JXB Advance Access originally published online on November 8, 2004
Journal of Experimental Botany 2005 56(409):91-99; doi:10.1093/jxb/eri014
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH PAPER |
Analysis of two alleles of the urease gene from potato: polymorphisms, expression, and extensive alternative splicing of the corresponding mRNA

Scottish Crop Research Institute, Unit of Plant Biochemistry, Invergowrie, Dundee DD2 5DA, UK
To whom correspondence should be addressed. Fax: +44 (0)1382 562426. E-mail: mtaylo{at}scri.sari.ac.uk
Received 12 May 2004; Accepted 20 August 2004
| Abstract |
|---|
|
|
|---|
Globally, urea is the most widely used nitrogen fertilizer and is made accessible to plants via the urease reaction. However, sequence information for the plant enzyme is scarce. A cDNA encoding urease from soybean (Glycine max) has been cloned and sequence information has been obtained for two alleles (11 and 19 kbp, respectively) of the potato (Solanum tuberosum, cv. Désirée) urease gene and the corresponding cDNAs. It was found that urease is encoded by a single copy gene in several solanaceous species, and maps to chromosome V in potato. By contrast, the presence of two urease genes was reported for soybean. Comparative analysis of 11 kbp overlapping allelic DNA allowed the quantification of single nucleotide polymorphisms and revealed the presence of a truncated Ty1-copia retrotransposon in one of the alleles. Both alleles contained a copy of a terminal-repeat retrotransposon in miniature (TRIM). 2550% of urease pre-mRNAs from both alleles were alternatively spliced in a variety of different ways. The retrotransposons had no effect on splicing. While urease is expressed in all tissues tested, its mRNA and protein are of low abundance. The TATA-less urease promoter appears to drive low-level housekeeping transcription. An in silico analysis showed that eukaryotic urease protein sequences are very similar to sequences from prokaryotic enzymes, conserving all residues of known functional importance. It is therefore likely that all known ureases are structurally similar, employing the same catalytic mechanism.
Key words: Adenylate kinase, alternative splicing, SNP, TRIM, Ty1-copia, urease
| Introduction |
|---|
|
|
|---|
Urease catalyses the hydrolysis of urea, yielding ammonia and carbonic acid. The enzyme is ubiquitous in plants (Frankenberger and Tabatabai, 1982
At the physiological level, urease has been studied in soybean (Polacco and Holland, 1993
). Soybean contains a ubiquitous urease, expressed in all tissues, and an embryo-specific urease, accumulating to activity-levels 1000-times greater than those of ubiquitous urease. Two distinct genes encode these ureases (Torisky et al., 1994
).
The active site architecture of urease has been elucidated in Klebsiella aerogenes. Several histidines and an aspartate are ligands for two active site nickel ions (essential for activity; Dixon et al., 1975
; Witte et al., 2002a
) that, in addition, are bridged by a carboxyl group covalently attached to the terminal amino group of a lysine residue (Jabri et al., 1995
). The incorporation of nickel into the active site of urease is aided by several urease accessory proteins in bacteria and plants (Freyermuth et al., 2000
; Witte et al., 2001a
; Bacanamwo et al., 2002
).
The seed enzyme from Canavalia ensiformis (jackbean) has long been the only eukaryotic urease for which full-length coding sequence information was available. The genomic sequences of three fungal enzymes (Schizosaccharomyces pombe, Cryptococcus neoformans, Coccidioides immitis) and of a second plant enzyme (from Arabidopsis thaliana) have now been published. Very recently, the coding sequences for the ubiquitous and the seed-specific ureases of soybean (Glycine max) have been added to the database (Goldraij et al., 2003
).
Ureases have been cloned from two further plant species: a cDNA from Glycine max (soybean) and two alleles of the urease gene from Solanum tuberosum (potato). In potato, as well as in several other solanaceous species, urease is shown to be a single copy gene. The two alleles of the potato urease gene were analysed for polymorphisms, and extensive alternative splicing of the corresponding mRNAs in leaf and root tissues was discovered. It was demonstrated that urease is expressed ubiquitously in the potato plant and an in silico analysis of urease sequences highlights the similarity of prokaryotic and eukaryotic enzymes.
