Skip Navigation


JXB Advance Access originally published online on October 8, 2004
Journal of Experimental Botany 2004 55(408):2549-2557; doi:10.1093/jxb/erh274
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary data
Right arrowOA All Versions of this Article:
55/408/2549    most recent
erh274v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Massonneau, A.
Right arrow Articles by Laloue, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Massonneau, A.
Right arrow Articles by Laloue, M.
Agricola
Right arrow Articles by Massonneau, A.
Right arrow Articles by Laloue, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of Experimental Botany, Vol. 55, No. 408, © Society for Experimental Biology 2004; all rights reserved

RESEARCH PAPER

Maize cytokinin oxidase genes: differential expression and cloning of two new cDNAs

Agnès Massonneau1 *, Nicole Houba-Hérin2 *,{dagger}, Claude Pethe2, Catherine Madzak3, Matthieu Falque4, Mathieu Mercy4, David Kopecny2, Amel Majira2, Peter Rogowsky1 and Michel Laloue2

1RDP, UMR 5667 INRA-CNRS-ENSL-UCBL, IFR128 BioSciences Lyon-Gerland, ENS-Lyon, 46 Allée d'Italie, F-69364 Lyon Cedex 07, France
2Laboratoire de Biologie Cellulaire, INRA, Route de Saint-Cyr, F-78026 Versailles Cedex, France
3Laboratoire de Microbiologie et Génétique Moléculaire, INRA-CNRS-INAPG, CBAI, F-78850 Thiverval-Grignon, France
4UMR de Génétique Végétale, INRA/UPS/CNRS/INAPG, Ferme du Moulon, F-91190 Gif-sur-Yvette, France

{dagger} To whom correspondence should be addressed. Fax: +33 1 30 83 37 25. E-mail: houba{at}versailles.inra.fr

Received 2 February 2004; Accepted 11 August 2004


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Cytokinin oxidases (CKOs) play a major role in the regulation of hormone levels in plants by irreversibly degrading cytokinins. Two new cDNAs from maize (CKO2 and CKO3) were cloned and CKO activity of a recombinant CKO3 enzyme was demonstrated. CKO2 and CKO3 encode flavoproteins with 93% identity among each other compared with 45% identity with CKO1. The respective genes were mapped to BIN 3.05/06 and BIN 8.06 which belong to duplicated regions of the maize genome. For a better understanding of the role of CKO2 and CKO3 in maize development, their expression profiles were analysed in different organs and during kernel development via semi-quantitative RT-PCR. Different spatial and temporal expression patterns were observed for the two genes, as well as for CKO1 and two additional genes CKO4 and CKO5. CKO2 to CKO5 genes were mainly expressed in vegetative tissues, with unique expression patterns. CKO1 was most strongly expressed in the kernel. All five genes were expressed at early stages of kernel development, a period when a peak in cytokinin levels and a high cell division rate in the endosperm have been described. However, each gene had its own expression profile with a major difference concerning the onset of expression.

Key words: Cytokinin, expression, hormone, maize, oxidase


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Cytokinin oxidase irreversibly degrades cytokinins by cleaving the N6-side chain from the adenine/adenosine moiety. This enzyme is thought to play a key role in the regulation of cytokinin levels in plants. Maize kernels have often been used for cytokinin oxidase purification, together with barley and wheat seeds (Armstrong, 1994Go, for a review; Galuszka et al., 2001Go). Significant cytokinin oxidase activity has also been reported in maize seedlings (Burch and Horgan, 1992Go; Schreiber et al., 1995Go) and broccoli sprouts (Laskey et al., 2003Go).

Peptide analysis of highly purified maize cytokinin oxidase led to the cloning of the first CKO gene (CKX1, CKO1) (Morris et al., 1999Go; Houba-Hérin et al., 1999Go). This gene probably belongs to a multigene family, as do the CKO genes of other species for which comprehensive genomic or EST data are available (Schmülling et al., 2003Go, for a review). However, cytokinin oxidase activity of their encoded products has not always been clearly demonstrated. Within the Arabidopsis thaliana multigene family, cytokinin oxidase activity has been reported for recombinant proteins AtCKX2, 3, and 4, the closest relatives of CKO1 (Bilyeu et al., 2001Go). However, other AtCKXs showed a rather low activity when overexpressed in plants, although these transgenic plants had a cytokinin-deficient phenotype (Werner et al., 2003Go).

In maize endosperm, a rise in cytokinin oxidase activity at 10–12 d after pollination (DAP) is associated with increased cytokinin levels and a high rate of cell division (Dietrich et al., 1995Go). More recent studies determined more clearly CKO1 expression in different organs, kernel compartments, and in response to different hormones and stress. CKO1 is mainly expressed in kernels both at a transcriptional (Houba-Hérin et al., 1999Go; Brugière et al., 2003Go) and a translational level (Bilyeu et al. 2003Go). Even in kernels, expression is rather weak and transcripts are detected by northern analysis only if polyA+ RNA rather than total RNA is hybridized. Expression starts at 8 DAP and lasts at least until 34 DAP. In addition, Brugière et al. (2003)Go reported that CKO1 expression in maize is localized to the vascular bundles of kernels and seedlings and is induced by cytokinins, abscisic acid, and abiotic stress. Transgenic maize plants expressing CKO1 under the control of a maize pollen- or anther-specific promoter are male-sterile (Huang et al., 2003Go).

The cloning of two new maize CKO cDNAs (CKO2 and CKO3) from immature kernels is reported here. The related genes were mapped and CKO activity was demonstrated for a recombinant CKO3 enzyme in the yeast Yarrowia lipolytica. For a better understanding of the role of CKO genes in maize development, expression of CKO1, CKO2, CKO3, and two additional genes was monitored in different maize organs and during kernel development.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Plant material
Zea mays cv. Nobilis (Pau Semences, 64230 Lescar, France) was used for RACE-PCR analysis, cDNA cloning and genomic sequencing. Inbreds F2, F252, and MBS847 were used for genetic mapping, as well as the LRD RIL mapping panel and genetic map derived from the cross F2xMBS847 (Causse et al., 1996Go), and the LHRF intermated RIL mapping panel and genetic map derived from the cross F2xF252 (Falque et al., 2003Go). Both panels and maps were developed at INRA, Le Moulon, France. Inbred line A188 (Gerdes and Tracy, 1993Go) was used for RT-PCR analysis and grown in a growth chamber with a 16 h illumination period (100 W m–2) at 24/19 °C (day/night) and 80% relative humidity.

