Journal of Experimental Botany

JXB Advance Access originally published online on July 16, 2004
Journal of Experimental Botany 2004 55(404):1785-1798; doi:10.1093/jxb/erh201

This Article Abstract FREE Full Text (PDF) All Versions of this Article: 55/404/1785    most recent erh201v1 E-letters: Submit a response Alert me when this article is cited Alert me when E-letters are posted Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (21) Request Permissions Disclaimer Google Scholar Articles by Wirtz, M. Articles by Hell, R. Search for Related Content PubMed PubMed Citation Articles by Wirtz, M. Articles by Hell, R. Agricola Articles by Wirtz, M. Articles by Hell, R. Social Bookmarking          What's this?

Journal of Experimental Botany, Vol. 55, No. 404, © Society for Experimental Biology 2004; all rights reserved

RESEARCH PAPER

O-acetylserine (thiol) lyase: an enigmatic enzyme of plant cysteine biosynthesis revisited in Arabidopsis thaliana

Markus Wirtz¹, Michel Droux² and Rüdiger Hell^1,*

¹Heidelberg Institute of Plant Sciences (HIP), University of Heidelberg, Im Neuenheimer Feld 360, D-69120 Heidelberg, Germany
²Laboratoire Mixte CNRS/Bayer CropScience FRE 2579, 14–20 Rue Pierre Baizet, Bat B1, F-69263 Lyon Cedex 9, France

^* To whom correspondence should be addressed. Fax: +49 6221 545859. E-mail: rhell{at}hip.uni-heidelberg.de

Received 26 January 2004; Accepted 14 May 2004

	Abstract

Top Abstract Introduction Materials and methods Results Discussion References

 
The synthesis of cysteine is positioned at a decisive stage of assimilatory sulphate reduction, marking the fixation of inorganic sulphide into a carbon skeleton. O-acetylserine (thiol) lyase (OAS-TL) catalyses the reaction of inorganic sulphide with O-acetylserine (OAS). Despite its prominent position in the pathway OAS-TL is generally regarded as a non-limiting enzyme without regulatory function, due to low substrate affinities and semi-constitutive expression patterns. To resolve this apparent contradiction, the kinetic properties of three OAS-TLs from Arabidopsis thaliana, localized in the cytosol (A), plastids (B), and mitochondria (C), were analysed. The recombinant expressed OAS-TLs were purified to apparent homogeneity without any fusion tag to maintain their native forms. The proteins displayed high specific activities of 550–900 µmol min^–1 mg^–1. Using an improved and highly sensitive assay method for cysteine determination, the apparent was 3–6 µM for OAS-TL A, B, and C and thus 10–100 times lower than previously reported for plant OAS-TLs. was between 310 µM and 690 µM for OAS-TL isoform A, B, and C, whereas the apparent dissociation binding constant for OAS was much lower (K_d<1 µM OAS). A HPLC method was developed for OAS quantification that revealed fast increases of the cellular OAS concentration in response to sulphate deprivation. The observed fluctuations of intracellular OAS concentrations, combined with the OAS dissociation constant and the catalytic properties of OAS-TL, support the model of a dynamic cysteine synthesis system with regulatory function as can be expected from the position of the reaction in the sulphur assimilation pathway.

Key words: O-acetylserine, cysteine, enzyme kinetics, flux regulation, plants, sulphur metabolism

	Introduction

Top Abstract Introduction Materials and methods Results Discussion References

 
The integration of reduced sulphur into the amino acid cysteine is a central step in the assimilation of inorganic sulphur. In plants, as in bacteria, the reaction is catalysed by O-acetylserine (thiol) lyase (OAS-TL; EC 2.5.1.47 [EC] ; also named cysteine synthase) and requires two substrates: (1) free sulphide, provided by the sulphate reduction pathway, and (2) O-acetylserine (OAS), an energetically activated derivative of serine that is metabolically unique to cysteine synthesis. OAS is generated by serine acetyltransferase (SAT; EC 2.3.1.30 [EC] ) in a reaction catalysed from serine and acetyl coenzyme A (Kredich, 1996; Hell et al., 2002; Hell, 2003; Droux, 2004). The synthesis of cysteine is formally comparable to the fixation of ammonia during inorganic nitrogen assimilation. The synthesis of glutamine from ammonia and glutamate is catalysed by glutamine synthetase (EC 6.3.1.2 [EC] ) as part of the glutamine/2-oxoglutarate cycle. The metabolic flux rate of this reaction in plants is highly regulated at various levels of glutamine synthetase expression, including transcription, post-transcription, and post-translation (Cren and Hirel, 1999). Glutamine synthetase activity is encoded by genes for isoforms with plastid and cytosolic localization. Distinct functions for these compartment-specific isoforms are revealed by differential RNA expression patterns with respect to plant organ and tissue, nitrogen nutrition, photosynthetic conditions, and stress (Cren and Hirel, 1999; Brugière et al., 1999).

Similar regulatory properties can be expected from OAS-TL in plants due to the integral position of the catalysed reaction between assimilatory sulphate reduction and the branching point of pathways that lead to the array of organic compounds containing reduced sulphur (reviewed by Leustek et al., 2000; Hell et al., 2002; Droux, 2004). Surprisingly, however, no significant regulation of this step is known from higher plants. The genes encoding isoforms of OAS-TL proteins are more or less ubiquitously expressed in all plant organ cell types analysed so far with little variation of contents of RNA, protein, and extractable enzyme activity in response to external factors (Brunold, 1990; Hell et al., 1994; Hesse et al., 1999; Dominguez-Solis et al., 2001; Hell, 2003). OAS-TL activity has not only been found in plastids as the site of sulphate reduction, but also in the cytosol and mitochondria (Lunn et al., 1990; Rolland et al., 1992). When assayed at substrate-saturated conditions (i.e. V_max), the activities of all these compartment-specific isoforms are generally orders of magnitude higher than necessary to explain the observed rates of sulphate assimilation. The presumed cellular concentrations of the substrates sulphide and OAS are generally well below the affinities of OAS-TLs and, therefore, should limit cysteine synthesis in vivo (reviewed in Schmidt and Jäger, 1992). Nevertheless, these findings together with feeding studies using H₂S led to the general assumption that OAS-TL had no limiting role in flux regulation (De Kok et al., 2000; Schmidt and Jäger, 1992), but left the open question of an enzyme at a crucial position in one of the primary macronutrient assimilation pathways with highly inefficient substrate affinities and apparently no other regulatory properties.

Detailed analyses of OAS-TL at the regulatory, biochemical, and structural level are available from enterobacteria (Kredich, 1996). OAS-TL in Salmonella typhimurium and Escherichia coli is encoded by two structurally related genes, cysK and cysM, which are subjected to regulation by the cys-regulon. Under aerobic growth conditions and sulphate supply cysK is predominantly expressed, while anaerobic conditions and thiosulphate availability favour cysM expression. As outlined by Kredich (1996), the cysE gene encoding SAT is the only constitutively expressed gene of the cys-regulon. If the generation of sulphide declines, for example, because of lack of sulphate, the SAT reaction product OAS starts to accumulate. OAS converts chemically into N-acetylserine (NAS) at physiological pH. Subsequently, NAS binds to the transcription factor CysB which now recognizes the operator regions of the cys-regulon, thus activating sulphate uptake and assimilation genes. Repression of the regulon is carried out by cysteine which feedback inhibits SAT efficiently (K_i1 µM) and thus keeping OAS at low concentrations in the cell (Kredich, 1996).

The enzymatic pathway of cysteine synthesis has been characterized by the pioneering work of Kredich and colleagues (see Kredich, 1996, for a review). Kredich et al. (1969) provided the first enzymatic data for SAT and OAS-TL as free homomers and also bound in the hetero-oligomeric cysteine synthase complex. They revealed equal substrate affinities of SAT in the complex compared with the homomer, but lower affinities for sulphide and OAS for bound OAS-TL, effectively resulting in partial inactivation compared with free OAS-TL dimers. Accordingly, the earlier hypothesis of substrate channelling of OAS from SAT to OAS-TL within the complex was shown to be unlikely by Cook and Wedding (1977). Since OAS-TL is much less active in the complex, the intermediate OAS readily leaves the complex. In addition, OAS was shown to dissociate the complex, whereas sulphide stabilized it in vitro (Kredich et al., 1969; Cook and Wedding, 1977). These findings were largely confirmed for OAS-TL in the plant cysteine synthase complex, where SAT became more affined to its substrates and OAS-TL almost inactivated in the complex, causing OAS to leave the complex (Droux et al., 1998).

Detailed kinetic analysis of unbound OAS-TL from S. typhimurium revealed a bi-bi ping-pong reaction mechanism. OAS binds first to form an -aminoacrylate in Schiff base with pyridoxal phosphate, indicating a ß-elimination of the acetyl moiety. Subsequently, sulphide binds to the enzyme, probably as HS^–, to undergo a nucleophilic attack of the -aminoacrylate. The first half-reaction has a constant of 1.6x10^–3 M, while the second half-reaction is irreversible, rendering the formation of the -aminoacrylate as limiting for the overall reaction. The reaction follows Michaelis–Menten kinetics and shows no co-operativity for either substrate or one of the two catalytic centres on the homodimer (Cook and Wedding, 1976; Tai et al., 1993, 1995; Woehl et al., 1996).

