rice (Oryza sativa L.), differential display, ethylene receptor, gibberellin, internode elongation, submergence.
|
|
TopAbstractReferences |
|---|
Deep water rice is mainly cultivated in the flood areas of south-east Asia. The remarkable feature of this rice ecotype is its ability to elongate in response to flooding, thus making rice cultivation possible even under unfavourable environmental conditions. In earlier studies, it was shown that ethylene was synthesized and accumulated in submerged internode tissues, and thus stimulates the elongation of deep water rice internodes and accelerates the growth of submerged deep water rice (Ruskin and Kende, 1984; Metraux and Kende, 1983). To date, there have been several investigations on identifying the genes encoding ethylene biosynthetic enzymes in rice (Mekhedov and Kende, 1996; Zarembinski and Theologies, 1993; Zhou et al., 2002). In addition, the Os-TMK gene encoding a leucine-rich repeat receptor-like protein kinase has been cloned in deep water rice (Van der Knaap et al., 1999). However, very little work is currently available on the involvement of receptor genes in ethylene perception during accelerated growth of deep water rice.
In the present study, a cDNA clone coding for an ethylene receptor gene, similar to those of Arabidopsis thaliana, was isolated. Rice stem sections, 20 cm including intercalary meristem, were excised from 12-week-old deep water rice plants. Stem sections were placed upright in a 300 ml glass beaker containing 40 ml of distilled water. Each beaker was placed in a 5.5 l desiccator with a glass inlet tube fitted with a rubber cap through which ethylene was introduced using a gas-tight syringe when necessary. Stem sections were incubated for 3 h in 10 µl l–1 ethylene or under ethylene-free conditions as a control (Metraux and Kende, 1983; Suge, 1985). To set up ethylene-free conditions, three 50 ml glass beakers filled with Purafil (Purafil Inc., Atranta, GA) were enclosed in a desiccator to deplete any endogenously evolved ethylene. Total RNA was isolated from the ethylene-treated and control rice internodes (Verwoerd et al., 1989) and used for differential display analysis (Liang and Pardee, 1992). First, a partial-length cDNA was cloned by differential display with primers H-T11A (AAGCT11A) as a 3' primer and CGCCGTTCGG as a 5' primer. Using the nucleotide sequence of this partial-length cDNA, sequence specific primers for 5' RACE (rapid amplification of cDNA ends; Frohman et al., 1988) were designed. Then, the upstream region of cDNA was obtained by 5' RACE. The two cDNAs were reconstituted to make a composite cDNA. Finally, a full-length cDNA was amplified with primers derived from both ends of the composite cDNA and total RNA as template, and designated Os-ERL1 cDNA (Oryza sativa ETHYLENE RESPONSE 2 like 1, accession number AB107219 [GenBank] ). The sequences of primers used were GCGAATTCACACGCACGCAGCTTCCTC for the 5' primer and TATCTAGAGTAAGTTCTAACTGTATGACCTCTTC for the 3' primer. The cDNA was 2880 bp long and contained a 2289 bp open reading frame, a 366 bp 5'-flanking sequence and a 225 bp 3'-flanking sequence with a poly(A) tract. The predicted protein consisted of 763 amino acids and had a calculated molecular mass of 84.8 kDa. Searches of the rice genomic databases according to the procedure proposed by Yuan et al. (2000) revealed that the Os-ERL1 gene resided 12.2 cM from the top of chromosome IV with neighbouring physical markers C19376 [GenBank] and C99161 [GenBank] . A search of the GenBank database showed that Os-ERL1 had an amino acid sequence similar to those of ethylene receptors ETR2 and EIN4 of A. thaliana (Sakai et al., 1998; Hua et al., 1998) and ZmETR2 from Zea mays (accession number AB040406 [GenBank] ); with 50%, 52%, and 80% similarity, respectively. The deduced Os-ERL1 protein had a primary structure similar to that of ETR2 (Sakai et al., 1998). It consisted of an amino-terminal domain, a putative histidine kinase domain, and a receiver domain. An alignment of deduced amino acid sequences of Os-ERL1 and other ethylene receptors is shown in Fig. 1. Three membrane-spanning regions essential for ethylene binding are well conserved. In addition, Os-ERL1 had a fourth predicted membrane-spanning domain within an amino-terminal extension of the protein. An alternative prediction using the method of Hofman and Stoffel (1993) positioned the fourth membrane-spanning domain in Os-ERL1. While ETR1 had all of the five conserved motifs (H, N, G1, F, and G2) in bacterial histidine kinases, Os-ERL1 was more divergent from the consensus sequence; most of the motifs of histidine kinases were not easily detectable. Moreover, the conserved H residue in the H motif, the possible phosphorylation site in bacterial two-component proteins, was replaced by a D residue in Os-ERL1. This H residue is also replaced by a D residue in ZmETR2. Limited sequence similarity to the N motif was present in Os-ERL1, but the two N residues were absent as in ETR2 and EIN4. Neither the G1 nor the F motifs were found in Os-ERL1. While the G2 motif was also present in ETR2, it was not found in Os-ERL1. Os-ERL1 had a receiver domain, which was also found in ETR2 and EIN4. The D and K residues conserved among the receiver domains of ETR2 and EIN4 were present in Os-ERL1.