Yeast material
Yarrowia lipolytica was used as a yeast host. For CKO production, recombinant Y. lipolytica strains were grown in minimal PPB medium (20 g l–1 sucrose or glucose, 1.32 g l–1 yeast extract, 1.32 g l–1 NH4Cl, 0.32 g l–1 KH2PO4, 0.13 g l–1 MgSO4, 0.33 mg l–1 thiamine (from Madzak et al., 2000Go), in 50 mM phosphate buffer, pH 6.8, for 5 d. YPD medium (1% yeast extract, 1% glucose, and 1% bacto-peptone) was used for cloning purposes.

DNA cloning
In E. coli: PCR-amplified fragments were obtained from genomic DNA (100 ng) isolated according to Dellaporta et al. (1983)Go. The following degenerate oligonucleotides were used. CKs17: GGiACiYTiWSiAAYGCNGGNAT (sense); CKs18: GCiGGiATHWSiGGNCARGC (sense, nested to CKs17); CKa16: CCRAAYTGiCCiARNCCNCC (antisense). Two touchdown PCR reactions were performed in series. Each reaction consisted of 10 cycles of 45 s at 94 °C, 30 s at 68–58 °C, 2 min at 72 °C followed by 35 cycles of 45 s at 94 °C, 30 s at 58 °C, and 1 min 30 s at 72 °C plus one extension step of 10 min at 72 °C and one cooling step of 10 min at 7 °C. DNA fragments were excised from electrophoresis gels and purified using a Geneclean kit (Bio 101 Inc, Vista, CA, USA). They were cloned in a pBluescript (KS) T-vector. This vector was prepared by digesting the plasmid with EcoRV restriction enzyme and adding thymidine 3'-overhangs according to Marchuk et al. (1991)Go.

The plasmids were used to transform Escherichia coli strains XL1-Blue (Stratagene, La Jolla, CA, USA) or DH10B (Gibco BRL, Paisley, Scotland).

DNA sequencing was performed by GENOMEXPRESS, Meylan, France.

In yeast: The Yarrowia lipolytica mono-integrative expression vector pINA1267 (Madzak et al., 2000Go) was digested with the restriction endonucleases SfiI and KpnI for a translational fusion. The CKO3 ORF was amplified from a maize kernel cDNA library (MarathonTM cDNA Amplification Kit, Clontech; Houba-Hérin et al., 1999Go) using CKO3 specific primers and the procedure described in the kit. An aliquot of the first PCR reaction was used to amplify the desired ORF fragment using Pfu polymerase (Stratagene) with two nested primers, i.e. primer CKY04 (CCATGCACGGCCTCTTCGGCCGCCAAGCGAGTCCCCGACGAGGACGTG) cleavable by the restriction endonuclease SfiI and priming the CKO sequence start at GTC (codon 26), and primer CKY05 (CGGGGTACCAACTGTCACAAAGGCAATGGC) cleavable by the restriction endonuclease KpnI and encompassing the STOP codon. PCR cycles were as follows: (i) one denaturation step at 94 °C for 3 min, (ii) 3 cycles consisting of 30 s at 94 °C, 30 s at 55 °C, 4 min at 72 °C, (iii) 3 cycles consisting of 30 s at 94 °C, 30 s at 64 °C, 4 min at 72 °C, (iv) 30 cycles consisting of 30 s at 94 °C, 4 min at 72 °C, (v) one extension step of 10 min at 72 °C, and (vi) one cooling step of 10 min at 7 °C. The PCR reactions contained 4% DMSO.

Ligation was performed for 3 h at room temperature and the ligation mix was digested with XbaI restriction enzyme to increase the recovery of insert-containing plasmids. Five clones with the expected sequences at the vector/insert junctions were used for yeast transformation.

Constructs were linearized with the NotI restriction endonuclease. Y. lipolytica strain Po1g (Madzak et al., 2000Go) was used as a host. The transformation procedure was according to Xuan et al. (1988)Go. Transformants were selected on minimal YNB medium (Sherman et al., 1986Go). Three clones were picked up from each transformation and grown in YPD medium for 3 d. CKO activity was tested in the culture medium of the transformants by HPLC using tritiated isopentenyl adenine (iP) as a substrate according to Laloue and Fox (1989)Go. Two different transformants were producing CKO at similar yields. One of them (cl 4) was further used for CKO production. The integrity of the CKO3 ORF was checked by sequencing the corresponding construct in E. coli: two base substitutions were detected leading to two amino acid changes at position 450 (S->G) and 455 (M->I). Alternatively, the complete ORF sequence of the CKO3 allele 1 was inserted into a derivative of pINA1311 Y. lipolytica mono-integrative expression/secretion vector (described in Nicaud et al., 2002Go). The transformation of Y. lipolytica with this construction allowed the cl 39 strain to be obtained (work to be described elsewhere). Integrity of the CKO3 ORF was demonstrated by sequencing.

DNA sequencing was performed by GENOMEXPRESS, Meylan, France.

SNP analysis
SNP analysis was performed by the primer extension method in the presence of ddATP and a mixture of dCTP, dGTP, and dTTP. The PCR product was previously treated by shrimp alkaline phosphatase and exonuclease I (Epicentre) to dephosphorylate the remaining dNTPs and degrade the remaining PCR primers, respectively. Primer extension reaction was then performed by using thermosequenase (Amersham Pharmacia Biotech) with a fluorescently labelled primer having its 3' extremity just before the SNP position. Extension products were electrophoresed on a 12% polyacrylamide gel in a Li-Cor automatic sequencer to visualize length polymorphism between both alleles (21 versus 23 bp).