These findings are corroborated by the three-dimensional structure of OAS-TL from S. typhimurium (Burkhard et al., 1998). Both N- and C-terminus are involved in the formation of the functional homodimer, while the interaction site with SAT is still unknown. Binding of OAS induces a strong conformational shift of the dimer, allowing only small molecules like sulphide to access the catalytic centres of the dimer subunits. A putative allosteric binding site for an anion, possibly HS^–, has been identified, but still needs confirmation (Burkhard et al., 1999, 2000; Tai et al., 2001). It is interesting to note in this context that protein sequences of the three OAS-TLs from A. thaliana are sufficiently similar to CysK to predict three-dimensional structures with high reliability (M Wirtz and R Hell, unpublished data), using computer modelling with Swissprot software (http://swissmodel.expasy.org; Peitsch, 1995; Schwede et al., 2003).

By comparison, relatively little is known about plant OAS-TLs due to the presence of several compartment-specific isoforms with varying substrate specificities. At the genomic level the best investigated plant is A. thaliana which contains at least nine OAS-TL-like genes. The locus identification of these genes and the names of the encoded proteins are presented in Fig. 1, which demonstrates the amino acid sequence relationship of this group. The mainly expressed genes encode the cytosolic (A1), plastid (B), and mitochondrial (C) isoforms (Hell et al., 1994; Hesse et al., 1999; Jost et al., 2000). Another member (AtcysC1) encodes a mitochondrial ß-cyano-alanine synthase that catalyses the detoxification of cyanide with cysteine, forming ß-cyano-alanine and sulphide (Hatzfeld et al., 2000). The other family members in A. thaliana are much less characterized (Yamaguchi et al., 2000). OAS-TLs and ß-cyano-alanine synthase carry out both reactions, however, with different substrate affinities and efficiencies, enabling kinetic discrimination of the physiological function (Burandt et al., 2002; Jost et al., 2000; Warrilow and Hawkesford, 2000). In addition, the situation can be different in other plants. Spinach contains cytosolic and plastid OAS-TL activities, but only mitochondrial ß-cyano-alanine synthase activity (Warrilow and Hawkesford, 2000), while ß-cyano-alanine synthase activity is present in the cytosol and mitochondria of tobacco (Liang and Li, 2001). Various substrates are also accepted, such as azide (Rosichan et al., 1983) or pyrazole (Ikegami et al., 1988), which led to the nomenclature term of ß-alanine substituted synthases (Hatzfeld et al., 2000). With respect to cysteine synthesis the available kinetic data vary widely (Bertagnolli and Wedding, 1977; Kuske et al., 1994; Yamaguchi et al., 2000). The best characterized OAS-TLs are spinach isoenzymes from plastids and the cytosol (Droux et al., 1992; Rolland et al., 1996; Warrilow and Hawkesford 1998, 2000, 2002). Substrate affinities range from 0.3 mM to 8 mM for OAS and from 33 µM to >1 mM for sulphide. Reaction kinetics are described according to Michaelis–Menten, as well as to the Hill equation, with either no, positive or negative co-operativity for both substrates. While it should be cautioned that these divergent values are derived from different isoforms of several plant species with highly variable specific activities depending on the preparation method, these discrepancies make an assessment of the physiological role of OAS-TL in sulphur metabolism difficult.

View larger version (16K): [in this window] [in a new window]   Fig. 1. Sequence relationship of OAS-TL-like proteins in A. thaliana. OAS-TL-like proteins were identified by a homology search in the protein database of TAIR using the conserved sequence motive of OAS-TLs around the pyridoxal binding site. Locus identifications and gene names of putative OAS-TLs were adopted from TAIR nomenclature. The phylogenetic tree of full length OAS-TL like proteins was created with MegAlignTM 5.0 (DNASTAR, Madison).

 
Recently, the cysteine synthase complex has been suggested as the centre of a cellular-metabolite-sensing model based on the association and dissociation of SAT and OAS-TL (Hell and Hillebrand, 2001; Hell et al., 2002; Droux, 2003). According to kinetic analyses, SAT is more or only active in the complex, while OAS-TL is basically inactive in association with SAT and only forms cysteine as a free dimer (Droux et al., 1998). Because SAT activity is always rate-limiting compared with OAS-TL activity (Nakamura and Tamura, 1990; Droux et al., 1998), the amount of SAT protein bound to OAS-TL in the complex determines the rate of OAS formation and, ultimately, of cysteine synthesis. The equilibrium constant and equilibrium rate constant of complex association are governed by OAS concentrations ( Berkowitz et al., 2002). Increases of OAS concentrations are predicted to be a result of sulphide shortage in the cell, while sulphide availability (as a result of sufficient sulphate supply) keeps OAS concentrations low via the activity of free OAS-TL dimers. Importantly, OAS is known to induce genes of sulphate transport and reduction, making more sulphide available for the cell. In essence, the reversible protein–protein interaction of the subunits SAT and OAS-TL of the complex acts as a sensor for sulphide, using OAS and probably also cysteine as a trigger (Hell et al., 2002; Droux, 2003). In this model the inactive state of OAS-TL is required to activate SAT and to release OAS from the cysteine synthase complex while the active state finally catalyses cysteine formation. However, it is unclear how the currently known low affinities of free OAS-TL dimers from plants for sulphide and OAS fit into such a process and whether significant differences between OAS-TL isoforms exist in that respect.

The purpose of this study is a precise assessment of kinetic properties of the three major compartment-specific isoforms of OAS-TL from A. thaliana with emphasis on the potential regulatory function. New refined enzymatic assay techniques were applied to highly active recombinant proteins that were purified to apparent homogeneity as their native mature polypeptides without fusion tags, using conventional column chromatography. The findings suggest much lower K_m values for sulphide than previously known and a regulatory function of OAS-TL activity based on and data as part of the cysteine synthase complex system for flux towards cysteine synthesis as requested by its crucial position in the sulphur assimilation pathway.

	Materials and methods

Top Abstract Introduction Materials and methods Results Discussion References

 
Construction of expression plasmids
Three cDNAs (X80376 [GenBank] , X80377 [GenBank] , and 271727) encoding for cytosolic (A), plastid (B), and mitochondrial (C) OAS-TL isoforms were cloned into NcoI and BamHI restriction sites of the expression plasmid pET3d (Novagen). The desired restriction endonuclease sites were introduced during amplification of cDNAs via PCR. Primer pairs OAS-B (B1: CCATGGCTGTATCTATCAAGCCAGAAG, B2: GGATCCTCAAAGCTCGGGCTGCATTTG) and OAS-C (C1: CCATGGCTGTTAAGCGCGAGACTG, C2: GGATCCTCATACCTCAGGCTGATC) were used to amplify 1074 and 996 bp DNA fragments for OAS-TL B and C, respectively, coding for open reading frames of mature OAS-TLs without transit peptides in E. coli. The entire open reading frame of OAS-TL A (969 bp) was amplified using primer A1 (CCATGGCCTCGAGAATTGCTAAAGATG) and A2 (GGATCCTCAAGCCTCGAAGGTCATGGC). All cloning steps were performed using XL1-Blue bacteria (Stratagene), whereas over-expression of OAS-TL protein was carried out with E. coli strain HMS 174 (DE3) (Novagen).

Expression and purification of O-acetylserine (thiol) lyase
Recombinant OAS-TL isoforms from A. thaliana were purified without affinity tag after optimization of the method described in Rolland et al. (1996) for a recombinant plastid spinach isoform. Bacterial strains were grown at 37 °C in 200 ml of Luria–Bertiani medium (1% (w/v) trypton, 0.5 (w/v) yeast extract, and 1% (w/v) NaCl) supplemented with 100 µg ml^–1 ampicillin, 10 µM pyridoxine, and 15 µM thiamine. At an optical density of 0.8, expression of recombinant proteins was induced by adding 1 mM isopropyl ß-thiogalactopyranoside. Cells were grown for an additional 4 h and harvested by centrifugation for 15 min at 6000 g. The bacteria collected were resuspended in buffer A (10 mM TRIS-HCl pH 7.5, 1 mM dithio-DL-threitol (DTT), 1 mM phenylmethanesulphonyl fluoride) and disrupted by sonication. After centrifugation at 4 °C and 48 000 g for 15 min the soluble bacterial protein of the supernatant was subjected to ammonium sulphate precipitation (30–70%). The resulting precipitate (200 mg protein) was dissolved in buffer A and desalted via a Hiprep^TM 26/10 column (Amersham Biosciences) equilibrated in buffer A. All following purification steps were carried out at 1 ml min^–1 flow rate. The protein extract was loaded on a Fractogel^TM EMD DEAE (M) XK 16 column (50 ml) connected to a Pharmacia FPLC System. Unspecific bound proteins were washed with 40 ml buffer A, whereas OAS-TL was eluted by applying a linear gradient up to 30% buffer B (10 mM TRIS-HCl pH 7.5, 1 mM EDTA, and 1 M NaCl) in 60 min. OAS-TL C eluted at 10 mM NaCl, while isoforms A and B eluted between 20 and 40 mM NaCl. Fractions with OAS-TL activity were pooled, desalted as described above, and loaded on a Matrex^TM Green A XK 16 column (45 ml), which was previously equilibrated in buffer A. The proteins were eluted by applying an isocratic flow of 40 ml buffer A followed by a linear gradient of 50% buffer B in 60 min. While OAS-TL C was apparently pure after chromatography with Green A medium, OAS-TL A and B were further purified by hydrophobic interaction chromatography. Fractions containing OAS-TL A and B were adjusted with solid sodium chloride up to 2 M and loaded onto a HiLoad^TM 26/10 Phenyl Sepharose High Performance column (Amersham Biosciences), equilibrated in buffer C (10 mM TRIS-HCl pH 7.5, 1 mM EDTA, and 2 M NaCl). After washing with 100 ml buffer C and 50% buffer A, proteins were eluted by applying a 100 ml linear gradient from 50% to 100% buffer A. The pure OAS-TL isoforms were desalted and concentrated to a volume of 3 ml with a Centriplus^TM concentrator device (Amicon). The purity of enzyme preparations was analysed by gel electrophoresis and spectral analysis. For all analysed OAS-TL isoforms only single bands were detectable after Coomassie staining and the ratios at 280 and 412 nm were below 2.5. Protein content was measured by the method of Bradford (1976) and SDS-PAGE performed as previously described in Laemmli (1970).