|
IV). The boxes indicate the five sequence motifs for a histidine protein kinase domain. Accession numbers: Os-ERL1, AB107219
Fig. 2A shows the time-course of expression of Os-ERL1 transcripts. The Os-ERL1 mRNA accumulated considerably after ethylene treatment at all times tested. In particular, the signals were slightly higher at 2, 5, 6, and 8 h than at other times. Thus, the time-course study up to 24 h revealed that the level of Os-ERL1 transcripts fluctuated slightly in the ethylene-treated deep water rice internodes; its course was not investigated further. Among five ethylene receptor genes of Arabidopsis, the ERS1, ERS2, and ETR2 genes are up-regulated by ethylene treatment, while the ETR1 and EIN4 genes are not responsive to ethylene in Arabidopsis leaves (Hua et al., 1998). Together with the previous findings, it is suggested that Os-ERL1 resembles ETR2 more than EIN4. The amount of Os-ERL1 transcript increased in response to flooding (Fig. 2B). Vriezen et al. (1997) found that the level of RP-ERS1 transcript increased after submergence, as well as after treatment with ethylene, in the shoots and leaves of Rumex palustris, a flooding-tolerant plant. The expression of Os-ERL1 was also induced by ethylene treatment and flooding. However, Os-ERL1 does not belong to the family of ERS1 homologues, because it has a receiver domain. Moreover, the Os-ERL1 transcript accumulated after gibberellin (GA) treatment (Fig. 2C). It was previously proposed that rapid internode growth of deep water rice might result from an ethylene-mediated increase in the ratio of an endogenous growth promoter (GA) and a growth inhibitor (ABA) (Hoffmann and Kende, 1992; Kende et al., 1998). Ethylene enhances the responsiveness of deep water rice internodes to GA (Ruskin and Kende, 1984). Thus, both GA and ethylene play an important role in internode elongation in deep water rice; however, a detailed mechanism for the stimulation of expression of the Os-ERL1 gene by GA treatment remains to be elucidated. Taken together, Os-ERL1 is one of the ethylene receptors in rice and may play a crucial regulatory role in internode elongation of deep water rice.
|
|
Acknowledgement |
|---|
The authors thank the International Rice Research Institute (Los Banos, Philippines) for providing seeds of deep water rice (Oryza sativa L. cv. Pin Gaew 56)
|
References |
|---|
|
TopAbstractReferences |
|---|
Chang C, Kwok SF, Bleecker AB, Meyerowitz EM. 1993. Arabidopsis ethylene-response gene ETR1: similarity of product to two-component regulators. Science 262, 539–544.
Frohman MA, Dush MK, Martin GR. 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences, USA 85, 8998–9002.
Hoffmann BS, Kende H. 1992. On the role of abscisic acid and gibberellin in the regulation of growth in rice. Plant Physiology 99, 1156–1161.
Hofman K, Stoffel W. 1993. Tmbase-A database of membrane spanning protein segments. Biological Chemistry 347, 166.
Hua J, Sakai H, Nourizadeh S, Chen QG, Bleecker AB, Ecker JR, Meyerowitz EM. 1998. EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis. The Plant Cell 10, 1321–1332.
Kende H, Van der Knaap E, Cho HT. 1998. Deep water rice: a model plant to study stem elongation. Plant Physiology 118, 1105–1110.
Liang P, Pardee AB. 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257, 967–971.
Mekhedov SL, Kende H. 1996. Submergence enhances expression of a gene encoding 1-aminocyclopropane-1-carboxylate oxydase in deep water rice. Plant and Cell Physiology 37, 531–537.
Metraux JP, Kende H. 1983. The role of ethylene in the growth response of submerged deep water rice. Plant Physiology 72, 441–446.
Ruskin I, Kende H. 1984. Role of gibberellin in the growth of submerged deep water rice. Plant Physiology 76, 947–950.
Sakai H., Hua J, Chen CG, Chang C, Medrano LJ, Bleecker AB, Meyerowitz EM. 1998. ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis. Proceedings of the National Academy of Sciences, USA 95, 5812–5817.
Suge H. 1985. Ethylene and gibberellin: regulation of internode elongation and nodal root development in floating rice. Plant and Cell Physiology 26, 607–614.
Van der Knaap E, Song WY, Ruan DL, Sauter M, Ronald PC, Kende H. 1999. Expression of a gibberellin-induced leucine-rich repeat receptor-like protein kinase in deepwater rice and its interaction with kinase-associated protein phosphatase. Plant Physiology 120, 559–569.
Verwoerd TC, Dekker BMM, Hoekema A. 1989. A small-scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Research 17, 2362–2363.
Vriezen WH, van Rijn CPE, Voesenek LACJ, Mariani C. 1997. A homolog of the Arabidopsis thaliana ERS gene is actively regulated in Rumex palustris upon flooding. The Plant Journal 11, 1265–1271.[CrossRef][ISI][Medline]
Yuan Q, Liang F, Hsiao J, Zismann V, Benito MI, Quackenbush J, Wing R, Buell R. 2000. Anchoring of rice BAC clones to the rice genetic map in silico. Nucleic Acids Research 28, 3636–3641.
Zarembinski TI, Theologies A. 1993. An aerobiosis and plant growth hormones induce two genes encoding 1-aminocyclopropane-1-carboxylate synthase in rice (Oryza sativa L.). Molecular Biology of the Cell 4, 363–373.[Abstract]
Zhou Z, Engler JDA, Rouan D, Michiels F, Montagu MV, Straeten DVD. 2002. Tissue localization of submergence-induced 1-aminocyclopropane-1-carboxylic acid synthase in rice. Plant Physiology 129, 72–84.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  M. B. Jackson Ethylene-promoted Elongation: an Adaptation to Submergence Stress Ann. Bot., January 1, 2008; 101(2): 229 - 248. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||