RACE-PCR analysis
Maize cobs harvested about 2 weeks after anthesis were cleaned, frozen in liquid nitrogen, and kept at –70 °C before use. Total RNA extraction from kernels was adapted from Hall et al. (1978)Go. Poly A+ RNA was purified by two rounds of spun-column chromatography by using the mRNA purification kit of Pharmacia and further treated with the MarathonTM cDNA amplification kit from Clontech. 1 µg was used in each reaction. The procedure was exactly as advised by the company. 4% DMSO was added to the PCR reactions.

Specific primers were the following. cks1: CCAGGGGATCGTGGTCAGGAT; cks2: TCAGCAATGTCAATCAACTGGAGA; cka1: AGCGTTATCATCGGGTGAGCAGGTAA; cka2: TCCTCTTCCTGTCACAATCTCCAGTT.

Fragments were gel purified and cloned as described in ‘DNA cloning’.

RT-PCR analysis
Total RNA was isolated using the following procedure. Tissues were ground to powder under liquid nitrogen and transferred to a tube containing equal volumes of extraction buffer (200 mM TRIS-HCl pH 9, 400 mM KCl, 200 mM sucrose, 35 mM MgCl2, and 25 mM EGTA) and phenol/chloroform (pH 8) and vortexed for 30 s. The aqueous phase, resulting from a 5 min centrifugation at 18 000 g, was re-extracted twice with phenol/chloroform. RNA was precipitated by the addition of 1 M acetic acid (1/10 volume) and ethanol (2.5 volumes). The RNA pellet was washed with 3 M NaOAc (pH 6) and resuspended in water. A second acetic acid/ethanol precipitation was performed before the final resuspension in water.

RNA was treated with RQ1 RNase free DNase I (Promega) and quantified in a spectrophotometer at 260 nm. Approximately 5 µg of total RNA were reverse transcribed using random hexamers (Amersham Pharmacia Biotech Inc) and SuperScriptTM II RNase H reverse transcriptase (Gibco BRL). 2.5x105 copies of GeneAmplimer pAW109 RNA (Applied Biosystems) were added to the reverse transcription reaction.

The constitutively expressed 18S rRNA gene (primers CCATCCCTCCGTAGTTAGCTTCT and CCTGTCGGCCAAGGCTATATAC) was used as an internal control of RNA quantity and GeneAmplimer pAW109 RNA (primers CATGTCAAATTTCACTGCTTCATC and TGACCACCCAGCCATCCTT) as a positive control of the RT-PCR efficiency.

CKO-specific oligonucleotides were the following. CKO1: GGTGCACGGCGAGGAGGT and CGTCCCACATGGATTTGTTGAG (which overlaps exons 2 and 3); CKO2: GAATCTTCTGATACCGAGGAGCTCA and TGGCTGTTCAGGCTCATCGC (each of them bordering intron 4); CKO3: GCGTGTCGCCACCGTC and CGACATCTCCTCTTCCTGTCACA (which overlaps exons 1 and 2); CKO4: GGCCGACTCGTAACGTAATCCA and CCAACCGGAGCTAACTAAACAATCC; CKO5: GGACGTGATGCTGCGTGA and AGCAGCACGCCGTGGAA.

The cycle number of the PCR reactions was adjusted for each gene to obtain barely visible bands in agarose gels. Aliquots of the PCR reactions were loaded on agarose gels and stained with ethidium bromide.

Assays for CKO activity
The standard [3H]-iP assay for oxidase activity (Laloue and Fox, 1989Go) was performed at 30 °C in 20 mM TRIS-HCl buffer, pH 7.4, 1 mg ml–1 bovine serum albumin using 2 µM [3H]-iP (Institute of Experimental Botany, Czech Academy of Sciences, Praha, CZ) as a substrate. Radioactive adenine formed was detected by HPLC on a C8 Lichrospher 60, RPselect B, 5 µm column (125x4 mm) from Merck. The HPLC system was a Waters gradient instrument 600E equipped with a programmable multiwavelength detector 490E. Radioactivity was measured with an on-line Flo-one-ß instrument from Radiomatic.

Two assays for dehydrogenase activity were both performed in the presence of the electron acceptor 2,6-dichlorophenolindophenol (DCPIP). The DCPIP initial rate assay (Bilyeu et al., 2001Go) was performed at 30 °C in 100 mM phosphate buffer, pH 7.0, 1 mM EDTA, 0.05 mM DCPIP, and 1 mg ml–1 bovine serum albumin in the presence of 0.05 mM iP. DCPIP reduction was measured at 600 nm.

The 4-aminophenol end-point assay (Frébort et al., 2002Go) was performed at 37 °C in 75 mM TRIS-HCl buffer, pH 8.5, and 0.5 mM DCPIP in the presence of 0.15 mM iP. 3-Methyl-2-butenal formed over 50 min was reacted with 4-aminophenol (0.44% final concentration) and measured at 352 nm.

Photoaffinity labelling
Protein concentrations were determined according to Lowry's procedure with the Protein Assay kit from Sigma. Bovine serum albumin was used as a standard.

CKO solution aliquots were mixed with an isotopic dilution of [3H]-azidoCPPU (333 Gbq mmol–1) at 0.5 µM azidoCPPU final concentration.

50 µl droplets were placed on a parafilm piece at 4 °C for 20 min in the dark. They were irradiated at 254 nm for 5 min with a 6 W lamp (energy=0.3 mW cm–2, Bioblock Scientific, Illkirch, France).

SDS-PAGE and fluorography
SDS-PAGE and fluorography were performed as previously described (Houba-Hérin et al., 1999Go) except for 10% polyacrylamide concentration in the running gel. Protein concentration was achieved by acetone precipitation. Silver nitrate staining was performed according to Blum et al. (1987)Go.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Cloning of two new cDNAs
To clone additional CKO genes from maize, degenerate oligonucleotides flanking intron 1 of CKO1 were designed in regions of high homology between maize CKO1, Arabidopsis CKX1 (AC002510 [GenBank] ), and bacterial FAS5 (P46377 [GenBank] ) from Rhodococcus fascians (Houba-Hérin et al., 1999Go). They were used to amplify maize genomic DNA. The most abundant PCR product, of about 450 bp, was purified and cloned. It contained two distinct sequences differing from CKO1 that were named CKO2 and CKO3. Comparison with the deduced amino-acid sequence of CKO1 showed that 5' priming was further upstream in the sequence than expected (i.e. 210 bp upstream of the 5' primer). The partial CKO2 and CKO3 genomic sequences were 89% identical to each other.

To obtain full-length cDNA clones, RACE-PCR analysis was performed on cDNA produced from immature kernels (Houba-Hérin et al., 1999Go). Nested oligonucleotides with nearly complete matches within both sequences were designed for both 5' and 3' RACE-PCR, allowing for ~250 bp and ~100 bp overlaps between respective 5' and 3' RACE reaction products and cDNA sequences derived from the partial genomic clones. A single CKO2 cDNA was determined (AJ606942 [GenBank] ). However, in the case of CKO3, very subtle sequence differences between RACE products led to the verification of these sequences with additional primers and allowed discrimination between the two alleles (CKO3 allele 1 and CKO3 allele 2). This was not surprising because the cDNA had been isolated from the cultivar Nobilis which is a hybrid line. Shotgun-sequencing of genomic DNA from both parent lines (kindly provided by P Blanchard) helped attribute each allele to a given parent line (AJ606943 [GenBank] for CKO3 allele 1 and AJ606944 [GenBank] for CKO3 allele 2). Comparison of the ORF cDNA sequences indicated 99% homology between the two CKO3 alleles. Only CKO3 allele 1 was used for further sequence comparisons that revealed 93% identity between CKO2 and CKO3 (Table 1). An alignment of the deduced amino-acid sequences is supplied as supplementary data at Journal of Experimental Botany online.


View this table:
[in this window]
[in a new window]
 
Table 1. Identities within maize CKO genes and proteins

 
Mapping of CKO2 and CKO3
F2 and MBS847 lines for which recombinant inbred lines (RILs) are available were PCR-screened for CKO2 and CKO3 sequences with various pairs of specific primers. The respective amplification products could be recovered in each line. Sequencing of one CKO3 specific amplification product revealed a SstI restriction site polymorphism between the parental lines. Ninety-four F2xMBS847 RILs were PCR-analysed for this SstI polymorphism, to place the gene on the LRD genetic map developed with this RIL population (data not shown). This allowed assigning the CKO3 gene to BIN 8.06 by using the MapMaker software (Lander et al., 1987Go).

A similar analysis could not be performed for CKO2 because of a reduced level of polymorphism. Instead a single-nucleotide polymorphism (SNP) analysis was performed on the basis of a SNP in intron 2. The mapping panel used in this case was LHRF. This analysis allowed the assignment of CKO2 to BIN 3.05/06. The regions harbouring CKO2 and CKO3 contained other duplicated loci indicating that they belong to duplicated regions in the maize genome (Helentjaris, 1995Go).

In addition, the assembly of all the partial genomic sequences generated for the genetic mapping study allowed the intron/exon structure of CKO2 and CKO3, which both harbour four introns located at identical positions, to be determined (supplementary material is available at Journal of Experimental Botany online). These sequence data are in complete agreement with recently delivered maize genomic sequences of line B73 (i.e. TIGR AZM4 133895 and NCBI, GSS nucleotide sequence database, CC606096 [GenBank] , CC339941 [GenBank] , CG340433 [GenBank] , CG340422 [GenBank] , CC330819 [GenBank] , for CKO2; TIGR AZM4 133880 and NCBI, GSS nucleotide sequence database, BZ706895 [GenBank] , CG287021 [GenBank] , CG287009 [GenBank] , CC708488 [GenBank] , CC708476 [GenBank] , for CKO3).

Cytokinin oxidase activity of recombinant CKO3 protein
Recombinant CKO3 was produced from two different Yarrowia lipolytica yeast strains (cl 4 and cl 39). In the cl 4 strain, the open reading frame (ORF) sequence of the CKO3 allele 1, without the sequence encoding a putative 25 amino acid signal peptide (as predicted by PSORT and TargetP), was fused in frame downstream of the sequence encoding the prepro-region of the Y. lipolytica alkaline extracellular protease, to allow for the secretion of the heterologous protein. The cl 39 strain contained the entire CKO3 allele 1 ORF without any yeast secretion signal. CKO3 activity was assayed in the supernatant of yeast cultures using iP as a substrate, either in an oxidase or a dehydrogenase reaction, and compared with the activity of recombinant CKO1 produced from a Y. lipolytica strain and whose expression was based on the same vector as in the cl 4 strain (C Pethe, unpublished results) (Table 2). When measured in the presence of an electron acceptor (DCPIP), CKO3 and CKO1 activity increased in the range of 1–2 log units, indicating that both enzymes function in a similar way. When measured in both oxidase and dehydrogenase assays, activity was weaker for CKO3 compared with CKO1. In addition, CKO3 activity of the cl 39 strain was at least 10 times weaker than for the cl 4 strain. The different culture supernatants were then analysed by SDS-PAGE (Fig. 1). Additional protein bands were detected for CKO3- (cl 4) and CKO1-producing strains with apparent molecular weights of 61 kDa (double band) and 69 kDa, respectively. No additional band could be detected for recombinant CKO3 when the native signal peptide was present (cl 39). Therefore, a photoaffinity labelling experiment was performed on concentrated cl 39 supernatant with a labelled cytokinin agonist (an azido-derivative of N-(2-chloro-4-pyridyl)-N'-phenylurea; Dias et al., 1995Go). After SDS-PAGE analysis and fluorography (Fig. 2), a band at ~61 kDa could be identified as the recombinant CKO3 enzyme. The addition of decreasing amounts of highly purified CKO1 protein (C Pethe, unpublished results) to aliquots of the CKO3 preparation was used to estimate the amount of CKO3, by assuming that both enzymes had the same affinity for this cytokinin agonist. About 30 ng of active enzyme should be present in 22 µg of the CKO3 preparation, i.e. 1000 times less than in the purified CKO1 preparation, which matches with a 1000 times weaker activity (2.58 pkat mg–1 compared to 2.15 nkat mg–1).


View this table:
[in this window]
[in a new window]
 
Table 2. Activity of recombinant CKO3 and CKO1 (nkat ml–1) assayed with iP as a substrate in the supernatants of Y. lipolytica grown in minimal PPB medium

 


View larger version (84K):
[in this window]
[in a new window]
 
Fig. 1. SDS-PAGE analysis on supernatants of CKO-expressing Y. lipolytica cultures. Supernatants were concentrated 12.5 times (5 times for CKO1) and 6 µl were loaded in each lane. Gel was stained with silver nitrate. M, supernatant of a control Y. lipolytica strain transformed with an empty vector. Molecular weight markers are indicated on the left-hand side of the figure in kDa.

 


View larger version (99K):
[in this window]
[in a new window]
 
Fig. 2. CKO photolabelling with [3H]-azido CPPU. An aliquot (i.e. 22 µg proteins) of the cl 39 CKO3 preparation was loaded in each lane of an SDS-polyacrylamide gel together with decreasing amounts of purified CKO1 (43, 13, and 4 ng in lanes 1, 2, and 3, respectively). Respective activities were 2.15 nkat mg–1 for purified CKO1 and 2.58 pkat mg–1 for the CKO3 preparation, as measured in the oxidase assay. Molecular weight markers are indicated on the left-hand side of the figure in kDa.

 
Additional CKO genes in maize
Two additional CKO-like genes that were called CKO4 and CKO5 were initially identified as partial sequences in the data banks (AW506922 [GenBank] and AQ844401 [GenBank] , respectively). From recently delivered sequences, the corresponding genomic sequences were retrieved and the sequence of the encoded proteins deduced (supplementary material is available at Journal of Experimental Botany online). Comparisons of either the nucleotide or the amino acid sequences (Table 1) indicated that CKO4 clustered with CKO2 and CKO3, while CKO5 was more related to CKO1. The intron/exon structure was in agreement with this clustering (supplementary material is available at Journal of Experimental Botany online). CKO4 contained four introns as did CKO2 and CKO3, while CKO5 contained only two introns, a situation similar to the one found in CKO1.

Expression of CKO genes in maize organs
Expression of the five CKO genes in different organs of the maize plant was analysed by semi-quantitative RT-PCR analysis using gene specific primers (Fig. 3A). Specificity of the reaction and identity of the amplification product were verified for each gene by nucleotide sequencing. This analysis also confirmed experimentally the expression of CKO4 and CKO5.



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 3. Semi-quantitative RT-PCR analysis of CKO1 to CKO5 gene expression in various maize tissues and during kernel development. (A) Young leaves are the youngest leaf from 8–10 leaf-carrying plants and old leaves are the 3rd to 4th basal leaves. Young roots were collected from 1-week-old seedlings grown in vitro and old roots from 40-d-old plants grown on sand. 7 and 15 DAP kernels have been added for a comparison. (B) Plants were hand-pollinated for the isolation of staged kernel tissue. Non-pollinated ovaries (–5 DAP) were collected at the emergence of silks. The constitutively expressed 18S rRNA gene was used as an internal control of RNA quantity and GeneAmplimer pAW109 RNA as positive control of the RT-PCR efficiency.

 
The expression profile of CKO1 was in full agreement with previous results that had demonstrated strong expression in kernels and weaker expression in roots (Houba-Hérin et al., 1999Go; Brugière et al., 2003Go). In addition, an even weaker expression was detected in some other tissues. The expression profiles of the other CKO genes were quite different from that of CKO1 and each other. CKO2 was the only gene with strong expression in mature tassels. It shared strong expression in old leaves with CKO3. CKO4 was mainly expressed in immature tassels and CKO5 in immature ears. The marked differences in gene expression suggest distinct functions for the five CKO genes throughout the maize plant.

Expression profile and localization of different CKO genes in the kernel
Because the maize kernel had been reported to constitute a major source of cytokinin oxidase and because CKO1, CKO2, and CKO3 cDNAs had been isolated from immature kernels, special emphasis was placed on the study of CKO expression in the kernel. A semi-quantitative RT-PCR analysis was therefore performed on total RNA from ovules and kernels between 0 and 30 DAP (Fig. 3B). While significant expression of CKO1 and 2 was only detected after pollination, CKO3, 4, and 5 transcripts were also detected prior to pollination. All genes, with the exception of CKO5, showed a ‘bi-phasic’ pattern with two distinct maxima, which could possibly be explained by overlapping profiles in different parts of the kernel. CKO1 and 3 had peaks of expression at 7 and 30 DAP, CKO2 at 5 and 12 DAP, and CKO4 at 1 and 7 DAP. In the cases of CKO3 and CKO4, the first peak might be of maternal or gametophytic origin, while the second might concern the embryo or endosperm. CKO5 was hardly expressed after pollination and it is likely that this gene does not play a major role in kernel development.

Since the attempts to obtain in situ localization of the transcripts did not result in any definite signals, 15 DAP kernels were tentatively dissected into embryo, endosperm, pedicel, and pericarp and analysed by semi-quantitative RT-PCR. CKO1 was mainly expressed in the embryo and to a lesser extent in the pericarp, while CKO5 expression was exclusively in the pericarp (supplementary material is available at Journal of Experimental Botany online). A high signal was detected in the pedicel fraction for CKO2, 3, and 4. However, during the micro-dissection the separation of the pedicel fraction from the two closest basal endosperm domains, the basal endosperm transfer layer (BETL) and the embryo surrounding region (ESR), is extremely difficult and expression in theses adjacent domains cannot be excluded. CKO4 was the only gene with consequent expression in the glumes (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
The identification and characterization of two novel maize CKO genes, originally isolated from cDNA of immature kernels, are presented here. Although CKO2 and CKO3 are highly homologous, they correspond to two different genes based on sequence analysis, expression studies, and genetic mapping. Both genes are quite distant from the previously published CKO1 and appear to belong phylogenetically to another CKO subgroup (Fig. 4). CKO2 and CKO3 may represent a single ancestral gene provided to the maize genome by different ancestors of this ancient tetraploid (Gaut et al., 2000Go) because they map to duplicated regions of the maize genome. It is tempting to speculate that this hypothesis also holds for other genes, for example, the barley genes 2 and 3 and the maize genes 4 and 4 bis (Fig. 4).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4. Phylogenetic analysis of CKO proteins. Complete sequences of CKO proteins were aligned using the CLUSTAL W program (Thompson et al., 1994Go). The relationship tree was produced with the TreeView program (Page, 1996Go). 7 AtCKX gene products named according to Bilyeu et al. (2001)Go. Barley CKO: HvCKO2 AF540382 [GenBank] , HvCKO3 AY209184 [GenBank] . Rice CKO: OsCKO1 AP00286.1, OsCKO2 AAP54326 [GenBank] OsCKO3 AP003244 [GenBank] .1, OsCKO4 AP3412.4, OsCKO5 AP003344 [GenBank] .2, OsCKO6 derived from AC108874 [GenBank] .2 (TIGR 8353.m02683). Dendrobium sonia: Ds CAC17752 [GenBank]

 
When produced in the yeast Yarrowia lipolytica, recombinant CKO3 was shown to have cytokinin oxidase/dehydrogenase activity on isopentenyladenine. As far as is known, it is the first time that an enzymatic activity is unambiguously demonstrated for a recombinant enzyme of this CKO subgroup. As shown by others on a native (Galuszka et al., 2001Go) or recombinant CKO/CKX enzyme (Frébort et al., 2002Go), activity measured in the dehydrogenase assay is enhanced compared with the oxidase assay. The reason why the yield of active CKO3 enzyme was weak probably arises mainly from the weak amount of recombinant secreted enzyme, as illustrated by SDS-PAGE analysis. Yield and activity of the CKO3 enzyme were higher in the cl 4 strain compared with the cl 39 strain in which the CKO3 gene sequence was found to be totally identical to the maize CKO3 allele 1. Apparently the two substitutions detected in the sequence of the recombinant cl 4 CKO3 gene leading to S->G (position 450) and M->I (position 455) substitutions were not detrimental to its activity. According to homology studies, these substitutions did not affect any conserved amino acid. It therefore seems more likely that the yeast prepropeptide directs a more efficient secretion than the native maize signal peptide, as also noted by Bilyeu et al. (2001)Go for CKO1 secretion in Pichia pastoris.

However, it is likely that the recombinant CKO3 enzyme is less stable than the recombinant CKO1 enzyme, as suggested by both (i) the lower activity measured by the end-point assay compared with the initial rate assay (Table 2; dehydrogenase reaction) and (ii) the shape of the kinetic curves obtained either for the oxidase or the dehydrogenase reaction (data not shown). Glycosylation is thought to increase protein stability. As shown by SDS-PAGE analysis, recombinant CKO1 has an apparent molecular weight of 69 kDa instead of 63 kDa for the native enzyme (Houba-Hérin et al., 1999Go) and 55 kDa for the protein devoid of any post-translational modifications. While CKO1 has eight potential glycosylation sites, CKO3 has only three sites and the recombinant enzyme has an apparent molecular weight increase of only 6 kDa compared with the molecular weight calculated from the peptide sequence. Differences in the glycosylation level could possibly be responsible for a difference in protein stability. More experiments are needed to determine the cellular in vivo localization of the enzyme and to accurately measure its affinity for different substrates.

Two additional genes CKO4 and CKO5 were first identified as an EST and a genomic survey sequence in Genbank respectively, before the confirmation of their expression by RT-PCR with gene-specific primers. Further available sequence data allowed their intron/exon structure to be determined. The five maize CKO genes of this study harbour two or four introns of various sizes but at conserved positions. In rice, the 10 CKO genes have also two or four introns while all seven Arabidopsis genes have four introns (Bilyeu et al., 2001Go; Schmulling et al., 2003Go).

The presence of many CKO genes in rice and Arabidopsis suggested that the maize genome probably contained more than five CKO genes. Very recently, numerous genomic sequences have been delivered by the maize genome initiative for the B73 inbred line, from which a total of 12 genes, putatively coding for CKO enzymes (data available on request) were tentatively extracted. They include maize genes with three introns and a sequence very similar to CKO4 (maize 4bis in Fig. 4) that does not hybridize to the primers used for CKO4 expression analysis. These genes were not included in these expression studies because the sequences were not available when this study was undertaken.

The five CKO genes have distinct expression patterns, suggesting specialized functions adapted to certain organs. While CKO1 expression is strongest in kernels, CKO2 is mainly expressed in old leaves and mature tassels, CKO3 in old leaves, CKO4 in immature tassels, and CKO5 in immature ears. There is an apparent overlap in the expression of the genes in some organs. This may correspond to a true redundancy of expression or to a specific expression pattern in different compartments inside an organ. This second hypothesis seems to apply for the kernel. Indeed, the dissection of the kernel into embryo, pedicel, pericarp, and endosperm revealed preferential expression of CKO1 in the embryo, of CKO2, 3, and 4 in the pedicel, and of CKO5 in the pericarp.

The expression pattern of CKO1 is largely in agreement with earlier reports. It has to be noted that, in contrast to the previous studies based on northern blot (Brugière et al., 2003Go), western blot (Bilyeu et al., 2003Go), or enzymatic activity (Jones et al., 1992Go) this RT-PCR approach prevented cross-reactions with the 11 other putative CKO genes. All authors agree that expression is strongest in kernels, measurable in roots, and around background levels in other tissues. Within the kernel, expression was confirmed in the maternal tissues (Jones et al., 1992Go; Brugière et al., 2003Go), while the observed expression in the embryo is in agreement with Jones et al. (1992)Go and Bilyeu et al. (2003)Go but contradictory to the in situ hybridization data of Brugière et al. (2003)Go. These data favour the hypothesis that the early embryo has developed an active protection against cytokinins that, according to Dietrich et al. (1995)Go, are present in high amounts in the surrounding endosperm at 10–12 DAP. CKO1 expression is indeed induced by cytokinins (Brugière et al., 2003Go) and this enzyme is secreted (Houba-Hérin et al., 1999Go; Morris et al., 1999Go). As reviewed in Larkins et al. (2001)Go, cell divisions cease in the central region of the endosperm after 12 DAP. If cytokinins are transferred to the developing endosperm, which acts as a nutritional sink, through the vascular bundles of the pedicel, then CKO2, CKO3, and CKO4 could be important enzymes in restricting cell division and hence regulating the sink capacity of the kernel. However, if de novo synthesis is responsible for the cytokinin burst in the early stages of kernel development, as claimed by Jones et al. (1992)Go, then the CKO enzyme possibly involved in the switch off of endosperm cell divisions would not be encoded by any one of the five genes analysed in this study.

Therefore cytokinin oxidases seem to play an important role in the fine-tuning of cytokinin level at precise locations. For such a control to be efficient it has to be turned on fast. It seems to be the case. In a recent transcriptome analysis, Rashotte et al. (2003)Go reported that exogenous application of cytokinins on Arabidopsis seedlings induced an up-regulation of a cytokinin oxidase gene (At4g29740) as quickly as for ARRs, i.e. primary cytokinin response genes. The output from the maize genome project (Martienssen et al., 2004Go) should soon provide access to the whole set of CKO genes. Analysis of their expression patterns as well as characterization of mutants should help to precise the role of CKO enzymes in the interactions between embryo, endosperm, and maternal tissues during the early developmental stages of the maize kernel.


    Supplementary data
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Three supplementary figures associated with this paper are available at Journal of Experimental Botany online. Figure SP1 is an alignment of the amino-acid sequences of the five CKOs analysed in this study. Figure SP2 shows the exon-intron structure of the five corresponding CKO genes. Figure SP3 is a semi-quantitative RT-PCR analysis of the expression of those genes in various kernel compartments.


    Acknowledgements
 
We acknowledge the help provided by Pascal Condamine in the preparation of maize tissues and in RT-PCR experiments. D Kopecny was supported by a Marie Curie Fellowship.


    Footnotes
 
* These authors contributed equally to the work presented here. Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Armstrong DJ. 1994. Cytokinin oxidase and the regulation of cytokinin degradation. In: Mok DWS, Mok MC, eds. Cytokinins, chemistry, activity and function. Boca Raton, Ann Arbor, London, Tokyo: CRC Press, 139–154.

Bilyeu KD, Cole JL, Laskey JG, Riekhof WR, Esparza TJ, Kramer MD, Morris RO. 2001. Molecular and biochemical characterization of a cytokinin oxidase from maize. Plant Physiology 125, 376–386.

Bilyeu KD, Laskey JG, Morris RO. 2003. Dynamics of expression and distribution of cytokinin oxidase/dehydrogenase in developing maize kernels. Plant Growth Regulation 39, 195–203.

Blum H, Beier H, Gross HJ. 1987. Improved silver staining of plant proteins, RNA and DNA in polyacrylamide gels. Electrophoresis 8, 93–99.[CrossRef][Web of Science]

Brugière N, Jiao S, Hantke S, Zinselmeier C, Roessler JA, Niu X, Jones RJ, Habben JE. 2003. Cytokinin oxidase gene expression in maize is localized to the vasculature, and is induced by cytokinins, abscisic acid and abiotic stress. Plant Physiology 132, 1228–1240.[Abstract/Free Full Text]

Burch LR, Horgan R. 1992. Cytokinin oxidase and the degradative metabolism of cytokinins. In: Kaminek M, Mok DWS, Zazimalova E, eds. Physiology and biochemistry of cytokinins in plants. The Hague: SPB Academic Publishing, 29–32.

Causse M, Santoni S, Damerval C, Maurice A, Charcosset A, Deatrick J, de Vienne D. 1996. A composite map of expressed sequences in maize. Genome 39, 418–432.[Web of Science][Medline]

Dellaporta SL, Wood J, Hicks JB. 1983. A plant DNA minipreparation: version II. Plant Molecular Biology Reporter 1, 19–21.

Dias M, Mornet R, Laloue M. 1995. Synthesis, azido-tetrazole equilibrium studies and biological activity of 1-(2-azido-6-chloro-pyrid-4-yl)-3-phenylurea, a photoaffinity labeling reagent for cytokinin-binding proteins. Bioorganic and Medicinal Chemistry 3, 361–366.[Medline]

Dietrich JT, Kaminek M, Blevins DG, Reinbott TM, Morris RO. 1995. Changes in cytokinins and cytokinin oxidase activity in developing maize kernels and the effects of exogenous cytokinin on kernel development. Plant Physiology and Biochemistry 33, 327–336.[Web of Science]

Falque M, Décousset L, Murigneux A, Dautrevaux N, Dervins D, Jacob AM, Ribière N, Ridel C, Albini G, Joets J, Charcosset A. 2003. Large-scale maize cDNA mapping for candidate gene approach. Proceedings of 45th Maize Genetics Conference, 13–16 March 2003, Lake Geneva, WI.

Frébort I, Sebela M, Galuszka P, Werner T, Schmülling T, Pec P. 2002. Cytokinin oxidase/cytokinin dehydrogenase assay: optimized procedures and applications. Analytical Biochemistry 306, 1–7.[CrossRef][Web of Science][Medline]

Galuszka P, Frébort I, Sebela M, Sauer P, Jacobsen S, Pec P. 2001. Cytokinin oxidase/dehydrogenase or dehydrogenase? Mechanism of cytokinin degradation in cereals. European Journal of Biochemistry 268, 450–461.[Web of Science][Medline]

Gaut BS, Le Thierry d'Ennequin M, Peek AS, Sawskins MC. 2000. Maize as a model for the evolution of plant nuclear genomes. Proceedings of the National Academy of Sciences, USA 97, 7008–7015.[Abstract/Free Full Text]

Gerdes JT, Tracy WF. 1993. Pedigree diversity within the Lancaster surecrop heterotic group of maize. Crop Science 33, 334–337.[Abstract/Free Full Text]

Hall TC, Ma Y, Buchbinder BU, Pyne JW, Sun SM, Bliss FA. 1978. Messenger RNA for G1 protein of French bean seeds: Cell-free translation and product characterization. Proceedings of the National Academy of Sciences, USA 75, 3196–3200.[Abstract/Free Full Text]

Helentjaris T. 1995. Atlas of duplicated sequences. Maize Genetics Cooperation Newsletter 69, 67–81.

Houba-Hérin N, Pethe C, d'Alayer J, Laloue M. 1999. Cytokinin oxidase from Zea mays: purification, cDNA cloning and expression in moss protoplasts. The Plant Journal 17, 615–626.[CrossRef][Web of Science][Medline]

Huang S, Cerny RE, Qi Y, Bhat D, Aydt CM, Hanson DD, Malloy KP, Ness LA. 2003. Transgenic studies on the involvement of cytokinin and gibberellin in male development. Plant Physiology 131, 1270–1282.[Abstract/Free Full Text]

Jones RJ, Schreiber BMN, McNeil K, Brenner M, Foxon G. 1992. Cytokinin levels and oxidase activity during maize kernel development. In: Kaminek M, Mok DWS, Zazimalova E, eds. Physiology and biochemistry of cytokinins in plants. The Hague: SPB Academic Publishing, 235–239.

Laloue M, Fox JE. 1989. Cytokinin oxidase from wheat. Partial purification and general properties. Plant Physiology 90, 899–906.[Abstract/Free Full Text]

Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln SE, Newburg L. 1987. MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 2, 174–181.

Larkins BA, Dilkes BP, Dante RA, Coelho CM, Woo Y, Liu Y. 2001. Investigating the hows and whys of DNA endoreduplication. Journal of Experimental Botany 52, 183–192.[Abstract/Free Full Text]

Laskey JG, Patterson P, Bilyeu K, Morris RO. 2003. Rate enhancement of cytokinin oxidase/dehydrogenase using 2,6-dichloroindophenol as an electron acceptor. Plant Growth Regulation 40, 189–196.[CrossRef][Web of Science]

Madzak C, Tréton B, Blanchin-Roland S. 2000. Strong hybrid promoters and integrative expression/secretion vectors for quasi-constitutive expression of heterologous proteins in the yeast Yarrowia lipolytica. Journal of Molecular Microbiology and Biotechnology 2, 207–216.[Web of Science][Medline]

Marchuk D, Drumm M, Saulino A, Collins FS. 1991. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Research 19, 1154.[Free Full Text]

Martienssen RA, Rabinowicz PD, O'Shaughnessy A, McCombie WR. 2004. Sequencing the maize genome. Current Opinion in Plant Biology 7, 102–107.[CrossRef][Web of Science][Medline]

Morris RO, Bilyeu KD, Laskey JG, Cheikh NN. 1999. Isolation of a gene encoding a glycosylated cytokinin oxidase from maize. Biochemical and Biophysical Research Communications 255, 328–333.[CrossRef][Web of Science][Medline]

Nicaud J-M, Madzak C, van den Broek P, Gysler C, Duboc P, Niederberger P, Gaillardin C. 2002. Protein expression and secretion in the yeast Yarrowia lipolytica. FEMS Yeast Research 2, 371–379.[Web of Science][Medline]

Page RD. 1996. TreeView: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357–358.[Free Full Text]

Rashotte AM, Carson SDB, To JPC, Kieber JJ. 2003. Expression profiling of cytokinin action in Arabidopsis. Plant Physiology 132, 1998–2011.[Abstract/Free Full Text]

Schmülling T, Werner T, Riefler M, Krupkova E, Bartrina y Manns I. 2003. Structure and function of cytokinin oxidase/dehydrogenase genes of maize, rice, Arabidopsis and other species. Journal of Plant Research 166, 241–252.

Schreiber BMN, Roessler JA, Jones RJ. 1995. Polyclonal antibodies to maize cytokinin oxidase. Plant Physiology 108, (Supplement) 80.

Sherman F, Fink GR, Hicks J. 1986. Transformation in yeast. In: Methods in yeast genetics. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, 91–102.

Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680.[Abstract/Free Full Text]

Werner T, Motyka V, Laucou V, Smets R, Van Onckelen H, Schmülling T. 2003. Cytokinin-deficient transgenic Arabidopsis plants show multiple developmental alterations indicating opposite functions of cytokinins in the regulation of shoot and root meristem activity. The Plant Cell 15, 2532–2550.[Abstract/Free Full Text]

Xuan JW, Fournier P, Gaillardin C. 1988. Cloning of the LYS5 gene encoding saccharopine dehydrogenase from the yeast Yarrowia lipolytica by target integration. Current Genetics 14, 15–21.[CrossRef]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Plant Physiol.Home page
S. Vyroubalova, K. Vaclavikova, V. Tureckova, O. Novak, M. Smehilova, T. Hluska, L. Ohnoutkova, I. Frebort, and P. Galuszka
Characterization of New Maize Genes Putatively Involved in Cytokinin Metabolism and Their Expression during Osmotic Stress in Relation to Cytokinin Levels
Plant Physiology, September 1, 2009; 151(1): 433 - 447.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
M. Smehilova, P. Galuszka, K. D. Bilyeu, P. Jaworek, M. Kowalska, M. Sebela, M. Sedlarova, J. T. English, and I. Frebort
Subcellular localization and biochemical comparison of cytosolic and secreted cytokinin dehydrogenase enzymes from maize
J. Exp. Bot., July 1, 2009; 60(9): 2701 - 2712.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
P. Galuszka, J. Frebortova, L. Luhova, K. D. Bilyeu, J. T. English, and I. Frebort
Tissue Localization of Cytokinin Dehydrogenase in Maize: Possible Involvement of Quinone Species Generated from Plant Phenolics by Other Enzymatic Systems in the Catalytic Reaction
Plant Cell Physiol., May 1, 2005; 46(5): 716 - 728.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary data
Right arrowOA All Versions of this Article:
55/408/2549    most recent
erh274v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Massonneau, A.
Right arrow Articles by Laloue, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Massonneau, A.
Right arrow Articles by Laloue, M.
Agricola
Right arrow Articles by Massonneau, A.
Right arrow Articles by Laloue, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?