Enzyme assays
OAS-TL activity was measured by following cysteine formation in a volume of 0.1 ml containing 100 mM HEPES-NaOH pH 7.5, 2.5 mM DTT, 10 mM OAS, and 5 mM Na₂S as standard conditions. The reaction, initiated by the addition of OAS, was incubated for 5 min or 10 min at 25 °C and terminated by adding 50 µl of 20% (w/v) tri-chlorine-acetic acid followed by centrifugation at 12 500 g. For determination of K_m values OAS and Na₂S concentrations were varied from 0 to 10 or 5 mM, respectively. Since quantification of cysteine using the method described by Gaitonde (1967) was not sensitive enough to determine product formation at low substrate concentrations (Schmidt, 1990), especially for sulphide, cysteine was quantified after derivatization with the fluorescent dye monobromobimane (Thiolyte, Calbiochem). The OAS-TL concentration in the assay was kept at 0.1–0.5 ng in 0.1 ml assay to ensure excess of substrate over enzyme even at low substrate concentrations. Depending on cysteine formation in the assay, 10 µl or 50 µl of assay supernatant was reduced at room temperature for 60 min in a total volume of 0.27 ml containing 134 mM TRIS-HCl pH 8.3, 1 mM DTT. Afterwards thiols were derivatized for 15 min by adding 0.03 ml monobromobimane to a final concentration of 3 mM, representing more than 2.5-fold excess above the total thiol concentration. The resulting monobromobimane derivatives were stabilized by the addition of 0.7 ml 5% acetic acid and detected by fluorescence (Fluorometer RF 551, Shimadzu) at 480 nm after excitation of the adduct at 380 nm after separation. Separation of the bimane derivative was carried out by reverse-phase HPLC (Waters 600E Multisolvent Delivery system, Autosampler 717plus) connected to a Nova-Pak C18 4.6x250 mm column (pore size 4 µm). Cysteine was separated from substrates of OAS-TL by applying an isocratic flow (1.3 ml min^–1) of buffer A (100 mM potassium acetate pH 5.5, 9% methanol) for 12.5 min. Subsequently, the column matrix was washed with 100% methanol for 3 min and re-equilibrated for 8.5 min in buffer A. Data acquisition and processing was performed with Millenium³² software (Waters, USA).

Spectroscopic methods and kinetic analysis
Absorption spectras of OAS-TL isoforms were recorded in a UVIKON_XL spectrophotometer (Goebel). Various concentrations of OAS-TLs (3–50 µM) were titrated with OAS (0–1000 µM) by addition of 1 µl adjusted OAS solutions in a total volume of 1 ml. Data sets from spectroscopic and enzymatic assays were plotted and fitted using the enzymatic kinetics module of SigmaPlot 2001. Michaelis constants (K_m) were calculated from non-linear regression using Michaelis-Menten equation

and potential co-operativity was analysed by the Hill equation

as described in Segel (1993). In these equations v represents the reaction rate, V_max the apparent maximal activity at substrate saturation, K_m the apparent substrate concentration constant, and h the Hill constant calculated from the rate (v) versus total substrate concentration. The obtained fits and Gaussian distribution of data points were statistically analysed with SigmaStat 3.0 (SPSS Science).

Analysis of sulphur deficiency in vivo
Heterotrophic A. thaliana cell suspensions cultures were grown in 0.3 l Erlenmeyer flasks at 90 rpm and 24 °C in the dark. 1 g of cells were used to inoculate 50 ml 1x MS medium pH 5.7 (Murashige and Skoog, 1962) supplemented with 0.1 g l^–1 ampicillin. To analyse the impact of sulphur deficiency, cells were transferred after 4 d to sulphur-deficient or sulphur-containing MS medium. Sulphur-deficient medium was produced by replacing sulphate (1.5 mM) containing MS-salts with their corresponding chloride salts. Samples were taken up to 3 d after transfer and analysed for protein content, metabolites, and mRNA of sulphate transporter (Sultr 2;1; AB003591 [GenBank] , Takahashi et al., 2000). Metabolites were extracted with 1 ml 0.1 M HCl using 0.1 g fresh weight of cells. Thiols were measured after derivatization with monobromobimane as described above, while OAS was quantified using the AccQ-Tag fluorescence dye (Waters) after separation by reversed-phase HPLC on a Nova-Pak C18 3.9x150 mm column (pore size 4 µm). The column was equilibrated with buffer A (140 mM sodium acetate pH 6.3, 7 mM triethanolamine) at a flow rate of 1 ml min^–1 and heated at 37 °C. Pure acetonitrile serves as buffer B. The gradient was produced by the following concentration changes: 1 min 1% B, 27 min 5% B, 28.5 min 9% B, 44.5 min 18% B, 47.5 min 60% B, hold for 3 min, and return to 0% B in 1 min. Chromatograms were recorded and processed with the Millenium³² software. For quantification of Sultr 2;1 mRNA levels total mRNA was extracted according to Logemann et al. (1987) and transferred to nylon membranes by capillary transfer (Sambrook et al., 1989). Specific probes for Sultr 2;1 were labelled with -³²P-dATP as described by Feinberg and Vogelstein (1983) using the Megaprime DNA Labelling System (Amersham).

	Results

Top Abstract Introduction Materials and methods Results Discussion References

 
Purification of three OAS-TL isoforms from Arabidopsis thaliana
The cDNAs encoding the major OAS-TL isoforms of the three plant cell compartments containing cysteine biosynthetic capacity, OAS-TL A, B, and C, were cloned into the expression vector pET3d and over-expressed in E. coli. Only the mature polypeptides without any fusion tags were produced to allow analysis of native proteins with correct enzymatic properties. Expression levels of all three OAS-TLs reached about 10% of total soluble protein in their hosts. Since the recombinant proteins lacked purification tags, they were purified to apparent homogeneity using a modified chromatography protocol of Rolland et al. (1996) that had been developed for the recombinant plastid OAS-TL from spinach leaves. OAS-TL C was apparently pure after ammonium sulphate fractionation, anion exchange chromatography, and Green A affinity chromatography, whereas an additional hydrophobic interaction chromatography step was required to isolate OAS-TL A and B. Purity and molecular mass were determined by SDS-PAGE (Fig. 2) and found to be in agreement with the molecular masses of the three proteins calculated from the cDNAs. The bacterial OASTLs, encoded either from the cysK or cysM gene, should not be expressed to a significant level, since according to work by Kredich (1996) the cys-regulon is completely suppressed in full media containing reduced sulphur sources. Furthermore, the predicted molecular weight of the bacterial OAS-TL is slightly different from the three Arabidopsis OAS-TLs used in this study and no contaminating bacterial OAS-TL band was visible in Coomassie stained SDS-PAGE gels loaded with up to 5 mg of pure protein per lane (data not shown), although the varying apparent molecular weights of OAS-TL A, B, and C should easily allow the recognition of any bacterial OAS-TL band. An additional index for purity of pyridoxal phosphate-containing enzymes is the ratio of the absorbance peaks at 280 nm and 412 nm, caused by the Schiff base of the -amino group of protein lysine and the pyridoxal phosphate cofactor (Becker et al., 1969). At pH 7.5 the A₂₈₀/A₄₁₂ ratios of all three OAS-TL isoforms were below 2.5, indicating the highest degree of purity reported for OAS-TLs so far. As expected from the high expression levels of the recombinant OAS-TLs in HMS174 (DE3) bacteria, the specific activities of OAS-TLs increased only 10–20-fold during purification. The yield after purification was approximately 80% for each OAS-TL isoenzyme, giving rise to about 10 mg pure protein from 1.0 l of bacterial culture. The three OAS-TL isoenzymes were independently overexpressed and purified three times to verify the purification procedure with respect to enzyme stability and kinetic behaviour. The specific activities of the purified cytosolic and in-organelles-located isoforms differed significantly: OAS-TL B and C exhibited specific activities of approximately 550 µmol min^–1 mg^–1, whereas the OAS-TL A activity was 1.6-fold higher (Table 1).