| Materials and methods |
|---|
|
|
|---|
DNA and RNA isolations
Genomic DNA was obtained as previously described (Draper et al., 1988
Isolation of potato urease genomic clones
A lambda EMBL-3 SP6/T7 phage library of the potato genome (cv. Désirée; Clontech, Palo Alto, CA) was screened twice following the manufacturer's protocol. For the first screen, probe DNA (320 bp) was generated by RT-PCR (total leaf RNA, RT-step with Superscript II from Gibco BRL, 41 °C annealing temperature, 40 cycles) with degenerate primers: GGITTIAARITICAYGARGAYTGGG (forward) and TGRTGRCAIACCATIARCATRTC (reverse). This yielded two clones,
1 and
2b, representing different alleles of the Désirée urease gene, but which lacked the 5'-end of the gene. Therefore, a second screen was performed using a probe matching the 5'-end of the gene. This probe was generated as follows. In a first step, a degenerate primer matching the 5'-coding sequence of jackbean and soybean urease ATGAARYTIWSICCIAGRGA (for) and two reverse primers AGGGAATTACATTCTTTACACCACA (rev1) CTGAATTGGTCTGTCACCTG (rev2) were used in nested RT-PCR (total leaf RNA; RT-step using rev1 with Superscript from Gibco BRL; 20 cycles during the first PCR with 48 °C annealing temperature using for and rev1; 25 cycles during nested PCR with 48 °C annealing temperature using for and rev2. Based on the sequence of the obtained PCR product, a third reverse primer CAGGAAGGAAAGAACCAT (rev3) was designed to allow the amplification of a probe fragment not overlapping with the previously isolated lambda phages (PCR with primers for and rev3; 20 cycles, 48 °C annealing temperature). This probe identified a single clone (
2a) which contained the 5' end of the potato urease gene and overlapped with
1 and
2b.
Isolation of potato urease cDNA
Based on the genomic sequence, primers were designed to the 5' and 3' end of the coding sequence: CATATGAAGTTGGCTCCAAG (5') and TAGGAATTCCTAAAAGAGGAAATAGTTCCTGGAG (3'). A reverse transcription step using primer 3' was carried out with MMLV-reverse transcriptase from Gibco BRL (3 µg total RNA from root or leaf as template) as described by the manufacturer. Subsequent PCR was performed with forward and reverse primers for 32 cycles (53 °C annealing temperature, 68 °C elongation temperature, Roche HiFidelity Taq DNA Polymerase). Resulting amplicons (2.5 kbp) were purified from an agarose gel and cloned into pGEM-T Easy (Promega). 10 clones from leaf and 12 clones from the roots were sequenced. The coding sequence of potato urease was predicted from the genomic sequence by alignment with the jackbean urease cDNA. This prediction was confirmed by aligning the potato cDNA sequences, which also revealed the occurrence of alternative splicing.
Isolation of soybean urease cDNA
A degenerate primer was designed based on the published N-terminal amino acid sequence of ubiquitous soybean urease (Torisky et al., 1994
): ATGAARYTIWSICCIAGRGA (for). Published partial sequence of ubiquitous soybean urease (accession number EMBL: S69179) was used to design a primer to the 3'-end: CTTAAAAGAGGAAGTAATTTCGAG. Total RNA from soybean leaf (1.2 µg) was reverse transcribed with Superscript reverse transcriptase from Gibco BRL. 30 cycles of PCR (50 °C annealing temperature) with both of the above primers amplified a 2.5 kbp product which was sequenced. RACE-PCR (see below) was used to obtain non-degenerate 5'-end sequence. A second RT-PCR experiment (conditions as before) using primer ATTTCTGAATTCTCTGCTGC (which binds upstream of the start codon) and the previously used reverse primer was conducted in triplicate. Possible PCR errors were detected by comparing sequences of three clones obtained from independent RT-PCR reactions.
RACE-PCR
5' RACE-PCR was conducted following the instructions of the Roche 5'/3' RACE-PCR kit, using Superscript reverse transcriptase and terminal transferase from Gibco BRL. For 5'-RACE of soybean urease, the following gene-specific primers were designed: TGACTAACTTAGTACCATCTCG (for reverse transcription and first PCR; 16 cycles, 54 °C annealing temperature) and GATGAGGAACAGYTGGAAGAACTTG (for nested PCR; 30 cycles, 60 °C annealing temperature). For potato urease 5'-RACE, the primers rev1, rev2, and rev3 described previously were used. The reverse transcription step was carried out with primer rev1, primer rev2 was used in a first PCR (20 cycles; 55 °C annealing temperature), and primer rev3 in a nested PCR (30 cycles; 61 °C annealing temperature).
Southern analysis
Southern analysis was carried out with DNA from several potato cultivars: Désirée, Stirling, Gladstone, Lumpers, Teena; different Solanum species (accession numbers in the Commonwealth Potato Collection at the Scottish Crop Research Institute, Dundee, in brackets): S. phureja (IVP 48), S. acaule ssp. aemulans (ACL 7016), S. brachycarpum (BCP 7027), S. chacoense ssp. chacoense (CHC7143), S. papita (PTA 7079), S. ochranthum (OCR 7517); and three further solanaceous species: Lycopersicon esculentum (cv. Moneymaker), Nicotiana benthamiana, and Datura stramonium. Approximately 30 µg of either EcoRI or HindIII-digested DNA was loaded per lane. The blots were probed with a 215 bp fragment of exon 18 of the potato urease gene, generated by PCR using the reverse primer (3') described previously and a forward primer: TGGATGCTGGAATAAAAG. Washes were performed at 65 °C with 2x SSC (saline sodium citrate buffer), 0.1% SDS (sodium dodecyl sulphate; twice for 5 min) and 0.1x SSC, 0.1% SDS (twice for 15 min). The washed blots were exposed to film for 22 h.
Mapping of potato urease
A potato diploid F1 population (SH83-92-488 x RH89-039-16; Rouppe van der Voort et al., 1997
) was used to determine the map location of urease. Two primers AGGCTGCAAGTTCTAATTC and GTGTATACAAAGTAAATCCCAAC were used to amplify a simple sequence repeat region in intron 17. Reaction conditions, separation, and visualization of reaction products were as described in Provan et al. (1996)
. Genetic linkage analysis was performed using Joinmap version 2.0 software (Stam and van Oijen, 1995
).
Protein extraction, electrophoresis, and in-gel urease detection
Tissue from field-grown potato plants before the flowering stage were used for protein extraction in 50 mM phosphate buffer (pH 7.5) containing 1.5% PVPP, 50 mM NaCl, 1 mM EDTA, 10 mM DTT, and 0.1 mM PMSF (tissue to buffer ratio=1:3). Extracts were centrifuged at 20 000 g for 20 min at 4 °C and protein concentrations of the supernatants were determined by a commercial Bradford assay (Bio-Rad) using BSA as standard. Electrophoresis and in-gel staining were performed as described by Witte and Medina-Escobar (2001)
. 75 µg protein were loaded per sample (except for the mother tuber, because of low protein concentration: loading 13 µg).
Bioinformatic tools
Sequence alignments of ureases were generated with Clustal W (Thompson et al., 1994
) using default settings. The three urease subunit sequences of Klebsiella aerogenes were fed in as a single contiguous sequence. Shadings were generated using the public domain program BOXSHADE. Urease and adenylate kinase sequences were identified by BLAST searches (Altschul et al., 1997
). Single nucleotide exchanges and Indels were identified by pairwise alignment of the genomic urease clones using the GAP program (University of Wisconsin Genetics Computer Group). TRIM elements were discovered as described by Witte et al. (2001b)
.
| Results |
|---|
|
|
|---|
Cloning and structural analysis of the potato urease gene
Three overlapping lambda clones (
1,
2a,
2b) containing the urease gene sequence of Solanum tuberosum ssp. tuberosum (cv. Désirée) were isolated from a lambda phage genomic DNA library (Clontech; Fig. 1). Fragments
2a and
2b were identical in the overlapping region and the joined sequence (18 962 bp; accession number EMBL: AJ276864; subsequently referred to as
2) contains one allele of a full-length urease gene, comprizing 18 exons (Fig. 1; exons 118). Three additional possible exons were found upstream of the urease gene, coding for a peptide with strong similarity to the C-terminal sequence of plant adenylate kinases (Fig. 1; exons AC).
|
|
The fragment
1 (11 066 bp, accession number EMBL: AJ276865) overlaps completely with
2 (Fig. 1), but is not identical to it. The most obvious difference is an insertion of 1755 bp in intron 6 of
2 absent in
1 (Fig. 1; insertion). This insertion represents a retrotransposon, containing long terminal repeats of 261 bp, but lacking internal coding regions for mobility factors, indicating that this element is not capable of autonomous transposition. Some fragmented remnants of coding sequence for reverse transcriptase and RNaseH allowed the element to be classified as Ty1-copia. The Ty1-copia element is flanked by further repeats belonging to a terminal-repeats retrotransposon in miniature (TRIM; Fig. 1). The TRIM is also present at the same position in
1, but is not interrupted as in
2. The non-autonomous TRIM-type of retrotransposons were first discovered in the potato urease gene, but were later found to be widespread in genomes of monocot and dicot plant species (Witte et al., 2001b)
Urease is a single copy gene in potato and related species
Whether
1 and
2 are two alleles of the same gene or represent different genes was tested by Southern Blot and mapping analysis. Using a fragment of exon 18 as probe, single hybridizing fragments were observed in Southern blots generated with EcoRI and HindIII digested genomic DNA of several cultivars of Solanum tuberosum and various other solanaceous species, including tomato, Datura stramonium, and Physalis floridana (Fig. 2). The restriction fragments expected for the potato cv. Desireé are marked in the genomic map of the urease gene (Fig. 1). For N. benthamiana a faint band could only be observed after prolonged exposure (not shown). These data indicate that these species possess a single copy gene for urease, whereas two urease gene copies were reported in soybean (Torisky et al., 1994
). The presence of a second urease copy could not be ruled out for Solanum papita, Solanum acaule, and Solanum brachycarpum because two hybridizing bands were observed when genomic DNA was digested with HindIII (for S. acaule also with EcoRI; Fig. 2).