View larger version (37K): [in this window] [in a new window]   Fig. 2. Purification of recombinant OAS-TL A, B, and C by column chromatography. Proteins were separated on 12.5% discontinuous SDS-PAGE and stained with Coomassie brilliant blue R-250. Samples were loaded as follows: (1) soluble proteins (10 µg) of E. coli HMS 174 (DE3) cells expressing OAS-TL A. (2) 30–70% ammonium sulphate fraction (10 µg). Pools of OAS-TL activity containing fractions (1 µg) after (3) EMD DEAE; (4) Green A Matrex; (5) phenyl sepharose OAS-TL A; (6) phenyl sepharose pool of OAS-TL B. (7) phenyl sepharose pool of OAS-TL C.

 

View this table: [in this window] [in a new window]   Table 1. Kinetic constants of OAS-TLs from substrate saturation experiments

 

View larger version (33K): [in this window] [in a new window]   Fig. 3. Response of O-acetylserine (thiol) lyase activity to increasing substrate concentrations. Assays were performed in the presence of 0.7–1.35 fmol enzyme, to ensure a large excess of substrate over enzyme, even at low substrate concentrations. Filled circles represent the arithmetic mean of nine independent OAS-TL activity measurements, consisting of three independently purified OAS-TL preparations for each isoform with three repeated kinetic measurements. The best fit using the Michaelis–Menten equation is displayed as a solid line. For determination of Michaelis constants OAS (left side) and sulphide (right side) concentrations were varied from 0 to 10 mM and from 0 to 250 µM, respectively. The upper graphics represent the velocity against substrate plots for OAS-TL A. The corresponding Eadie–Hofstee plots for OAS-TL A, B, and C are displayed in the three lower diagrams. The linearity of the Eadie–Hofstee plots confirms that the OAS-TL reactions follow a typical Michaelis–Menten kinetic.

 
Substrate conversion of the three compartment-specific Arabidopsis OAS-TLs
The purified enzymes were subjected to a detailed analysis of substrate reaction kinetics. Initially the widely used Gaitonde test (Gaitonde, 1967; Schmidt, 1990) was used to determine the Michaelis–Menten constants for the free diffusible substrate, sulphide. This test is based on the spectrophotometric detection of a pink complex that is formed between cysteine and ninhydrin solution prepared at acidic pH (Gaitonde, 1967). Using assay conditions described in several studies on plant OAS-TLs (Rolland et al., 1996; Schmidt, 1990; Warrilow and Hawkesford, 1998), nearly identical K_m values and positive co-operativity for sulphide binding for the three OAS-TLs with statistically unlikely exactness were determined, when the highly active OAS-TL preparations of this study were applied. A close inspection of data statistics and assay conditions revealed that the enzyme concentrations used in the assay volumes were 50 ng OAS-TL in 0.1 ml assay volume. This was equivalent to 14 nM OAS-TL (=1.4 pmol in 0.1 ml assay) and at low sulphide concentrations such as 0.5 µM (=50 pmol sulphide 0.1 ml^–1) had completely consumed the substrate sulphide. This produced exactly linear ratios of sulphide concentration to apparent specific reaction rate of µmol cysteine min^–1, but in fact only the ratio between mol sulphide applied and mol cysteine obtained had been determined (data not shown). In the case of the Arabidopsis OAS-TLs it was not possible to use lower enzyme concentrations to obtain below-K_m data, because the Gaitonde test proved to be too insensitive.

Therefore, a HPLC method based on derivatization of the thiol group of cysteine by monobromobimane and formation of a fluorescent adduct was applied. Using this method, detection of the fluorescent cysteine adduct allowed quantification of 1 pmol of cysteine. In addition, the activities of the three OAS-TLs could be performed with 3 fmol OAS-TL protein in 0.1 ml assay volume (30 pM) and with 0.5 µM sulphide (Fig. 3). Thus, under these conditions, enzyme concentrations were negligible compared with all substrate concentrations of sulphide as required by reaction kinetic equations. Remarkably, even at the lowest sulphide concentration of 0.5 µM, the OAS-TLs were able to convert the entire sulphide quantitatively into cysteine, indicating that no backward reaction took place under these conditions (data not shown). Data sets for the response of enzyme activities to substrate concentrations were critically analysed using the Michaelis–Menten and the Hill equations. The cytosolic as well as the organelle-located A. thaliana OAS-TLs showed typical Michaelis–Menten behaviour with respect to sulphide and OAS, when the highly sensitive fluorescence-coupled separation of the cysteine adduct by HPLC was applied. The best fits of data sets using the Hill equation resulted in Hill constants (h) of about 1 (Table 1). Values down to 0.75 were not considered as significantly different from 1 because in these cases R² values were identical when Hill and Michaelis–Menten fits were applied to the primary data. This indicated that binding of substrate to one site of the OAS-TL dimers neither positively (h>1) nor negatively (h<1) affected binding of substrate to the second binding site of the dimer. These results were verified by graphic analyses of data sets using Eadie–Hofstee plots (Fig. 3), revealing linear relationships of activities versus activity/substrate ratios as expected for Michaelis–Menten kinetics. The of cytosolic OAS-TL A was 5.6±0.6 µM, while the organelle isoforms OAS-TL B and C showed slightly lower values of 3 µM and 4.6 µM, respectively (Table 1). The values differed between 0.31 mM and 0.69 mM and showed similar relationships when cytosolic and organelle isoforms were compared (Table 1). Most notably, the affinities of the A. thaliana OAS-TLs for sulphide were 10–100 times higher than reported for plant OAS-TLs so far, possibly because the micromolar sulphide concentrations had been underestimated due to insensitive detection methods.

Binding affinity of OAS-TLs for OAS
The amino acid metabolite OAS exclusively occurs as part of sulphur metabolism, but there it potentially carries out three functions: intermediate substrate of cysteine biosynthesis, effector for cysteine synthase complex dissociation, and trigger for the induction of sulphur-related genes (Hell et al., 2002). At least the first two functions imply binding of OAS to OAS-TL. The binding affinity of OAS at the substrate binding site was determined using spectral analysis. Defined concentrations of OAS-TL A were incubated at room temperature with 1 µM increments OAS of concentrations (Fig. 4). Sulphide had to be omitted in order to avoid rapid formation of cysteine, thereby causing a decline of OAS concentrations in the solution. Detection of OAS binding to pyridoxal phosphate is based on an absorbance shift from 412 to 460 nm in prokaryotic and eukaryotic OAS-TL proteins (Becker et al., 1969; Droux et al., 1998), due to the formation of a -aminoacrylate intermediate and concomitant release of acetate (Cook and Wedding, 1976). The stepwise addition of OAS (up to 1 mM) to concentrated OAS-TL A solutions resulted in an -aminocrylate-based shift of the same amount of OAS-TL. Indeed all the OAS added bound to OAS-TL down to 3 µM OAS-TL protein. Below this concentration the absorption shift was too small for accurate quantification. Sulphide alone did not change the absorbance spectra up to concentrations of 5 mM. OAS-TL B and C were subjected to the same analysis and behaved in the same manner (data not shown). It is concluded that the binding affinities of the A. thaliana OAS-TL proteins for OAS must be lower than 3 µM, most probably even below 1 µM.

View larger version (34K): [in this window] [in a new window]   Fig. 4. Determination of binding affinity by titration of OAS-TL with OAS. Ultraviolet/visible spectra of OAS-TL A were recorded at increasing OAS concentration (A). The appearance of the peak at 460 nm depends on the formation of the -aminoacrylate intermediate formed after binding of OAS to OAS-TL. The increment in adsorption at 460 nm as a function of increasing total OAS concentration is plotted in the lower panel (B) for three enzyme concentrations. Addition of OAS results in equimolar formation of -aminoacrylate intermediate at any tested enzyme concentration. OAS-TL B and C show the same kinetic behaviour (data not shown).

 
Substrate specificity of OAS-TL for the dissociation states of sulphide
The intracellular concentrations of free sulphide are generally assumed to be very low due to the potential toxicity of the molecule. These concentrations are subjected to the pH-dependent equilibrium between H₂S, HS^– and S^2–, but except for one report from S. typhimurium (Tai et al., 1995), the nature of the sulphide substrate of OAS-TL was unknown. Since the proton concentration of chloroplasts changes during photosynthesis, the preference of the plastid OAS-TL isoform B was tested for different dissociation states of sulphide. OAS-TL activities at sulphide-limiting (4 µM) and sulphide-saturating (400 µM) concentrations were measured in the presence of different proton concentrations (pH 7, 7.5, and 8.5). Saturating OAS concentrations were guaranteed, taking the pH-dependent chemical conversion of OAS to NAS into account. The conversion rate for this reaction at pH 7.6 is 1% min^–1 (Flavin and Slaughter, 1965), allowing a maximum transition of 5% OAS to NAS during the incubation period at standard assay conditions. The enzymatic activity at pH 7.5 was defined as 100% for sulphide-limiting and sulphide-saturating concentrations. At sulphide-saturating concentrations the difference in OAS-TL activity between different proton concentrations reflected the pH dependence of the enzyme, which is caused by the protonation state of internal amino acids (Fig. 5A, grey bars). However, at sulphide-limiting concentrations the enzymatic activity at different pH values was also dependent on the availability of the preferred dissociation state of sulphide (Fig. 5A, black bars). Therefore, the difference in enzyme activity between saturating and limiting sulphide concentrations caused by a pH shift (parentheses in Fig 5A) reflected the availability of the preferred dissociation state of sulphide. This relationship was illustrated by comparison with OAS-TL B activities between pH 7.5 and pH 7. At pH 7 and saturating sulphide the activity was 21% lower compared with pH 7.5, but in the presence of limiting sulphide (4 µM) the activity dropped by an additional 22%. Since at pH 7.0 more H₂S (118%), but 31% less HS^– and 83% less S^2– were present compared with the assay at pH 7.5 (Fig. 5B), the observed extra loss of 22% of OAS-TL activity can only be attributed to HS^– as the preferred substrate state. This finding is confirmed by analysis of the differential activity increase at alkaline pH. Thus, the preferred sulphide state of OAS-TL B was HS^–, the dissociation form with the least changes in abundance within the pH shift of illuminated chloroplasts (pH 7–8.5).

View larger version (28K): [in this window] [in a new window]   Fig. 5. Determination of the preferred sulphide dissociation state as substrate for OAS-TL B catalysis. (A) Enzymatic activity of OAS-TL B was measured at sulphide limiting (black bars; 4 µM) and saturating (grey bars; 400 µM) concentrations in the presence of different proton concentrations. Activities at pH 7.5 were set as 100% for each sulphide concentration to facilitate activity and dissociation state comparisons. Alteration of activities caused by pH shifts from pH 7.5 to pH 7 (1) or pH 8.5 (2) at sulphide-saturating and sulphide-limiting conditions differed significantly (asterisk; n=12 independent tests). (B) The abundance of the three dissociation states of sulphide, H2S, HS–, and S2–, strongly depends on the prevailing pH. The increase or decrease of H2S and S2– at pH 7.0 and 8.5 are expressed in% relative to pH 7.5. Comparison of changes of sulphide dissociation state and OAS-TL activity allowed the identification of HS– as the preferred substrate form.

 
Consequences of short-term sulphur deprivation in A. thaliana cell suspension cultures
The strong dependency of OAS-TL activity for sulphide and OAS concentration prompted an investigation of the abundance of OAS in sulphate-depleted plant cells. A heterotrophic cell suspension culture from A. thaliana was characterized after transfer from sulphate-containing growth medium (1.5 mM) to medium without sulphur for 72 h. The growth rate and relative protein contents began to decrease between 12 h and 24 h after transfer compared with the control cells on fresh sulphate-containing medium (Fig. 6A, B). This immediate decline corresponded with the absence of detectable acid-soluble sulphate in the sulphate-sufficient as well as in the sulphate-deficient cells (data not shown), indicating that no sulphur was stored, for example, as sulphate in vacuoles, during the exponential growth of these cell cultures. The limit of detection of the HPLC method with the conductivity monitor was approximately 0.1 µmol sulphate mg^–1 fresh weight. Within 24 h the major free thiols, glutathione and cysteine, reached minimal levels (<10% of control). They were maintained over 72 h, suggesting that these thiol concentrations were essential for survival of the cells (Fig. 6D, E).

View larger version (39K): [in this window] [in a new window]   Fig. 6. Characterization of A. thaliana cell suspension cultures during short-term sulphate deprivation. Experiments were repeated three times using independent batches of A. thaliana cell lines. Typical results obtained for each experiment are presented. At time point 0 cells were transferred to sulphur-deficient medium. The responses to sulphur starvation with respect to fresh weight (A), protein content (B), and thiols (D, E) were monitored for up to 3 d. OAS concentrations were quantified after derivatization with the fluorescence dye AccQ-Tag and reverse-phase HPLC (C). The identity of the OAS-AccQ derivative (F, arrow) was confirmed by spiking OAS and shifting OAS to NAS at alkaline condition (F). As a marker of sulphate starvation the mRNA levels of Sultr2;1 (At5g10180) were analysed by northern blotting and compared with ethidium bromide stained 18S rRNA as a loading control (G).

 
To the best of current knowledge the response of OAS concentrations to short-term sulphur deprivation was analysed for the first time. The quantification of OAS was highly reproducible and sensitive, using a newly established fluorescence derivatization method based on AccQ-Tag (Waters) with subsequent separation by HPLC. The increase in fluorescence of the OAS-AccQ derivative was strictly linear to the amount of OAS with a regression coefficient of this fit of higher than R²=0.999. The high fluorescence efficiency of the OAS-AccQ derivative allowed the detection of 1 pmol OAS on the column, whereas NAS was not detected at all, probably due to the steric position of the secondary amine (data not shown). The proof of identity of the OAS-AccQ derivative from cell extracts was demonstrated by (1) spiking of OAS to samples and (2) shifting OAS to NAS at alkaline pH, resulting in the complete disappearance of the OAS peak in the elution profile (Fig. 6F), similar to observations by Droux (2003) using o-phthaldialdehyde for derivatization. Identical treatment of OAS standards and their 100% recovery due to the millisecond reaction of AccQ with most primary amines indicated that neither significant levels of NAS are present in the A. thaliana cells nor produced as an extraction artefact. In fact, the rate of OAS conversion to NAS is only 1% min^–1 at pH 7.6 and above (Flavin and Slaughter, 1965). The recovery rate for OAS in the cell suspension cultures was found to be higher than 94% in all experiments.

The application of this new method revealed the rapid accumulation of OAS, presumably as a consequence of sulphide deficiency. Within 8–16 h after transfer to sulphate-limiting conditions, OAS increased significantly and continued to rise during the following time, while OAS concentrations in control cells with sufficient sulphate remained unaltered at 33.3±9.5 nmol OAS g^–1 fresh weight (Fig. 6C). The otherwise leaf-specific gene of sulphate transporter Sultr2;1 (At5g10180; Takahashi et al., 2000) was repressed at sulphate-sufficient conditions in suspension cells, but was expressed as early as 8 h after transfer to medium without sulphate (Fig. 6G). Since depletion of thiols and the increase of OAS occurred simultaneously at the time resolution of this experiment, it was not possible to deduce whether expression of Sultr2;1 was caused by loss of repression by thiols or induction because of increased OAS concentrations. However, the results document that rapid changes in OAS concentrations can occur in vivo and that these are closely correlated with reactions of plant cells to sulphur deprivation.

	Discussion

Top Abstract Introduction Materials and methods Results Discussion References

 
The three major OAS-TLs from cytosol, plastids, and mitochondria of A. thaliana have been characterized to address some of the open questions regarding the regulation of cysteine synthesis. Recombinant proteins were expressed in E. coli to circumvent the problem of contamination by other OAS-TL isoforms that is inherent in purification from plant material. Full-length OAS-TL A and in case of plastid and mitochondrial OAS-TL B and C, mature proteins, were expressed without any fusion parts to avoid any disturbance of the structurally important N- and C-termini. The three proteins were purified to apparent homogeneity at high yield (c. 80%) using several chromatographic steps. Addition of pyridoxine to the growth medium helped to ensure proper assembly of functional homodimer as indicated by the low A₂₈₀/A₄₁₂ ratios. Most importantly, the specific activities of the purified proteins of 550–900 µmol min^–1 mg^–1 are comparable to the best values of native OAS-TL preparations from bacteria and plants (Table 2), indicating highly functional enzymes. With a HPLC-based detection system for cysteine instead of the less sensitive Gaitonde system (Gaitonde, 1967; Schmidt, 1990) it became possible to quantify product formation with as little as 3 fmol of pure OAS-TL protein in a 100 µl reaction volume.

View this table: [in this window] [in a new window]   Table 2. Kinetic constants and reaction mechanisms of OAS-TLs from pro- and eukaryotic species

 
This combination of highly active enzyme protein and sensitive assay procedure was used to determine the preferred dissociation state of sulphide as a substrate. Strictly controlled pH values and substrate concentrations under assay conditions suggested HS^– as the main, if not the only, substrate of OAS-TL. This finding is in agreement with the only known determination of the nature of the sulphide substrate. Analysis of pH studies within the catalytic centre of CysK from S. typhimurium also suggested HS^– as the true substrate (Tai et al., 1995). This is supported by the detection of a binding site for a small anion, presumably HS^–, near the catalytic site on the OAS-TL structural model (Burkhard et al., 2000). HS^– is the most abundant dissociation form found at the pH conditions of plastid, cytosol, and mitochondria, thus allowing efficient substrate availability if OAS-TL A and C show a sulphide form preference similar to OAS-TL B.