A simple sequence repeat (SSR) present in intron 17 of the sequenced urease gene from Solanum tuberosum (cv. Désirée) was used to map the gene on an ultra-high density AFLP (amplified fragment length polymorphism) map (Isidore et al., 2003
). The gene mapped to a single location on chromosome 5, near Gp188 and Stm1020 (Collins et al., 1999
). Thus, it is likely that urease is a single copy multiallelic gene in potato and probably also in several other solanaceous species.
SNPs and Indels between the two allelic urease copies
Genomic subclones of the urease gene alleles were sequenced on both strands and most regions on each strand was sequenced more than once. A detailed comparison of the overlapping region between the two urease alleles revealed the presence of 277 single nucleotide polymorphisms (SNPs; on average, 2.5 polymorphisms per 100 bp: 2.5%). For non-coding regions a SNP frequency of 2.8% was found while in coding regions the frequency was 1.2%.
Within the non-coding regions 40 insertion/deletion (Indel) events can be documented. Of these 70% are 14 bp in length, 20% are 510 bp, and 10% (four events) are longer than 10 bp. Possible causes for most of the longest Indels may be deduced from sequence features. As mentioned above, the insertion in intron 6 (
2) is due to a retrotransposon; an Indel of 30 bp is found in an array of 30 bp repeats in intron 14 which is probably caused by unequal cross-over; and an Indel of 34 bp in intron 17 is present in a SSR region, which are known to undergo expansion and contraction probably due to polymerase slippage during replication (Schlötterer and Tautz, 1992
).
The urease promoter and urease expression
The urease transcription start site was localized by 5'-RACE at 60 (translation start site= +1). Although a canonical TATA element and other typical promoter elements cannot be found by manual inspection, computational promoter prediction using a neural network (server at http://www.fruitfly.org/seq_tools/promoter.html; Reese and Eeckman, 1995
) locates a possible transcription start site at 57, indicating the presence of possible promoter elements. The absence of a canonical TATA box has been reported for other genes (Dynan, 1986
; Ibrahim et al., 2001
).
Steady-state levels of urease mRNA were found to be undetectable by northern blot analysis using 30 µg of total RNA from a variety of organs (not shown), suggesting either a low level of transcription or instability of urease mRNA. In western blots using a polyclonal antibody against jackbean seed urease, the potato enzyme could be detected in all organs investigated, but only close to the detection limit (not shown). In-gel urease activity staining showed that urease activity is ubiquitously present in the potato plant (Fig. 3) which is consistent with results obtained from activity measurements in different tissues (Witte et al., 2002b
). Thus, the urease promoter appears to drive low-level housekeeping expression of the urease gene. However, urease activity levels seem more than sufficient for the plant's needs since urea applied to the leaves is hydrolysed more rapidly than the resulting ammonium can be assimilated (Witte et al., 2002b
).
|
Comparative analysis of ureases from different eukaryotes
Coding sequences of both allelic urease forms from potato and of ubiquitous urease from soybean were compared to all other eukaryotic urease sequences available (two plant and three fungal sequences) and also to 36 full-length bacterial sequences. An alignment focusing on the plant sequences compared with the sequence from Schizosaccharomyces pombe and Klebsiella aerogenes is shown in Fig. 4. In most bacteria, urease is encoded by three genes (ureA, ureB, and ureC). Eukaryotic urease genes contain regions of similarity collinear to all three bacterial genes, bridged by short linking regions not present in bacteria (ureA-bridge-ureB-bridge-ureC). The degree of sequence conservation among ureases of different origin is high. For example, ureA, ureB, and ureC from K. aerogenes are 54%, 50%, and 61% identical at the protein level to the corresponding sequences of potato urease (
2), while urease from A. thaliana and potato (
2) are 75% identical. The cDNA sequence of the ubiquitous soybean urease that was recently deposited in the database (accession number EMBL: AY230156) is identical to the sequence obtained in this study except for one silent nucleotide exchange.
|
Detailed biochemical studies have been carried out on urease from Klebsiella aerogenes. All residues biochemically shown, or structurally inferred, to be important for optimal enzyme performance in K. aerogenes are conserved in eukaryotic sequences (Fig. 4; amino acid labelling according to K. aerogenes urease). This includes the residues that co-ordinate nickel in the active site of K. aerogenes urease (His
134, His
136, His
246, His
272, and Asp
360) and the lysine residue carrying the carboxyl group which bridges the two active site nickel ions (K
217; Park and Hausinger, 1993
219, thought to aid in the polarization of the urea carbonyl group, and His
320, thought to act as a general acid during catalysis, as well as D
221 and R
336, implied in the modulation of His
320 orientation and acidity (Pearson et al., 2000
319, shown not to be essential for catalytic activity but to facilitate catalysis at neutral and basic pH values (Martin and Hausinger, 1992
Given the high degree of overall conservation and the conservation of catalytically important residues among prokaryotic ureases, and also between eukaryotic and prokaryotic enzymes, it seems likely that all ureases described to date are structurally similar, employing the same catalytic mechanism. The crystal structure of K. aerogenes urease is consistent with this notion, since the bridging regions that connect ureA, ureB, and ureC in eukaryotes could be accommodated without significantly altering the structure (Jabri et al., 1995
).
Alternative splicing of potato urease
The insertion of retrotransposons into an intron of a gene has the potential to alter pre-mRNA splicing patterns (Marillonnet and Wessler, 1997
). To investigate whether the presence of the Ty1-copia and retrotransposon in intron 6 of the
2-urease allele hinders the generation of functional mRNA from this allele, urease-specific mRNA was amplified by RT-PCR from leaf and root tissues, with primers flanking the complete coding region. Ten clones from leaf and 12 clones from root were sequenced to test the integrity of the coding sequence (accession number EMBL: AJ308543 and EMBL: AJ308544 for allelic forms 1 and 2, respectively). Surprisingly, urease-specific mRNA was found to be differentially spliced at various locations (Table 1; Fig. 5), but splicing of the retrotransposon-containing intron was accurate in both alleles, indicating that the transposon insertion does not influence splicing efficiency of this intron. In the leaf, four of the 10 sequenced clones showed alternative splicing compared with expected splicing, whereas in the root, alternative splicing was found in two out of 12 clones, with one clone being affected by two different events (Table 1). Retention of intron 11 was the only alternative splicing event that could be documented twice (once in the leaf and once in the root), all other cases differed from each other, affected introns 4, 5, 7, 9, 10, 11, 12, and 17 indicating widespread changes in splice site choice throughout the gene (Table 1). In several cases, a small shift in either the 3' or the 5' splice site had occurred, but more extensive mRNA alterations were also observed, including the skipping of exon 10, the retention of intron 11, and the inclusion of 73 bp of intron 4 as an exon (Fig. 5). In all but one case (Table 1; line 1), alternative splicing introduced stop codons, shortening the open reading frame. Urease amplicons were size-selected before cloning (see Materials and methods), thus putative alternative splicing events that would greatly alter mRNA size were not selected. It can therefore not be excluded that such splicing events occur.
|
|
| Discussion |
|---|
|
|
|---|
Gene copy number
In contrast to the situation in soybean, urease is a single copy gene in potato and several related solanaceous species (Fig. 2). The genome of A. thaliana also contains only one copy of urease. A second copy of urease in soybean (and related species) was probably the result of a gene duplication event, allowing the development of an enzyme expressed mainly in seed. While the ubiquitous urease enzyme, found in all organs in soybean, is essential for the recycling of metabolically derived urea (Stebbins et al., 1991
SNPs and Indels
The comparison of 11 kbp of allelic DNA allowed the frequency of SNPs and Indels to be assessed in this region of the potato genome. The average frequency of 1 SNP every 40 bp between the two urease alleles is comparatively high. When 10 different loci from three Arabidopsis ecotypes were compared, polymorphism was detected only every 207413 bp on average, although a greatly increased frequency was observed at one hypervariable locus (Hauser et al., 1998
). An analysis of 3'-untranslated regions of 20 loci in 30 maize lines revealed the presence of one SNP every 70 bp and one Indel every 160 bp on average (Rafalski et al., 2001
). In the human genome, SNPs occur once every 100300 bp (SNP database at http://www.ncbi.nlm.nih.gov/SNP/). To gain a more comprehensive view of the general genetic variability in the potato genome, the analysis of several loci would be required.
Given the high degree of polymorphism at the urease locus it is surprizing that generally single bands were observed in Southern blot analysis (for all autoploid Solanum species, Fig. 2). Multiple bands were only observed for the allotetraploid species S. papita and S. acaule and for the allohexaploid species S. brachycarpum. Alleles
1 and
2 are the only allelic forms occurring in the autotetraploid cultivars/species tested, or perhaps other additional alleles are considerably less polymorphic.
Conservation of ureases
Ureases are highly conserved across eukaryotic and prokaryotic kingdoms (Fig. 4). This analysis has shown that all the known important features characteristic of ureases in bacteria were preserved in plants (eukaryotes). The catalytic mechanism employed by plant (eukaryotic) ureases is therefore unlikely to vary significantly from what has been found for bacteria. The organization of the urease genes in bacterial operons is collinear with the regions of similarity to these genes found in eukaryotic ureases. The presence of merged ureA and ureB genes in the only distantly related bacterial groups Helicobacter and Deinococcus suggest that merging events creating one single reading frame (as found in eukaryotes) seem likely to have happened more than once during evolution.
Alternative splicing
Alternative splicing occurs through variable splice site selection, which results in the production of different mRNAs derived from the same gene and can give rise to distinct proteins. In humans, over 60% of genes are estimated to be alternatively spliced and show multiple splicing patterns (Black, 2003
). By contrast, around 5% of Arabidopsis genes have been estimated to show alternative splicing of a type less complex than that described for vertebrates and invertebrates (Brett et al., 2002
). Nevertheless, an increasing number of alternative splicing events have been described to have roles in plant metabolism and development (Tantikanjana et al., 1993
; Comelli et al., 1999
; Figueroa et al., 1999
; Mano et al., 1999
; Quesada et al., 2003
). Alternative splicing also leads to a truncated coding sequence due to the activation of intron polyadenylation signals or by bringing translation stops in-frame. In some cases these proteins retain activity whereas in others, activity is lost. (Kyozuka et al., 1997
; Nishihama et al., 1997
; MacKnight et al., 1997
). More recently, the presence of nonsense termination codons have been described to lead to mRNA degradation through nonsense-mediated decay (Maquat, 2004
). Such processes regulate the levels of relevant mRNA available for translation and, therefore, can regulate gene expression.
Urease mRNA in potato is subject to extensive alternative splicing at different introns throughout the length of the gene's pre-mRNA. It is likely that the number of differentially spliced pre-mRNAs is greater than that described here due to the limited number of clones sequenced. Recently, the presence of urease-like sequences in jackbean was reported (Pires-Alves et al., 2003
) which may also be the result of differential splicing events. In most cases, alternative splicing found in potato urease mRNAs led to the introduction of stop codons giving rise to shortened ORFs that lack the catalytic motifs. Thus, aberrant splicing probably results in a reduction of urease protein, because a great proportion (50% in leaf and 25% in root) of pre-mRNA was processed incorrectly (Table 1). This inaccuracy (relaxed splicing) may be tolerated as long as sufficient intact urease mRNA is made. In leaves of potato, sufficient urease activity is present as the substrate, urea, is barely detectable. Even when urea is applied externally, urease is not rate-limiting for the assimilation of urea nitrogen (Witte et al., 2002b
). Thus, despite the low level of expression and the relaxed splicing of urease pre-mRNA, urease activity appears to be abundant for the plant's needs. Selective pressure for improved expression or more accurate splicing is probably low.
Relaxed splicing might not only affect urease, but also other gene transcripts. While in some instances a functional role for an alternatively spliced transcript may emerge, in the majority of cases the resulting mRNA is likely to encode non-functional or at best equally functional proteins. The current literature on alternative splicing in plants is consistent with this notion. In cases where pre-mRNA processing is limiting for protein expression, splicing is probably very accurate due to selective pressure for strong splice signals. Conversely, a greater extent of relaxed splicing is likely to occur when protein amounts are more than sufficient or are limited by other factors. A certain tolerance/inaccuracy in splicing might be one element in the toolkit of evolution to aid the emergence of new functions from old genes.
| Acknowledgements |
|---|
We thank the Ministry of Agriculture, Fisheries, and Food (now the Department of Environment, Food, and Rural Affairs), the European Commission TMR programme and the Scottish Executive Environment and Rural Affairs Department for financial support. We thank R Waugh and CG Simpson for critical reading of the manuscript.
| Footnotes |
|---|
* Present address: Max-Planck-Institute for Plant Breeding Research, Department of Plant Microbe Interactions, Carl-von-Linné-Weg 10, D-50829 Cologne, Germany.
| References |
|---|
|
|
|---|
Altschul SF, Madden TL, Schaffer AA, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 33893402.
Bacanamwo M, Witte CP, Lubbers MW, Polacco JC. 2002. Activation of the urease of Schizosaccharomyces pombe by the UreF accessory protein from soybean. Molecular Genetics and Genomics 268, 525534.[CrossRef][ISI][Medline]
Black DL. 2003. Mechanisms of alternative pre-messenger RNA splicing. Annual Review of Biochemistry 72, 291336.[CrossRef][ISI][Medline]
Brett D, Pospisil H, Valcarel J, Reich J, Bork P. 2002. Alternative splicing and genome complexity. Nature Genetics 30, 2930.[CrossRef][ISI][Medline]
Collins A, Milbourne D, Ramsay L, Meyer R, Chatot-Balandras C, Oberhagemann P, De Jong W, Gebhardt C, Bonnel E, Waugh R. 1999. QLT for field resistance to late blight in potato are strongly correlated with maturity and vigour. Molecular Breeding 5, 387398.[CrossRef][ISI]
Comelli P, König J, Werr W. 1999. Alternative splicing of two leading exons partitions promoter activity between the coding regions of the maize homeobox gene Zmhox1a and Trap (transposon-associated protein). Plant Molecular Biology 41, 615625.[CrossRef][ISI][Medline]
Dixon NE, Gazzola C, Blakeley RL, Zerner B. 1975. Jack bean urease (EC 3.5.1.5 [EC] ). A metalloenzyme. A simple biological role for nickel? Journal of the American Chemical Society 97, 41314133.[CrossRef][ISI][Medline]
Draper J, Scott RJ, Armitage P, Walden R. 1988. Plant genetic transformation and gene expression: a laboratory manual. London, UK: Blackwell Scientific Publications.
Dynan W. 1986. Promoters for housekeeping genes. Trends in Genetics 2, 196197.[CrossRef][ISI]
Eskew DL, Welch RM, Cary EE. 1983. Nickel: an essential micronutrient for legumes and possibly all higher plants. Science 222, 621623.
FAO. 1998. Database collection of the Food and Agriculture Organization of the United Nations (FAO). Internet: http://apps.fao.org/
Figueroa P, Gómez I, Holuigue L, Araya A, Jordana X. 1999. Transfer of rps14 from the mitochondrion to the nucleus in maize implied integration within a gene encoding the ironsulphur subunit of succinate dehydrogenase and expression by alternative splicing. The Plant Journal 18, 601609.[CrossRef][ISI][Medline]
Fishbein WN. 1969. The structural basis for the catalytic complexity of urease: interacting and interconvertible molecular species (with a note on isozyme classes). Annals of the New York Academy of Science 147, 857881.[ISI][Medline]
Frankenberger WT, Tabatabai MA. 1982. Amidase and urease activities in plants. Plant and Soil 64, 153166.[CrossRef]
Freyermuth SK, Bacanamwo M, Polcacco JC. 2000. The soybean Eu3 gene encodes an Ni-binding protein necessary for urease activity. The Plant Journal 21, 5360.[CrossRef][ISI][Medline]
Goldraij A, Beamer LJ, Polacco JC. 2003. Intrallelic complementation at the ubiquitous urease coding locus of soybean. Plant Physiology 132, 18011810.
Hauser MT, Adhami F, Dorner M, Fuchs E, Glossl J. 1998. Generation of co-dominant PCR-based markers by duplex analysis on high resolution gels. The Plant Journal 16, 117125.[CrossRef][ISI][Medline]
Hogan ME, Swift IE, Done J. 1983. Urease assay and ammonia release from leaf tissues. Phytochemistry 22, 663667.[CrossRef]
Ibrahim AFM, Watters JA, Brown JWS. 2001. Differential expression of potato U1A spliceosomal protein genes: a rapid method for expression profiling of multigene families. Plant Molecular Biology 45, 449460.[CrossRef][ISI][Medline]
Isidore E, van Os H, Andrzejewski S, et al. 2003. Toward a marker-dense meiotic map of the potato genome: lessons from linkage group I. Genetics 165, 21072116.
Jabri E, Carr MB, Hausinger RP, Karplus PA. 1995. The crystal structure of urease from Klebsiella aerogenes. Science 268, 9981004.
Kyozuka J, Harcourt R, Peacock WJ, Dennis ES. 1997. Eucalyptus has functional equivalents of the Arabidopsis AP1 gene. Plant Molecular Biology 35, 573584.[CrossRef][ISI][Medline]
MacKnight R, Bancroft I, Page T, et al. 1997. FCA, a gene controlling flowering time in Arabidopsis, encodes a protein containing RNA-binding domains. Cell 89, 737745.[CrossRef][ISI][Medline]
Mano S, Hayashi M, Nishimura M. 1999. Light regulates alternative splicing of hydroxypyruvate reductase in pumpkin. The Plant Journal 17, 309320.[CrossRef][ISI][Medline]
Maquat LE. 2004. Nonsense-mediated mRNA decay: a comparative analysis of different species. Current Genomics 5, 175190.
Marillonnet S, Wessler SR. 1997. Retrotransposon insertion into the maize waxy gene results in tissue-specific RNA processing. The Plant Cell 9, 967978.
Martin PR, Hausinger RP. 1992. Site-directed mutagenesis of the active site cysteine in Klebsiella aerogenes urease. Journal of Biological Chemistry 267, 2002420027.
Mobley HLT, Hausinger RP. 1989. Microbial ureasessignificance, regulation, and molecular characterization. Microbiology Reviews 53, 85108.
Nishihama R, Banno H, Kawahara E, Irie K, Machida Y. 1997. Possible involvement of differential splicing in regulation of the activity of Arabidopsis ANP1 that is related to mitogen- activated protein kinase kinase kinases (MAPKKKs). The Plant Journal 12, 3948.[CrossRef][ISI][Medline]
Park I-S, Hausinger RP. 1993. Site-directed mutagenesis of Klebsiella aerogenes urease: identification of histidine residues that appear to function in nickel ligation, substrate binding, and catalysis. Protein Science 2, 10341041.[Abstract]
Pearson MA, Michel LO, Hausinger RP, Karplus PA. 1997. Structures of Cys319 variants and acetohydroxamate-inhibited Klebsiella aerogenes urease. Biochemistry 36, 81648172.[CrossRef][Medline]
Pearson MA, Park I-S, Schaller RA, Michel LO, Karplus PA, Hausinger RP. 2000. Kinetic and structural characterization of urease active site variants. Biochemistry 39, 85758584.[CrossRef][Medline]
Pires-Alves M, Grossi-de-Sa MF, Barcellos GBS, Carlini CR, Moraes MG. 2003. Characterization and expression of a novel member (JBURE-II) of the urease gene family from jackbean (Canavalia ensiformis (L.) DC). Plant and Cell Physiology 44, 139145.
Polacco JC, Holland MA. 1993. Roles of urease in plant cells. International Review of Cytology 145, 65103.
Provan J, Powell W, Waugh R. 1996. Microsatellite analysis of relationships within cultivated potato (Solanum tuberosum). Theoretical and Applied Genetics 92, 10781084.[CrossRef]
Quesada V, Macknight R, Dean C, Simpson GG. 2003. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO Journal 22, 31423152.[CrossRef][ISI][Medline]
Rafalski A, Ching A, Bhattramakki D, Morgante M, Dolan M, Register JC, Smith OS, Tingey S. 2001. SNP markers in maize: discovery and applications. In: Plant and animal genome, IX. The international conference on the status of plant and animal genome research, 1317 January 2001, San Diego, USA, W149.
Reese MG, Eeckman FH. 1995. Novel neural network algorithms for improved eukaryotic promoter site recognition. The Seventh International Genome Sequencing and Analysis Conference, Hilton Head Island, South Carolina.
Rouppe van der Voort J, van Zandvoort P, van Eck H, Folkertsma R, Hutten R, Draaistra J, Gommers F, Jacobsen E, Helder J, Bakker J. 1997. Use of allele specificity of comigrating AFLP markers to align genetic maps from different potato genotypes. Molecular and General Genetics 255, 438447.
Schlötterer C, Tautz D. 1992. Slippage synthesis of simple sequence DNA. Nucleic Acids Research 20, 211215.
Shimada N, Ando T. 1980. Role of nickel in plant nutrition. (2) Effect of nickel on the assimilation of urea by plants. Japanese Journal of Soil Science and Plant Nutrition 51, 493496.
Stam P, van Oijen J. 1995. Joinmap 2.0: Software for calculation of genetic linkage maps. CPRO-DLO, Wageningen.
Stebbins NE, Holland MA, Cianzio SR, Polacco JC. 1991. Genetic tests of the roles of the embryonic ureases of soybean. Plant Physiology 97, 10041010.
Tantikanjana T, Nasrallah ME, Stein JC, Chen CH, Nasrallah JB. 1993. An alternative transcript of the S-locus glycoprotein gene in a class-II pollen-recessive self-incompatibility haplotype of Brassica oleracea encodes a membrane-anchored protein. The Plant Cell 5, 657666.
Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 46734680.
Torisky RS, Griffin JD, Yenofsky RL, Polacco JC. 1994. A single-gene (Eu4) encodes the tissue-ubiquitous urease of soybean. Molecular and General Genetics 242, 404414.
Witte C-P, Isidore E, Tiller SA, Davies HV, Taylor MA. 2001a. Functional characterization of urease accessory protein G (ureG) from potato. Plant Molecular Biology 45, 169179.[CrossRef][ISI][Medline]
Witte C-P, Le QH, Bureau T, Kumar A. 2001b. Terminal-repeat retrotransposons in miniature (TRIM) are involved in restructuring plant genomes. Proceedings of the National Academy of Sciences, USA 98, 1377813783.
Witte C-P, Medina-Escobar N. 2001. In-gel detection of urease with nitroblue tetrazolium and quantification of the enzyme from different crop plants using the indophenol reaction. Analytical Biochemistry 290, 102107.[CrossRef][ISI][Medline]
Witte C-P, Tiller SA, Taylor MA, Davies HV. 2002a. Addition of nickel to Murashige and Skoog medium in plant tissue culture activates urease and may reduce metabolic stress. Plant Cell Tissue and Organ Culture 68, 103104.
Witte C-P, Tiller SA, Taylor MA, Davies HV. 2002b. Leaf urea metabolism in potato. Urease activity profile and patterns of recovery and distribution of 15N after foliar urea application in wild-type and urease-antisense transgenics. Plant Physiology 128, 11291136.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C.-P. Witte, M. G. Rosso, and T. Romeis Identification of Three Urease Accessory Proteins That Are Required for Urease Activation in Arabidopsis Plant Physiology, November 1, 2005; 139(3): 1155 - 1162. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