While extractable OAS-TL activities under saturating substrate conditions are generally about 500 times higher than that required for the in vivo rates of cysteine synthesis in plants (Schmidt and Jäger, 1992), the low affinity towards sulphide has always remained unexplained (Table 2). Sulphide concentrations in plants are not precisely known, but from isotopic exchange reactions normal concentrations in the micromolar range were concluded which would limit OAS-TL activities in vivo to a very low level (Schmidt and Jäger, 1992). The K_m values determined here were between 3.0 µM and 5.6 µM sulphide for the three isoforms and thus 10–100 times lower than any value reported so far for plant OAS-TLs (Table 1). These values are in agreement with data for the S. typhimurium CysK enzyme that was analysed using a sensitive sulphide electrode (Tai et al., 1993). Furthermore, the reaction dependency of the A. thaliana enzymes followed Michaelis–Menten kinetics and displayed neither positive nor negative co-operativity as suggested by other plant OAS-TL preparations (Table 2), but again in agreement with CysK from S. typhimurium (Tai et al., 1993). Thus, at comparable specific activities and substrate concentrations, similar kinetic protperties of free OAS-TL dimers from a bacterium and a plant were observed. Careful statistical analysis of data obtained using the Gaitonde test (Schmidt, 1990) and the new HPLC test for cysteine with the same enzyme preparations clearly demonstrated that positive co-operativity according to the Hill-equation and low substrate affinity were a result of the insensitivity of the Gaitonde test at micromolar sulphide concentrations (data not shown). The Gaitonde test was only applicable at elevated concentrations of substrate and OAS-TL protein. This caused the complete consumption of sulphide in the assay, giving rise to apparently near-linear increases of initial reaction velocities at low sulphide concentrations. It should be noted in this context that application of the HPLC assay at OAS-TL protein concentrations as required for the Gaitonde test demonstrated the quantitative reaction of sulphide into cysteine, similar to experiments with chloroplast extracts (Brunold, 1990). This underlines that the true affinity for sulphide is rather high and at the same time confirms that no backwards reaction of the synthesized cysteine took place under assay conditions. For reasons of comparison with other references, the affinities for sulphide reported in Table 1 refer to concentrations of S^2– added to assay solutions with defined pH. At pH 7.5 of the standard assay used in this study the HS^– concentration is 79.2% of total sulphide and the calculated K_m values were 4.4, 2.4, and 3.7 µM for OAS-TL A, B, and C, respectively. Half-maximal reaction velocities at these concentrations would correspond to the assumed sulphide levels in plant cells (Schmidt and Jäger, 1992) and enable the observed rates of cysteine synthesis. Consequently, sulphide concentrations would hardly limit cysteine synthesis rates under sufficient sulphate supply. In addition, elevation of free sulphide with potentially toxic consequences would be avoided, as would be feedback inhibition of sulphite reductase (von Arb and Brunold, 1985)

Substrate affinities for OAS reported here were at the lower end of the range reported from plant and bacterial sources (Table 2). It is interesting to compare these data with previously published K_m values of the same recombinant OAS-TL isoforms from A. thaliana. Purified OAS-TL A, B, and C with a N-terminal histidine-tag showed 3-, 2.3- and 9.1-fold higher respectively, at 25–450 times lower specific activities (Burandt et al., 2002). Protein extracts from E. coli strains that expressed OAS-TL A, B, and C with a N-terminal fusion of 14 amino acids for stabilization displayed 1.8-, 2.6-, and 2.3-fold lower affinities for OAS at 3–4 times lower specific activities, even though there was strong protein background from the E. coli host (Jost et al., 2000). Thus, amino terminal protein fusions seem to affect the properties of the enzymes as can be derived from the crystal structure of the bacterial counterpart CysK (Burkhard et al., 1998). In summary, the homology of amino acid sequences over the entire protein and three-dimensional computer modelling, the similar kinetic properties, substrate affinities and preferences suggest that bacterial and plant OAS-TLs share more similarities than previously thought.

OAS concentrations in plants range from 2 nmol g^–1 fresh weight in A. thaliana leaves to 120 nmol g^–1 fresh weight in cell cultures of tobacco at regular sulphate supply. Under prolonged sulphate deficiency several fold increases were reported for several plant species (see Hell, 2003, for a review). When these data are considered, it is evident that OAS limits cysteine synthesis at regular sulphate supply rather than sulphide, unless subcellullar compartmentation provides elevated local availability of OAS. Mechanistically, reaction velocity is indeed dependent on OAS concentrations for the formation of the -aminoacrylate-enzyme intermediate (Woehl et al., 1996). At the physiological level the assumption of OAS limitation for cysteine synthesis is supported by several independent experiments. (i) Transgenic tobacco plants with increased expression of OAS-TL in plastids only provide strongly elevated cysteine synthesis when isolated chloroplasts are fed with OAS, indicating sufficient availability of sulphide (Takahashi and Saito, 1996). (ii) Overexpression of APS reductase in A. thaliana resulted in increased sulphide and, consequently, increased cysteine levels as well, but feeding of OAS was required to trigger elevated cysteine concentrations effectively (Tsakraklides et al., 2002). (iii) When SAT was overexpressed in tobacco, potato, and A. thaliana plants to produce OAS, cysteine levels were strongly increased, indicating sufficient capacity of the sulphate assimilation pathway to provide sulphide (Blaszczyk et al., 1999; Harms et al., 2000; Noji and Saito, 2002; Wirtz and Hell, 2003).

The K_D of OAS-TL proteins for OAS (<3 µM) was found to be more than 100 times lower that the K_m values. High binding affinity but slow reaction to cysteine, even at a saturating sulphide concentration, appears to be a contradiction. The resolution can be seen in the regulatory mechanism of the cysteine synthase complex (Hell and Hillebrand, 2001; Hell et al., 2002; Hell, 2003). The OAS-triggered equilibrium concentration of the complex between SAT and OAS-TL is about 50–80 µM OAS (Berkowitz et al., 2002). To allow OAS-dependent reversible SAT/OAS-TL interaction and thereby adjustment of SAT activity to available sulphide, the free OAS-TL homodimers have to bind OAS at concentrations below complex dissociation. By contrast, catalysis has to depend on relatively high of free OAS-TL as found here with of >300 µM, because the function of the regulatory system of cysteine synthase complex and free OAS-TL depends on the limitation of cysteine synthesis by OAS. Only in this way can the activity of SAT, in turn controlled by the association state of the complex, control the flux rate and, at the same time, can the OAS and cysteine concentrations (Berkowitz et al., 2002; Droux, 2003) determine the equilibrium of the complex.

These three actions of OAS (binding, dissociation, catalysis) on the free and bound OAS-TL protein, respectively, are dependent on the ambient OAS concentrations in a given cellular compartment. Transfer of cell suspension cultures of A. thaliana showed an increase of total OAS from about 30 nmol to 400 nmol g^–1 fresh weight that was apparent as early as 8 h after transfer from sulphate-sufficient to sulphate-depleted growth media. Such concentrations would allow binding of OAS to OAS-TL as well as dissociation of the cysteine synthase complex, but would in any case control the rate of cysteine synthesis. It is concluded from these results that OAS-TL as part of the regulatory circuit of the cysteine synthase complex plays an integral role in the regulation of the rate of cysteine synthesis.

	Acknowledgements

 
This work was funded by the Deutsche Forschungsgemeinschaft. The authors are indebted to D Böhmert, IPK Gatersleben, for excellent technical assistance, and Drs O Berkowitz and R Jost for valuable discussions.

	Footnotes

 
Abbreviations: NAS, N-acetylserine; OAS, O-acetylserine; OAS-TL, O-acetylserine (thiol) lyase; SAT, serine acetyltransferase.

	References

Top Abstract Introduction Materials and methods Results Discussion References

 
Becker MA, Kredich NM, Tomkins GM. 1969. The purification and characterization of O-acetylserine sulfhydrylase-A from Salmonella typhimurium. Journal of Biological Chemistry 244, 2418–2427[Abstract/Free Full Text]

Berkowitz O, Wirtz M, Wolf A, Kuhlmann J, Hell R. 2002. Use of biomolecular interaction analysis to elucidate the regulatory mechanism of the cysteine synthase complex from Arabidopsis thaliana. Journal of Biological Chemistry 277, 30629–30634.[Abstract/Free Full Text]

Bertagnolli BL, Wedding RT. 1977. Purification and initial kinetic characterization of different forms of O-acetylserine sulfhydrylase from seedlings of two species of Phaseolus. Plant Physiology 60, 115–121.[Abstract/Free Full Text]

Blaszczyk A, Brodzik R, Sirko A. 1999. Increased resistance to oxidative stress in transgenic tobacco plants overexpressing bacterial serine acetyltransferase. The Plant Journal 20, 237–243.[CrossRef][Web of Science][Medline]

Bradford MM. 1976. A rapid and sensitive method for the determination of microgram quantities of protein using the principle of protein–dye binding. Analytical Biochemistry 84, 248–254.[CrossRef]

Brunold C. 1990. Reduction of sulfate to sulfide. In: Rennenberg H, Brunold C, De Kok LJ, Stulen I, eds. Sulfur nutrition and sulfur assimilation in higher plants. The Hague: SPB Academic Publishers, 13–32.

Brugière N, Dubois F, Limami AM, Lelandais M, Roux Y, Sangwan RS, Hirel B. 1999. Gluatmine synthetase in the phloem plays a major role in controlling proline production. The Plant Cell 11, 1995–2001.[Abstract/Free Full Text]

Burandt P, Schmidt A, Papenbrock J. 2002. Three O-acetylserine(thiol)lyase from Arabidopsis catalyse cysteine synthesis and cysteine desulfuration at different pH values. Journal of Plant Physiology 159, 111–119.[CrossRef]

Burkhard P, Rao GS, Hohenester E, Schnackerz KD, Cook PF, Jansonius JN. 1998. Three-dimensional structure of O-acetylserine sulfhydrylase from Salmonella typhimurium. Journal of Molecular Biology 283, 121–133.[CrossRef][Web of Science][Medline]

Burkhard P, Tai CH, Jansonius JN, Cook PF. 2000. Identification of an allosteric anion-binding site on O-acetylserine sulfhydrylase: structure of the enzyme with chloride bound. Journal of Molecular Evolution and Molecular Biology 303, 279–286.

Burkhard P, Tai CH, Ristroph CM, Cook PF, Jansonius JN. 1999. Ligand binding induces a large conformational change in O-acetylserine sulfhydrylase from Salmonella typhimurium. Journal of Molecular Biology 291, 941–953.[CrossRef][Web of Science][Medline]

Cook PF, Wedding RT. 1976. A reaction mechanism from steady-state kinetic studies for O-acetylserine sulfhydrylase from Salmonella typhimurium LT-2. Journal of Biological Chemistry 251, 2023–2029.[Abstract/Free Full Text]

Cook PF, Wedding RT. 1977. Initial kinetic characterization of the multienzyme complex, cysteine synthetase. Archives of Biochemistry and Biophysics 178, 293–302.[CrossRef][Web of Science][Medline]

Cren M, Hirel B. 1999. Glutamine synthetase in higher plants: regulation of gene and protein expression from the organ to the cell. Plant Cell Physiology 40, 1187–1193.[Abstract/Free Full Text]

De Kok LJ, Westerman S, Elisabeth C, Stuiver E Stulen I. 2000. Atmospheric H₂S as plant sulfur source: interaction with pedospheric sulfur nutrition—a case study with Brassica oleracea L. In: Brunold C, Rennenberg H, De Kok LJ, Stulen I, Davidian J-C, eds. Sulfur nutrition and sulfur assimilation in higher plants: molecular, biochemical and physiological aspects. Berne: Haupt Publishers, 41–55.

Dominguez-Solis JR, Gutierrez-Alcala G, Vega JM, Romero LC, Gotor C. 2001. The cytosolic O-acetylserine(thiol)lyase gene is regulated by heavy metals and can function in cadmium tolerance. Journal of Biological Chemistry 276, 9297–9302.[Abstract/Free Full Text]

Droux M, Martin J, Sajus P, Douce R. 1992. Purification and characterization of O-acetylserine (thiol) lyase from spinach chloroplasts. Archives of Biochemistry and Biophysics 295, 379–390.[CrossRef][Web of Science][Medline]

Droux M, Ruffet M-L, Douce R, Job D. 1998. Interactions between serine acetyltransferase and O-acetylserine (thiol) lyase in higher plants. Structural and kinetic properties of the free and bound enzymes. European Journal of Biochemistry 255, 235–245.[Web of Science][Medline]

Droux M. 2003. Plant serine acetyltransferase: new insights for regulation of sulphur metabolism in plant cells. Plant Physiology and Biochemistry 41, 619–627.[CrossRef][Web of Science]

Droux M. 2004. Sulfur assimilation and the role of sulfur in plant metabolism: a survey. Photosynthesis Research (in press).

Feinberg AP, Vogelstein B. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Analytical Biochemistry 132, 6–13.[CrossRef][Web of Science][Medline]

Flavin M, Slaughter C. 1965. Synthesis of the succininc ester of homoserine, a new intermediate in the bacterial synthesis of methionine. Biochemistry 4, 1370–1375.[CrossRef][Medline]

Gaitonde MK. 1967. A spectrophotometric method for the direct determination of cysteine in the presence of other naturally occurring amino acids. Biochemical Journal 104, 627–633.[Web of Science][Medline]

Harms K, von Ballmoos P, Brunold C, Höfgen R, Hesse H. 2000. Expression of a bacterial serine acetyltransferase in transgenic potato plants leads to increased levels of cysteine and glutathione. The Plant Journal 22, 335–343.[CrossRef][Web of Science][Medline]

Hatzfeld Y, Maruyama A, Schmidt A, Noji M, Ishizawa K, Saito K. 2000. ß-Cyanoalanine synthase is a mitochondrial cysteine synthase-like protein in spinach and Arabidopsis thaliana. Plant Physiology 123, 1163–1171.[Abstract/Free Full Text]

Hell R. 2003. Metabolic regulation of cysteine synthesis and sulfur assimilation. In: Davidian J-C, De Kok LJ, Stulen I, Hawkesford MJ, Schnug E, Rennenberg H, eds. Sulfur transport and assimilation in plants: regulation, interaction, signaling. Leiden: Backhuys Publishers, 21–32.

Hell R, Bork C, Bogdanova N, Frolov I, Hauschild R. 1994. Isolation and characterization of two cDNAs encoding for compartment specific isoforms of O-acetylserine (thiol) lyase from Arabidopsis thaliana. FEBS Letters 351, 257–262.[CrossRef][Web of Science][Medline]

Hell R, Hillebrand H. 2001. Plant concepts for mineral acquisition and allocation. Current Opinion in Biotechnology 12, 161–168.[CrossRef][Web of Science][Medline]

Hell R, Jost R, Berkowitz O, Wirtz M. 2002. Molecular and biochemical analysis of the enzymes of cysteine biosynthesis in the plant Arabidopsis thaliana. Amino Acids 22, 245–257.[CrossRef][Web of Science][Medline]

Hesse H, Lipke J, Altmann T, Höfgen R. 1999. Molecular cloning and expression analyses of mitochondrial and plastidic isoforms of cysteine synthase (O-acetylserine(thiol)lyase) from Arabidopsis thaliana. Amino Acids 16, 113–131.[CrossRef][Web of Science][Medline]

Ikegami F, Kaneko M, Kamiyama H, Murakoshi I. 1988. Purification and characterization of cysteine synthases from Citrullus vulgaris. Phytochemistry 27, 697–701.[CrossRef]

Jost R, Berkowitz O, Wirtz M, Hopkins L, Hawkesford MJ, Hell R. 2000. Genomic and functional characterization of the oas gene family encoding O-acetylserine (thiol) lyases, enzymes catalysing the final step in cysteine biosynthesis in Arabidopsis thaliana. Gene 253, 237–247.[CrossRef][Web of Science][Medline]

Kredich NM. 1996. Biosynthesis of cysteine. In: Neidhardt FC, Curtiss R, Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff WS, Riley M, Schaechter M, Umberger E, eds. Escherichia coli and Salmonella typhimurium. Cellular and molecular biology. Washington DC: ASM Press, 514–527.

Kredich NM, Becker MA, Tomkins GM. 1969. Purification and characterization of cysteine synthetase, a bifunctional protein complex, from Salmonella typhimurium. Journal of Biological Chemistry 244, 2428–2439.[Abstract/Free Full Text]

Kuske CR, Ticknor LO, Guzman E, Gurley LR, Valdez JG, Thompson ME, Jackson PJ. 1994. Purification and characterization of O-acetylserine sulfhydrylase isoenzymes from Datura innoxia. Journal of Biological Chemistry 269, 6223–6232.[Abstract/Free Full Text]

Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685.[CrossRef][Medline]

Leustek T, Martin MN, Bick J-A, Davies JP. 2000. Pathways and regulation of sulfur metabolism revealed through molecular studies. Annual Review of Plant Physiology and Plant Molecular Biology 51, 141–166.[CrossRef][Web of Science]

Liang W-S, Li D-B. 2001. The two ß-cyanoalanine synthase isozymes of tobacco showed different antioxidative abilities. Plant Science 161, 1171–1177.[CrossRef]

Logemann J, Schell J, Willmitzer L. 1987. Improved method for the isolation of RNA from plant tissues. Analytical Biochemistry 163, 16–20.[CrossRef][Web of Science][Medline]

Lunn JE, Droux M, Martin J, Douce R. 1990. Localization of ATP-sulfurylase and O-acetylserine(thiol)lyase in spinach leaves. Plant Physiology 94, 1345–1352.[Abstract/Free Full Text]

Murashige T, Skoog F. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiologia Plantarum 15, 473–497.[CrossRef]

Nakamura K, Tamura G. 1990. Isolation of serine acetyltransferase complexed with cysteine synthase from Allium tuberosum. Agricultural and Biological Chemistry 54, 649–656.

Noji M, Saito K. 2002. Molecular and biochemical analysis of serine acetyltransferase and cysteine synthase towards sulfur metabolic engineering in plants. Amino Acids 22, 231–243.[CrossRef][Web of Science][Medline]

Peitsch MC. 1995. Protein modeling by E-mail. Bio/Technology 13, 658–660.[CrossRef]

Rolland N, Droux M, Douce R. 1992. Subcellular distribution of O-acetylserine(thiol)lyase in cauliflower (Brassica oleracea L.) inflorescence. Plant Physiology 98, 927–935.[Abstract/Free Full Text]

Rolland N, Ruffet ML, Job D, Douce R, Droux M. 1996. Spinach chloroplast O-acetylserine (thiol)-lyase exhibits two catalytically non-equivalent pyridoxal-5'-phosphate-containing active sites. European Journal Biochemistry 236, 272–282.[CrossRef]

Rosichan JL, Blake N, Stallard R, Owais WM, Kleinhofs A, Nilan RA. 1983. O-Acetylserine (thiol)-lyase from barley converts sodium azide to a mutagenic metabolite. Biochimica et Biophysica Acta 748, 367–373.

Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual. New York: Cold Spring Harbour Laboratory Press.

Schmidt A. 1990. Sulphur metabolism. D. Cysteine synthase. In: Lea PJ, ed. Methods in plant biochemistry. London: Academic Press, 349–354.

Schmidt A, Jäger K. 1992. Open questions about sulfur metabolism in plants. Annual Review of Plant Physiology and Plant Molecular Biology 43, 325–349.[CrossRef][Web of Science]

Schwede T, Kopp J, Guex N, Peitsch MC. 2003. SWISS-MODEL: an automated protein homology-modeling server. Nucleic Acids Research 31, 3381–3385.[Abstract/Free Full Text]

Segel IH. 1993. Enzyme kinetics: behavior and analysis of rapid equilibrium and steady-state enzyme systems. New York: Wiley and Sons.

Tai C, Burkhard P, Gani D, Jenn T, Johnson C, Cook P. 2001. Characterization of the allosteric anion-binding site of O-acetylserine sulfhydrylase. Biochemistry 40, 7446–7452.[Medline]

Tai CH, Nalabolu SR, Jacobson TM, Minter DE, Cook PF. 1993. Kinetic mechanisms of the A and B isozymes of O-acetylserine sulfhydrylase from Salmonella typhimurium LT-2 using the natural and alternative reactants. Biochemistry 32, 6433–6442.[CrossRef][Medline]

Tai C, Nalabolu S, Simmons J, Jacobson T, Cook P. 1995. Acid–base chemical mechanism of O-acetylserine sulfhydrylases-A and -B from pH studies. Biochemistry 34, 12311–12322.[CrossRef][Medline]

Takahashi H, Saito K. 1996. Subcellular localization of spinach cysteine synthase isoforms and regulation of their gene expression by nitrogen and sulfur. Plant Physiology 112, 273–280.[Abstract]

Takahashi H, Watanabe-Takahashi A, Smith FW, Blake-Kalff M, Hawkesford MJ, Saito K. 2000. The roles of three functional sulphate transporters involved in uptake and translocation of sulphate in Arabidopsis thaliana. The Plant Journal 23, 171–182.[CrossRef][Web of Science][Medline]

Tsakraklides G, Martin M, Chalam R, Tarczynski M, Schmidt A, Leustek T. 2002. Sulfate reduction is increased in transgenic Arabidopsis thaliana expressing 5'-adenylylsulfate reductase from Pseudomonas aeruginosa. The Plant Journal 32, 879–89.[CrossRef][Web of Science][Medline]

Warrilow A, Hawkesford M. 1998. Separation, subcellular location and influence of sulphur nutrition on isoforms of cysteine synthase in spinach. Journal of Experimental Botany 49, 1625–1636.[Abstract/Free Full Text]

Warrilow AG, Hawkesford MJ. 2000. Cysteine synthase (O-acetylserine (thiol) lyase) substrate specificities classify the mitochondrial isoform as a cyanoalanine synthase. Journal of Experimental Botany 51, 985–993.[Abstract/Free Full Text]

Warrilow AG, Hawkesford MJ. 2002. Modulation of cyanoalanine synthase and O-acetylserine (thiol) lyases A and B activity by ß-substituted alanyl and anion inhibitors. Journal of Experimental Botany 53, 439–445.[Abstract/Free Full Text]

Wirtz M, Hell R. 2003. Production of cysteine for bacterial and plant biotechnology: application of cysteine feedback-insensitive isoforms of serine acetyltransferase. Amino Acids 24, 195–203.[Web of Science][Medline]

Woehl E, Tai C, Dunn M, Cook P. 1996. Formation of the -aminoacrylate immediate limits the overall reaction catalyzed by O-acetylserine sulfhydrylase. Biochemistry 35, 4776–4783.[CrossRef][Medline]

von Arb C, Brunold C. 1985. Ferredoxin-sulfite reductase and ferredoxin-nitrite reductase activities in leaves of Pisum sativum: changes during ontogeny and in vitro regulation by sulfide. Physiologia Plantarum 64, 290–294.[CrossRef]

Yamaguchi Y, Nakamura T, Kusano T, Sano H. 2000. Three Arabidopsis genes encoding proteins with differential activities for cysteine synthase and ß-cyanoalanine synthase. Plant and Cell Physiology 41, 465–476.[Abstract/Free Full Text]

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				K. Brautigam, L. Dietzel, T. Kleine, E. Stroher, D. Wormuth, K.-J. Dietz, D. Radke, M. Wirtz, R. Hell, P. Dormann, et al. Dynamic Plastid Redox Signals Integrate Gene Expression and Metabolism to Induce Distinct Metabolic States in Photosynthetic Acclimation in Arabidopsis PLANT CELL, September 1, 2009; 21(9): 2715 - 2732. [Abstract] [Full Text] [PDF]

				F. H. Haas, C. Heeg, R. Queiroz, A. Bauer, M. Wirtz, and R. Hell Mitochondrial Serine Acetyltransferase Functions as a Pacemaker of Cysteine Synthesis in Plant Cells Plant Physiology, October 1, 2008; 148(2): 1055 - 1067. [Abstract] [Full Text] [PDF]

				M. Watanabe, K. Mochida, T. Kato, S. Tabata, N. Yoshimoto, M. Noji, and K. Saito Comparative Genomics and Reverse Genetics Analysis Reveal Indispensable Functions of the Serine Acetyltransferase Gene Family in Arabidopsis PLANT CELL, September 1, 2008; 20(9): 2484 - 2496. [Abstract] [Full Text] [PDF]

				C. P. Lee, H. Eubel, N. O'Toole, and A. H. Millar Heterogeneity of the Mitochondrial Proteome for Photosynthetic and Non-photosynthetic Arabidopsis Metabolism Mol. Cell. Proteomics, July 1, 2008; 7(7): 1297 - 1316. [Abstract] [Full Text] [PDF]

				M. Schiavon, E. A.H. Pilon-Smits, M. Wirtz, R. Hell, and M. Malagoli Interactions between Chromium and Sulfur Metabolism in Brassica juncea J. Environ. Qual., June 23, 2008; 37(4): 1536 - 1545. [Abstract] [Full Text] [PDF]

				M. C. Lopez-Martin, M. Becana, L. C. Romero, and C. Gotor Knocking Out Cytosolic Cysteine Synthesis Compromises the Antioxidant Capacity of the Cytosol to Maintain Discrete Concentrations of Hydrogen Peroxide in Arabidopsis Plant Physiology, June 1, 2008; 147(2): 562 - 572. [Abstract] [Full Text] [PDF]

				C. Heeg, C. Kruse, R. Jost, M. Gutensohn, T. Ruppert, M. Wirtz, and R. Hell Analysis of the Arabidopsis O-Acetylserine(thiol)lyase Gene Family Demonstrates Compartment-Specific Differences in the Regulation of Cysteine Synthesis PLANT CELL, January 1, 2008; 20(1): 168 - 185. [Abstract] [Full Text] [PDF]

				M. Watanabe, M. Kusano, A. Oikawa, A. Fukushima, M. Noji, and K. Saito Physiological Roles of the -Substituted Alanine Synthase Gene Family in Arabidopsis Plant Physiology, January 1, 2008; 146(1): 310 - 320. [Abstract] [Full Text] [PDF]

				M. Wirtz and R. Hell Dominant-Negative Modification Reveals the Regulatory Function of the Multimeric Cysteine Synthase Protein Complex in Transgenic Tobacco PLANT CELL, February 1, 2007; 19(2): 625 - 639. [Abstract] [Full Text] [PDF]

				E. R. Bonner, R. E. Cahoon, S. M. Knapke, and J. M. Jez Molecular Basis of Cysteine Biosynthesis in Plants: STRUCTURAL AND FUNCTIONAL ANALYSIS OF O-ACETYLSERINE SULFHYDRYLASE FROM ARABIDOPSIS THALIANA J. Biol. Chem., November 18, 2005; 280(46): 38803 - 38813. [Abstract] [Full Text] [PDF]

				P. Buchner, C. E. E. Stuiver, S. Westerman, M. Wirtz, R. Hell, M. J. Hawkesford, and L. J. De Kok Regulation of Sulfate Uptake and Expression of Sulfate Transporter Genes in Brassica oleracea as Affected by Atmospheric H2S and Pedospheric Sulfate Nutrition Plant Physiology, October 1, 2004; 136(2): 3396 - 3408. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) All Versions of this Article: 55/404/1785    most recent erh201v1 E-letters: Submit a response Alert me when this article is cited Alert me when E-letters are posted Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (21) Request Permissions Disclaimer Google Scholar Articles by Wirtz, M. Articles by Hell, R. Search for Related Content PubMed PubMed Citation Articles by Wirtz, M. Articles by Hell, R. Agricola Articles by Wirtz, M. Articles by Hell, R. Social Bookmarking          What's this?

Online ISSN 1460-2431 - Print ISSN 0022-0957

Copyright © 2005 Society for Experimental Biology

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics