Skip Navigation


JXB Advance Access originally published online on February 2, 2005
Journal of Experimental Botany 2005 56(413):1007-1016; doi:10.1093/jxb/eri094
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
56/413/1007    most recent
eri094v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wagstaff, C.
Right arrow Articles by Stead, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wagstaff, C.
Right arrow Articles by Stead, A. D.
Agricola
Right arrow Articles by Wagstaff, C.
Right arrow Articles by Stead, A. D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2005]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved.

RESEARCH PAPER

Ethylene and flower longevity in Alstroemeria: relationship between tepal senescence, abscission and ethylene biosynthesis

Carol Wagstaff1,4 *, Usawadee Chanasut1, Frans J. M. Harren2, Luc-Jan Laarhoven2, Brian Thomas3, Hilary J. Rogers4 and Anthony D. Stead1,{dagger}

1School of Biological Sciences, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
2Life Science Trace Gas Facility, Department of Molecular and Laser Physics, University of Nijmegen, PO Box 9010, 6500GL, Nijmegen, The Netherlands
3Plant Genetics and Biotechnology, Warwick HRI, Wellesbourne, Warwickshire CV35 9EF, UK
4Cardiff School of Biosciences, Main Building, Cardiff University, PO Box 915, Cardiff CF10 3TL, UK

{dagger} To whom correspondence should be addressed. Fax: +44 (0)1784 470756. E-mail: a.stead{at}rhul.ac.uk

Received 2 August 2004; Accepted 2 December 2004


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Senescence of floral organs is broadly divided into two groups: those that exhibit sensitivity to exogenous ethylene and those that do not. Endogenous ethylene production from the former group is via a well-characterized biochemical pathway and is either due to developmental or pollination-induced senescence. Many flowers from the order Liliales are characterized as ethylene-insensitive since they do not appear to produce endogenous ethylene, or respond to exogenous ethylene treatments, however, the majority of cases studied are wilting flowers, rather than those where life is terminated by perianth abscission. The role of ethylene in the senescence and abscission of Alstroemeria peruviana cv. Rebecca and cv. Samora tepals was previously unclear, with silver treatments recommended for delaying leaf rather than flower senescence. In the present paper the effects of exogenous ethylene, 2-chloroethylphosphonic acid (CEPA) and silver thiosulphate (STS) treatments on tepal senescence and abscission have been investigated. Results indicate that sensitivity to ethylene develops several days after flower opening such that STS only has a limited ability to delay tepal abscission. Detachment force measurements indicate that cell separation events are initiated after anthesis. Endogenous ethylene production was measured using laser photoacoustics and showed that Alstroemeria senesce independently of ethylene production, but that an extremely small amount of ethylene (0.15 nl flower–1 h–1) is produced immediately prior to abscission. Investigation of the expression of genes involved in ethylene biosysnthesis by semi-quantitative RT-PCR indicated that transcriptional regulation is likely to be at the level of ACC oxidase, and that the timing of ACC oxidase gene expression is coincident with development of sensitivity to exogenous ethylene.

Key words: Abscission, Alstroemeria, chloroethylphosphonic acid, ethylene, photoacoustics, RT-PCR, senescence, sensitivity, silver thiosulphate


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Ethylene is the major co-ordinator of senescence in many flowers. The deterioration of the corolla in such species is hastened by exogenous ethylene and senescence is accompanied by increased endogenous ethylene biosynthesis (Nichols, 1977Go). Following pollination of highly ethylene-sensitive flowers such as carnation, a signal passes from the style to the petals through the ovary (Jones and Woodson, 1997Go) and initiates a burst of ethylene production. In unpollinated carnation flowers the gynoecium is essential for inducing senescence by generating an initial burst of ethylene which subsequently triggers a second, autocatalytic burst of ethylene in the petals (Shibuya et al., 2000Go). This initiates downstream events in the senescence process such as lipid peroxidation (Leverentz et al., 2002Go) and proteolytic activity (Xu and Hanson, 2000Go).

In ethylene-sensitive species such as carnation, much interest has been shown in the regulation of senescence through the expression of genes encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) and 1-aminocyclopropane oxidase (ACO) enzymes (Kende, 1993Go). Both are up-regulated transcriptionally as petals age (Woodson et al., 1992Go; Jones, 2003Go) and transcript levels may, in some species at least, be rapidly up-regulated by pollination, for example, tobacco (Sanchez and Mariani, 2002Go; Weterings et al., 2002Go), orchids (O'Neill et al., 1993Go; Bui and O'Neill, 1998Go), and Petunia (Clark et al., 1997Go). The evidence therefore suggests that ethylene production may be regulated at the transcriptional level in several species.

Flower deterioration is manifested as petal wilting or colour change in several species (Stead and van Doorn, 1994Go), whereas in others the perianth abscises (van Doorn and Stead, 1997Go) with little or no loss of fresh weight. In many species, ethylene appears to play little or no part in controlling petal collapse, for example, in daylily (Lay Yee et al., 1992Go) and iris (Celikel and van Doorn, 1995Go). However, where the perianth abscises ethylene has, with one exception (Sexton et al., 2000Go), always been shown to be involved in the control of the abscission process. For example, in Arabidopsis, ethylene was shown to be essential for normal floral organ abscission (Butenko et al., 2003Go; Patterson and Bleeker, 2004Go). In species where ethylene has been implicated in the control of floral senescence the use of a pulse treatment of ethylene inhibitors such as silver thiosulphate (STS), norbornadiene or 1-methylcyclopropene (1-MCP) usually prolongs flower longevity and such treatments are useful for increasing the vase life of cut flowers (Serek et al., 1995Go).

In Alstroemeria flowers the role of ethylene is unclear, Woltering and van Doorn (1988)Go reported sensitivity to ethylene to be low and commercial recommendations to use STS are usually related to attempts to prevent leaf yellowing rather than prolonging flower vase life (van Doorn et al., 1992Go). Although the senescence of Alstroemeria flowers has been reported elsewhere (Collier, 1997Go; Wagstaff et al., 2001Go, 2003Go) there has been no systematic attempt to determine if Alstroemeria flowers produce ethylene, nor have the effects of ethylene on flower longevity been fully investigated. The implication is that Alstroemeria may be similar to other flowers from the order Liliales, such as Iris (Celikel and van Doorn, 1995Go) and Hemerocallis (Lay Yee et al., 1992Go), which are insensitive to ethylene and do not produce the growth regulator during extensive petal collapse. However, Alstroemeria petals do not show such extreme petal wilting as either Iris or Hemerocallis, and termination of vase life is by tepal abscission. Therefore this raises the question of whether ethylene is only involved in abscission in this species, or if it has some additional role to play during senescence. An understanding of the role of ethylene in the control of floral deterioration in Alstroemeria has commercial relevance for post-harvest handling, as well as furthering understanding of the regulation of floral senescence and abscission.

Previous attempts by this group to determine ethylene production from Alstroemeria flowers and isolated petals using gas chromatography found that production was so low that results were very variable and could only be reproduced reliably when studying the ability of ethylene precursors to induce ethylene production (Stead et al., 2003Go). It was not possible to determine the true levels and the timing of ethylene evolution from Alstroemeria flowers, or the stage at which they became sensitive to exogenous ethylene. Consequently, a considerably more sensitive technique of a laser-driven photoacoustic detector has been used to measure real-time ethylene evolution from Alstroemeria flowers. This has been used previously to detect ethylene biosynthesis successfully from a variety of flowers (Woltering et al., 1988Go) and floral tissues including styles (Woltering et al., 1997Go) and during pollen tube growth (De Martinis et al., 2002Go). Using this technique it has been possible to follow ethylene production from single flowers in a continuous-flow system over a prolonged period of time.

In this paper, expression profiling of genes encoding the enzymes in the ethylene biosynthesis pathway is presented which has been integrated with physiological and photoacoustic measurements of ethylene production. Data are also presented that enable the role of ethylene to be discussed in relation to another key marker of senescence in Alstroemeria, that of proteolytic activity (Wagstaff et al., 2002Go).


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Plant material
Alstroemeria flowers (varieties Rebecca and Samora) were obtained from a commercial nursery (Oak Tree Nursery, Egham, Surrey, UK) and were pulled directly from the rhizome of the stock plants 1–2 d prior to flower opening, i.e. at the same stage as commercial harvest. The cultivar Rebecca has been used throughout this study, with Samora being used for comparison in some experiments. The flowers were transported back to the laboratory dry whereupon the stem ends were placed in water. Individual cymes were cut from each stem and placed in vials of dH2O for experimental purposes and maintained in a growth room (12 µmol m–2 s–1; 16 h photoperiod; 60% RH; 21 °C) for the duration of the vase life. All chemicals were from Sigma, Poole, UK. Stages of development are as described in Wagstaff et al. (2001)Go for Samora and Breeze et al. (2004)Go for Rebecca. Stages have been used in figures where endogenous gene expression or enzyme activity was measured, but days have been used in treatments such as CEPA and STS where the treatment altered the time taken to each morphological stage after harvest. In untreated detached cymes stages 0–7 occur 0, 1, 2, 4, 6, 8, 10, and 12 d after harvest, respectively, in Rebecca, and stages 1–7 occur 1, 2, 4, 5, 7, 9, and 10 d after harvest, respectively, in Samora flowers.

Treatment with STS or CEPA
STS treatment (4 mM AgNO3:32 mM NaS2O3) was for 1 h (longer treatments with STS caused blackening of vegetative structures; Chanasut et al., 2003Go) and flowers were then subsequently placed in distilled water. Ethylene treatments were conducted using chloroethylphosphonic acid solutions (CEPA) on both Samora and Rebecca cymes. 20 replicate cymes were placed into CEPA concentrations ranging from 0.005–500 ppm the day prior to flower opening and then the percentage of perianth segments that had abscised each day was observed (recordings taken up to three times a day). Alternatively, the effect of exposure to CEPA on the force required to detach the tepals was recorded using a DFG-1K digital force meter (Shimpo Europe GmbH, Germany).

Measurement of ethylene production
A laser-driven photoacoustic detector was used to measure ethylene evolution in a continuous flow system. Five flowers, just before opening, were placed individually into glass cuvettes with their cut ends in water containing 1–2 drops of commercial bleach to inhibit bacterial growth. Where appropriate, glass beads were used to reduce the internal void volume. Cuvettes were sealed and a flow of ethylene-free air maintained at a rate of 900 ml h–1. The concentration of ethylene in the atmosphere leaving each cuvette was determined periodically (c. every hour) by passing the gas into the photoacoustic cell. At each determination point at least 20 measurements of the ethylene concentration leaving the cuvette were performed. Flowers were left in the cuvettes up until the perianth segments abscised, thus ethylene production from day 0 to day 10 were obtained from the same flowers. In all experiments a background control was subtracted from the test cuvettes comprising of an identical cuvette to the experimental ones, but without the inclusion of a flower.

Expression of ACC synthase and ACC oxidase
Two ACC synthase partial cDNAs were cloned from Alstroemeria using degenerate primers based on known ACC synthases in the database (ACSF1: GGCYTSGCHGARAAYCA; ACSR1: GTCGAAYCCBGGRTARTA; ACSR2: GCCCARHGGGTTBGANG). The resultant sequences were used to design primers specific to unique regions of each Alstroemeria ACC synthase (ALSACS1-1 using ALSACSF1: GGCTTGGCTGAGAATCAG and ALSACSR1: ATTGAAGGAAATTGAACCTTAC giving a 204 bp product and ALSACS2-1 using ALSACSF2: GGCTTGGCTGAGAATCAG and ALSACSR2: GCCAGTGGGTTGGATGG giving a 486 bp product). A similar approach for ACC oxidase using degenerate primers (ACOF: ACCTTCGGSACNAARGT and ACOR: CCRTTGGTKATNACYTC) resulted in one clone being found. Specific primers were designed (ALSOACOF: ACCTTCGGCACAAAGGTGAGC and ALSACOR: GATTACCTCCAGCTGGTCACC) to the clone designated ALSACO1-1, giving a 218 bp product. Expression was determined throughout vase life using semi-quantitative RT-PCR as described previously in Wagstaff et al. (2002)Go.

cDNA was made from 2.5 µg total RNA (extracted using TriReagent according to the manufacturer's instructions with an additional phenol:chloroform clean-up step and ethanol precipitation) using Promega MMLV H reverse transcriptase in a 20 µl synthesis reaction. PCR using specific Alstroemeria primers to the ACC and ACO genes of interest was then conducted using 1 µl cDNA as a template. A reaction using a primer set spanning an intron in a ß-tubulin gene was used as a control to detect any genomic DNA in the template, and as an internal control for normalizing the RT-PCR data. The number of PCR cycles used was optimized using a pooled sample of cDNA for each primer set so that the products were visible on an ethidium bromide gel, but were below the maximal level of product detectable without saturation. Image analysis using UVP Gel Base Pro (UVP Ltd, Cambridge, UK) of product intensity at each cycle determined the optimal cycle number as one near the middle of the exponential phase of amplification to allow both lower and higher readings to be within the linear phase of the reaction. This ensured that the cycle numbers were below the level of the reaction at which template or enzyme became rate-limiting. The PCR was repeated with individual developmental stages at the optimal cycle number and image analysis performed as above on the resultant gel picture. The PCR for each gene of interest and the control ß-tubulin gene was duplicated in independent thermocycler runs from the same cDNA stocks. Data for each gene of interest was then expressed relative to ß-tubulin levels for each developmental stage.

Protease activity in STS and ethylene-treated petals
STS treatments were applied to cymes as described above. Ethylene (2 ppm) was injected into sealed containers containing isolated cymes in water at stage 0 and left for 15 h, after which the cymes were returned to the growth room conditions described above. A parallel group of cymes were sealed in a similar container without the addition of ethylene to act as a control. Crude extracts were obtained and total protease activity from Rebecca petals was determined using the method of Wagstaff et al. (2002)Go at stages 0, 3, and 6 of flower development.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Perianth abscission
STS delays time to perianth abscission:
Time to abscission in Rebecca flowers held in water was approximately 10 d. Treatment with STS delayed the time to perianth abscission in Rebecca and Samora varieties by approximately 2 d although the addition of exogenous ethylene had no effect on hastening abscission with or without STS treatment (Fig. 1). STS was administered at day 0 (stage 2) in both cases, but ethylene treatment was given at day 0 (Fig. 1A) or day 4 (Fig. 1B).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Tepal abscission in Rebecca following (A) STS (4 mM AgNO3:32 mM NaS2O3) treatment at day 0 followed by 2 ppm ethylene for 15 h at day 0 and (B) STS treatment at day 0 followed by 2 ppm ethylene for 15 h at day 4. Arrows indicate the time at which anthesis is complete: n=60 tepals per treatment.

 
Response to CEPA treatment:
Overall longevity of the control flowers was approximately 96 h greater in Rebecca than Samora. Tepal abscission was accelerated by continuous exposure to low concentrations of CEPA, even concentrations as low as 0.5 ppm resulted in petal abscission occurring before those in water (Fig. 2), whilst those in higher concentrations lost their petals in about half the time compared with those in water. In the highest CEPA concentrations, however, petal development was abnormal with thin, paper-like, petals produced that abscised without fully reflexing. Rebecca and Samora flowers showed the same sensitivity (i.e. tepal abscission commenced after 3 d treatent with CEPA) to concentrations of 50 ppm and 500 ppm CEPA. A low concentration of 5 ppm caused earlier abscission in Samora (10 d) than Rebecca (12 d) and Samora showed sensitivity to even lower CEPA concentrations down to 0.005 ppm. Abscission of petals within each treatment took place over a very short time frame (24 h) showing a high degree of co-ordination and replication.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. Tepal abscission (%) for flowers (A) Samora and (B) Rebecca held in varying concentrations of CEPA. n=120 flowers per treatment for Samora: n=150 tepals per treatment for Rebecca.

 
Detachment force:
Flowers from Rebecca were given a range of concentrations of CEPA as shown in Fig. 2 from stage 0 and the force required to detach the petals was subsequently measured at each stage of development (Fig. 3). All concentrations of CEPA tested reduced the force required to detach petals compared with the controls. However, the lower concentrations of CEPA (0.05 ppm and 0.5 ppm) did not reduce the force required to detach the petals until 4 d after the start of the treatment.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. Detachment force (mN) of Rebecca petals after CEPA treatment: n=30 petals per stage per treatment ±SE.

 
Ethylene production
Ethylene production from single isolated Alstroemeria cv. Rebecca flowers was close to the limits of detection using gas chromatography and no increase in production was detected throughout the life of the flowers. Therefore the extremely sensitive technique of laser photoacoustics was utilized to assay the evolution of ethylene from individual flowers in a continuous flow system.

Ethylene production was detectable from the very youngest flower stages of Samora and Rebecca varieties (when flower fresh weight was approximately 1.5 g) although the amounts produced were very low, less than 0.01 nl flower1 h–1. Ethylene production increased about 9 d after harvest in four out of the five Rebecca flowers investigated to a maximum (when the flower fresh weight was approximately 2 g) just less than 7.0 nl flower–1 h–1. The fifth flower produced a very small peak of ethylene somewhat earlier (Fig. 4A) and then did not show any increased ethylene production when the petals abscised. The increase in ethylene production appears to have taken place over about a 24 h period and the data indicated that this was a transitory burst lasting 24–48 h only. After this burst of ethylene the production seemed to decline at a similar rate to that at which it increased. However, the experiment did not run until the ethylene production had returned to its previous level, as the perianth had abscised and the flower had reached the end of its vase life. A similar pattern of ethylene production was seen in Samora (Fig. 4B) in the 24 h prior to abscission, but the levels produced from this variety were approximately 40-fold lower (on average 0.15 nl flower–1 h–1). Ethylene concentration in the atmosphere leaving the flower-containing chamber was between 0.2–0.7 ppb for fully open flowers. Given that the flow rate was 900 ml h–1 this equates to less than 1 nl per flower per hour (cv. Rebecca) or less than 0.3 nl g–1 FW h–1. This demonstrates the sensitivity of photoacoustics over other ways of measuring ethylene; the ethylene concentration leaving the Samora flower-containing chambers was accurately detected well below 1 ppb.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4. Ethylene production from isolated Alstroemeria flowers (A) Samora (B) Rebecca as detected by photoacoustics. Isolated flowers were held in glass cuvettes with 900 ml h–1 of air passing through and the ethylene content of the emitted atmosphere determined at regular intervals throughout vase life.

 
ACS and ACO expression
ACC synthase and ACC oxidase gene expression was investigated in Rebecca, as this variety showed the greatest production of ethylene. The ALSACS and ALSACO partial cDNAs isolated showed high homology to the same amino acid regions from a range of other species (alignment not shown) and included conserved amino acids defined in Mita et al. (1999)Go. However, they appear to represent two different ACS genes as they shared only 40.6% with one another. In addition ALSACO1-1 contained all the residues over this region that are essential for ACC oxidase activity of Kiwifruit (Lay et al., 1996Go). The ACC synthase partial cDNAs did not extend to the region encoding the active site of this protein. ALSACO1-1 (accession no. AY682558) represents a region encoding 73 amino acids starting approximately half way along the full length predicted protein (~317 amino acids). ALSACS1-1 (accession no. AY682556) and ALSACS2-1 (accession no. AY682557) begin approximately 50 amino acids from the start of the coding region and encode 107 and 164 amino acids from a predicted full length for ACS proteins of approximately 490 amino acids.

Expression profiles for the three genes were determined by semi-quantitative RT-PCR, visualized by ethidium bromide staining (Fig. 5A). Primers amplifying a portion of a ß-tubulin gene spanning an intron were used as a control for genomic DNA contamination. The band strength of the ACS and ACO gene products were quantified by image analysis and normalized to the values obtained for the tubulin cDNA-derived amplicon at each developmental stage (Fig. 5B). ALSACS1-1 and ALSACS2-1 showed little change over the course of development and senescence, but ALSACO1-1 showed marked up-regulation in the last two stages prior to abscission.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 5. (A) Expression of two ACC synthase genes and one ACO gene during vase life. Tubulin expression is shown below as a control. All RT-PCR reactions were from the same batch of cDNA and the experiments were repeated at least twice with identical results, only one image of which is shown here. (B) Image analysis of ACC synthase and ACO gene expression profiles shown in part (A), relative to tubulin expression. Stages defined as: S0, harvest point, closed bud; S1, loose bud, sepals parted; S2, open flower, no anthesis; S3, top three anthers anthesed; S4, bottom three anthers anthesed; S5, stigmatic lobes open; S6, sepals translucent at margins, anthers collapsed on bottom petal; S7, perianth abscinds if tapped.

 
Protease activity after STS and ethylene treatment
Protease activity was previously shown to increase dramatically from stage 5 until abscission (Wagstaff et al., 2002Go). Petals from Rebecca flowers treated with either STS or ethylene at stage 0 were assayed for protease activity. Neither treatment significantly changed the level of protease activity at stage 3 compared with the controls, however, STS and ethylene significantly reduced or increased the activity at stage 6 respectively, compared with control levels (Fig. 6).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6. Protease activity of Rebecca petals following (A) for 1 h and (B) ethylene treatment (2 ppm for 15 h). Treatments administered at stage 0, total protease subsequently measured from crude total protein extract at stage 3 and stage 6 in parallel to controls that had been maintained in water. Data are the mean of three replicates of three independent extractions. Bars=range.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In Alstroemeria, petal abscission terminates the functional life of the flower. Although petal wilting is not always associated with increased ethylene production or sensitivity in other species there is only one reported example of non-ethylene inducible petal abscission (Sexton et al., 2000Go). Alstroemeria appears to be no exception since a 1 h pulse with STS delayed perianth abscission, albeit by only 1–2 d such&!nbsp;that vase life was 120% that of the controls. This is a small increase compared with the effect STS has on ethylene-sensitive species such as carnation where vase life is extended by 200% compared with untreated flowers (Uda et al., 1996Go). Evidence from ethylene-insensitive transgenics and naturally occurring varieties implies that there is an underlying senescence mechanism that is simply accelerated by the presence of ethylene. For example, etr1 transgenic petunias show physiologically and morphologically similar senescence to unpollinated non-transformed plants, but at a much later time (Gubrium et al., 2000Go). Similarly, the Chinera variety of carnation shows extremely low levels of endogenous ethylene production compared with varieties such as White Sim, and shows greater longevity (Woltering et al., 1993Go). Therefore it is suggested that senescence is essentially the same in all senescing floral organs, but the sensitivity of some species to ethylene during the senescence phase accelerates this process. This could be said to provide a selective advantage to these flowers following pollination as it provides a rapid mechanism by which to render the flower unattractive to pollinators. In several species, such as lupin, this view is supported by evidence that ethylene production immediately after successful pollination induces a colour change in the petals as a precursor of senescence (Stead and Reid, 1990Go). This has the immediate effect of dissuading potential pollinators from visiting the flower again.

The ability of STS to delay perianth abscission in Alstroemeria suggests that ethylene does play a role in co-ordinating abscission since STS blocks the ethylene receptor (Veen, 1979Go). Confirmation of this comes from exposing the flowers to ethylene released from CEPA; concentrations as low as 0.5 ppm showed accelerated perianth abscission but at 5 ppm the effect was considerably more noticeable. The flowers were still buds when initially placed in the CEPA solutions, and those in the highest concentration (500 ppm) failed to open properly with abscission of the partially open perianth parts occurring some 3–4 d later, thus CEPA not only induced premature abscission but also prevented normal flower development. At somewhat lower concentrations of CEPA, bud opening was complete, but petals and sepals abscised earlier than water-treated controls, in a concentration-dependent manner. Abscission in all concentrations of CEPA took place over a narrow timeframe of some 24 h suggesting that ethylene may play a co-ordinating role in this process, as observed in Rubus petals (Burdon and Sexton, 1993Go). However, gaseous ethylene, even when administered as late as day 4 (completion of anthesis), did not accelerate petal abscission (Fig. 1B). This is in contrast to the effect of ethylene on corolla detachability in many other species, for example in Digitalis, ethylene exposure caused corolla abscission within 24 h of treatment in all open flowers but not in buds (Stead and Moore, 1983Go). There is clearly a conflict in the timing of abscission between flowers held continuously in CEPA and those subjected to a pulse of gaseous ethylene at day 0 or day 4. It is hypothesized that ethylene receptors are not functional until after day 4 and that the highest concentrations of CEPA had a toxic effect, as shown by the flowers' deformed morphology which was associated with premature abscission. Such toxicity is not unknown and previous work has suggested that the phosphate in CEPA may account for the morphological deformity seen in olives after treatment with high concentrations of CEPA (Burnik-Tiefengraber et al., 1994Go). The lower concentrations of CEPA accelerated abscission from day 5, presumably after ethylene receptors had begun to become functional. This time point correlates with the stage at which ALSACO1-1 expression was first detected.

The force required to detach the petals was reduced in CEPA-treated flowers relative to the controls, although for concentrations less than or equal to 0.5 ppm there was no effect on the detachment force prior to day 4 of treatment. This supports the hypothesis above that younger flowers are insensitive to ethylene. Tepal abscission from young flowers treated with high concentrations of CEPA indicates that cell separation around the abscission zone may be relatively early, however, such premature tepal abscission was associated with the deformation of the tepals, presumably because such high concentrations were toxic. The detachment force was reduced in both control and CEPA (0.5 ppm and lower) treated flowers approximately 4 d before abscission occurred. This is considerably later than the ethylene-sensitive abscising species Arabidopsis, where cell separation and a decrease in petal detachment force (breakstrength) occurs from the time of anthesis (Patterson and Bleeker, 2004Go). In Alstroemeria flowers maintained in water, anthesis begins 2 d after harvest, but breakstrength does not reduce for another 2 d, i.e. after anthesis of all six anthers has occurred. This time point is coincident with opening of the stigmatic lobes, and is therefore similar to the situation in Digitalis (Stead and Moore, 1977Go).

Despite the ability of CEPA to induce, and for STS to delay, abscission of the perianth the endogenous production of ethylene was very low; indeed no significant differences were detected from isolated flowers of differing ages when gas chromatography was used. Using a laser-driven photoacoustic detector, the detection limit is greatly reduced (Woltering et al., 1988Go), furthermore, this technique uses a flow-through system, thus avoiding the build-up of ethylene in a closed container which might otherwise stimulate the production of autocatalytic ethylene (Lelièvre et al., 1998Go). The low level of ethylene production from both Alstroemeria varieties was much less than that associated with other flowers, for example, carnation flowers produced over 80-fold more with a maximum of 25 nl g–1 FW h–1 (Shibuya et al., 2000Go). In young tomato flowers production is even higher; before pollination a minimum of 150 nl g–1 FW h–1 was produced, rising to over 300 nl g–1 FW h–1 after pollination (Llop-Tous et al., 2000Go). In tulips, low levels of ethylene production were reported throughout senescence and during abscission, but uniquely in one of the varieties studied using photoacoustics, tepal abscission appeared to occur in the complete absence of ethylene production (Sexton et al., 2000Go). There was a 4–5-fold increase in ethylene production from Alstroemeria flowers concomitant with perianth abscission. An Alstroemeria flower weighs a maximum of 2 g, hence this is still equal to only 6 nl g–1 FW h–1 in Rebecca, much less than reported for other species. This increase occurred over a 24 h period, moreover it would seem that the rate of production declined at a similar rate. Such low rates of ethylene production are consistent with the observation that very low concentrations of CEPA accelerate perianth abscission, thus it would appear that Alstroemeria flowers might be very sensitive to ethylene, but sensitivity only develops late in vase life. Indeed perhaps it is this very sensitivity, and the timing of it, that prevents STS from having such a dramatic effect on flower longevity in this species.

Given that there was an increase in the rate of ethylene production from isolated Alstroemeria flowers, it was anticipated that the genes involved in ethylene biosynthesis might show up-regulation in the later stages of petal senescence. However, the normalized values of ALSACS1-1 and ALSACS2-1 showed a less than 2.5-fold change from S0 to S7, indicating that these members of the ACC synthase gene family are unlikely to regulate ethylene biosynthesis transcriptionally. This is in contrast to some flower species, including Rose varieties such as Kardinal (Wang et al., 2004Go). It is possible, however, that transcriptional regulation of ethylene biosynthesis is at the ACC oxidase level since ALSACO1-1 showed very little change over the first six stages of development, but then increased by over 4.5-fold in the last two stages of development prior to abscission. In addition, previous work has shown that Alstroemeria petals can convert >1 mM ACC to ethylene, supporting the conclusion that ACC oxidase is functional in this system (Stead et al., 2003Go). A similar pattern of gene expression was observed in the rose cultivar Bronze, which showed no change in ACC synthase expression during senescence, but an increase of an ACC oxidase transcript prior to petal abscission (Muller et al., 2000Go). Thus in rose the transcriptional regulation of ethylene biosynthesis may be variety-specific. In a project related to the present one, nearly 2000 Alstroemeria transcripts were sequenced from subtracted (Breeze et al., 2004Go) and global (C Wagstaff, unpublished data) cDNA libraries in order to identify both up- and down-regulated genes at several stages between stage 0 and stage 5. Of these, none relating to ethylene biosynthesis were identified, supporting this hypothesis that ethylene biosynthesis only occurs after this stage, i.e. post-stigmatic lobe opening. Such patterns of expression show that ethylene biosynthetic genes are up-regulated very late on, in fact after those processes that had previously been identified as being up-regulated around stage 5: for example, DNA laddering, electrolyte leakage, fresh weight loss, and protease activity. By contrast, sensitivity to applied ethylene develops a little earlier, probably concomitant with these processes (Fig. 7c in Wagstaff et al, 2003Go).

From measurements of total protease activity it was concluded that acceleration of abscission by exogenous ethylene results in a concomitant acceleration of protein breakdown. Conversely, delaying abscission with STS results in reduced levels of protease activity. Thus it is clear from these data that physiological markers of senescence other than abscission are regulated by ethylene in this species. Exogenous ethylene application has been shown to enhance protease activity in parsley leaves (Jiang et al., 1999Go) and cysteine protease gene expression in carnation petals (Jones et al., 1995Go), resulting in premature senescence. It is not certain from the present study if changes in endogenous levels of ethylene are a precursor of proteolytic activity. From previous studies (Wagstaff et al., 2002Go) the reverse would appear to be the case as a rise in proteolysis was observed from stage 5 onwards. This is several days ahead of the rise in ethylene production reported in the present work, but concomitant with the time at which ALSACO1-1 expression was detected. Therefore it was hypothesized that proteolysis can be induced or repressed by altering ethylene levels, but that in the absence of external STS or ethylene treatments the proteolytic cascade is initiated and regulated by some other means.

An examination of the ethylene sensitivity and responsiveness of Alstroemeria flowers using a range of techniques has shown that this species senesces independently of endogenous ethylene production, but that the completion of abscission requires a small burst of ethylene in the previous 24 h prior to cell separation. The use of photoacoustics has enabled the endogenous ethylene production of this species to be characterized very precisely, and in a way that would not have been possible with older technologies. Using a gas chromatograph this species would be classified as showing ethylene-insensitive abscission, a conclusion that would have been incorrect, since Alstroemeria is clearly sensitive to extremely small concentrations of endogenous and exogenous ethylene, although sensitivity develops late in the life of this flower. In addition, the photoacoustic data supported evidence from abscission following CEPA treatment that there is a varietal difference in the sensitivity of Alstroemeria to ethylene. Samora responded to lower concentrations of CEPA than Rebecca and produced an order of magnitude less ethylene than the latter. Alternative systems of measurement using static gas collection systems rather than a continuous flow method raise questions of autocatalytic ethylene production in sealed chambers such that it is not always clear exactly what is being measured. Photoacoustics is a valuable tool with potential for examining other ethylene-producing events in plant development such as wound- and pollination-responses at a much more sensitive level than has previously been possible, and may lead to the recharacterization of processes in some species that were thought to be ethylene independent.


    Acknowledgements
 
The authors are grateful to Adrian Franke of Oak Tree Nurseries, Egham, UK for supplying Alstroemeria flowers of both varieties and to Lyndon Tuck and Ezra Linley, Cardiff University for maintaining stocks in the botanic garden and sequencing, respectively. CW, BT, ADS, and HJR were in receipt of a MAFF Grant (No. HH2122TOF) that funded part of this work. UC's PhD was funded by the Thai Government at Royal Holloway, University of London. Photoacoustic studies were supported by European funding to use the Life Sciences Trace Gas facilities at Nijmegen, Holland.


    Footnotes
 
* Present address: School of Biological Sciences, University of Southampton, Bassett Crescent East, Southampton SO16 7PX, UK. Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Breeze E, Wagstaff C, Harrison E, Bramke I, Rogers HJ, Stead AD, Thomas B, Buchanan-Wollaston V. 2004. Gene expression patterns to define stages of post harvest senescence in Alstroemeria petals. Plant Biotechnology Journal 2, 155–168.[CrossRef][Web of Science][Medline]

Bui AQ, O'Neill SD. 1998. Three 1-aminocyclopropane-1-carboxylate synthase genes regulated by primary and secondary pollination signals in orchid flowers. Plant Physiology 116, 419–428.[Abstract/Free Full Text]

Burdon JN, Sexton R. 1993. Ethylene co-ordinates petal abscission in red raspberry (Rubus idaeus L.) flowers. Annals of Botany 72, 289–294.[Abstract/Free Full Text]

Burnik-Tiefengraber T, Weis KG, Webster BD, Martin GC, Yamada H. 1994. Phosphorus effects on olive leaf abscission. Journal of the American Society for Horticultural Science 119, 765–769.

Butenko MA, Patterson SE, Grini PE, Stenvik GE, Amundses SS, Mandal A, Aalen RB. 2003. Inflorescence deficient in abscission controls floral organ abscission in Arabidopsis and identifies a novel family of putative ligands in plants. The Plant Cell 15, 2296–2307.[Abstract/Free Full Text]

Celikel FG, van Doorn WG. 1995. Solute leakage, lipid peroxidation and protein degradation during the senescence of Iris tepals. Physiologia Plantarum 94, 515–521.[CrossRef]

Chanasut U, Rogers HJ, Leverentz MK, Griffiths G, Thomas B, Wagstaff C, Stead AD. 2003. Increasing flower longevity in Alstroemeria. Postharvest Biology and Biotechnology 29, 324–332.

Clark DG, Richards C, Hilioti Z, Lind-Iverson S, Brown K. 1997. Effect of pollination on accumulation of ACC synthase and ACC oxidase transcripts, ethylene production and flower petal abscission in geranium (Pelargoniumxhortorum LH Bailey). Plant Molecular Biology 34, 855–865.[CrossRef][Web of Science][Medline]

Collier DE. 1997. Changes in respiration, protein and carbohydrates of tulip tepals and Alstroemeria petals during development. Journal of Plant Physiology 150, 446–451.[CrossRef][Web of Science]

De Martinis D, Cotti G, Hekker ST, Harren FJM, Mariani C. 2002. Ethylene response to pollen tube growth in Nicotiana tabacum flowers. Planta 214, 806–812.[CrossRef][Web of Science][Medline]

Gubrium EK, Clevenger DJ, Clark DG, Barrett JE, Nell TA. 2000. Production and horticultural performance of transgenic ethylene-insensitive petunias. Journal of the American Society for Horticultural Science 125, 277–281.

Jiang WB, Lers A, Lomaniec E, Aharoni N. 1999. Senescence-related serine protease in parsley. Phytochemistry 50, 377–382.[CrossRef][Web of Science]

Jones ML. 2003. Ethylene biosynthetic genes are differentially regulated by ethylene and ACC in carnation styles. Plant Growth Regulation 40, 129–138.[CrossRef][Web of Science]

Jones ML, Larsen PB, Woodson WR. 1995. Ethylene-regulated expression of a carnation cysteine proteinase during flower petal senescence. Plant Molecular Biology 28, 505–512.[CrossRef][Web of Science][Medline]

Jones ML, Woodson WR. 1997. Pollination-induced ethylene in carnation: role of stylar ethylene in corolla senescence. Plant Physiology 115, 205–212.[Abstract]

Kende H. 1993. Ethylene biosynthesis. Annual Review of Plant Physiology and Plant Molecular Biology 44, 283–307.[CrossRef][Web of Science]

Lay VJ, Prescott AG, Thomas PG, John P. 1996. Heterologous expression and site-directed mutagenesis of the 1-aminocyclopropane-1-carboxylate oxidase from kiwifruit. European Jouranal of Biochemistry 242, 228–234.[CrossRef]

Lay Yee M, Stead AD, Reid MS. 1992. Flower senescence in daylily (Hemerocallis). Physiologia Plantarum 86, 308–314.[CrossRef]

Lelièvre JM, Latché A, Jones B, Bouzayen M, Pech JC. 1998. Ethylene and fruit ripening. Physiologia Plantarum 101, 727–739.

Leverentz M, Wagstaff C, Rogers H, Stead A, Chanasut U, Silkowski H, Thomas B, Weichert H, Feussner I, Griffiths G. 2002. Characterisation of a novel lipoxygenase-independent senescence mechanism in Alstroemeria peruviana floral tissue. Plant Physiology 130, 273–283.[Abstract/Free Full Text]

Llop-Tous I, Barry CS, Grierson D. 2000. Regulation of ethylene biosynthesis in response to pollination in tomato flowers. Plant Physiology 123, 971–978.[Abstract/Free Full Text]

Mita S, Kirita C, Kato M, Hyodo H. 1999. Expression of ACC synthase is enhanced earlier than that of ACC oxidase during fruit ripening of mume (Prunus mume). Physiologia Plantarum 107, 319–328.[CrossRef]

Muller R, Lind-Iverson S, Stummann BM, Serek M. 2000. Expression of genes for ethylene biosynthetic enzymes and an ethylene receptor in senescing flowers of miniature potted roses. Journal of Horticultural Science and Biotechnology 75, 12–18.

Nichols R. 1977. Sites of ethylene production in the pollinated and unpollinated senescing carnation (Dianthus caryophyllus) inflorescence. Planta 135, 155–159.[CrossRef]

O'Neill SD, Nadeau JA, Zhang XS, Bui AQ, Halevy AH. 1993. Inter-organ regulation of ethylene biosynthetic genes by pollination. The Plant Cell 5, 419–432.[Abstract]

Patterson SE, Bleeker AB. 2004. Ethylene-dependent and -independent processes associated with floral organ abscission in Arabidopsis. Plant Physiology 134, 194–203.[Abstract/Free Full Text]

Sanchez AM, Mariani C. 2002. Expression of the ACC synthase and ACC oxidase coding genes after self-pollination and incongruous pollination of tobacco pistils. Plant Molecular Biology 28, 351–359.[CrossRef]

Serek M, Sisler EC, Reid MS. 1995. Effects of 1-MCP on the vase life and ethylene response of cut flowers. Plant Growth Regulation 16, 93–97.[CrossRef]

Sexton R, Laird G, van Doorn W. 2000. Lack of ethylene involvement in tulip tepal abscission. Physiologia Plantarum 108, 321–329.[CrossRef]

Shibuya K, Yoshioka T, Hashiba T, Satoh S. 2000. Role of the gynoecium in natural senescence of carnation (Dianthus caryophyllus L.) flowers. Journal of Experimental Botany 51, 2067–2073.[Abstract/Free Full Text]

Stead AD, Malcolm P, Breeze E, Buchanan-Wollaston V, Thomas B, Rogers HJ, Wagstaff C. 2003. Ethylene and Alstroemeria—a grey area. In: Vendrell M, Klee H, Pech J-C, Romojaro F, eds. Biology and biotechnology of the plant hormone ethylene III, 1st edn. Vol. 349. Amsterdam: IOS Press, 340–344.

Stead AD, Moore KG. 1977. Flower development and senescence in Digitalis purpurea L., cv. Foxy. Annals of Botany 41, 283–292.[Abstract/Free Full Text]

Stead AD, Moore KG. 1983. Studies on flower longevity in Digitalis. The role of ethylene in corolla abscission. Planta 157, 15–21.[CrossRef]

Stead AD, Reid MS. 1990. The effect of pollination and ethylene on the color-change of the banner spot of Lupinus albifrons (Bentham) flowers. Annals of Botany 66, 655–663.[Abstract/Free Full Text]

Stead AD, van Doorn W. 1994. Strategies of flower senescence. In: Scott R, Stead AD, eds. Molecular and cellular aspects of plant reproduction. SEB Symposium, Vol. 55. Cambridge: Cambridge University Press, 215–237.

Uda A, Yamanaka M, Fukushima K, Koyama Y. 1996. Effects of various concentration and durations of treatment with silver thiosulfate complex (STS) solution of Ag absorption, distribution and the vase life of cut carnations. Journal of the Japanese Society for Horticultural Science 64, 927–933.

van Doorn WG, Hibma J, Dewit J. 1992. Effect of exogenous hormones on leaf yellowing in cut flowering branches of Alstroemeria pelegrina L. Plant Growth Regulation 11, 445–448.

van Doorn W, Stead AD. 1997. Abscission of flowers and floral parts. Journal of Experimental Botany 48, 821–837.[Abstract/Free Full Text]

Veen H. 1979. Effects of silver on ethylene synthesis and action in cut carnations. Planta 145, 467–70.[CrossRef]

Wagstaff C, Leverentz M, Griffiths G, Thomas B, Chanasut U, Stead A, Rogers HJ. 2002. Cysteine protease gene expression and proteolytic activity during senescence of Alstroemeria petals. Journal of Experimental Botany 53, 233–240.[Abstract/Free Full Text]

Wagstaff C, Malcolm P, Rafiq A, Leverentz M, Griffiths G, Thomas B, Stead A, Rogers H. 2003. Programmed cell death (PCD) processes begin extremely early in Alstroemeria petal senescence. New Phytologist 160, 49–59.[CrossRef][Web of Science]

Wagstaff C, Rogers HJ, Chanasut U, Stead AD. 2001. Characterisation of Alstroemeria flower vase life. Acta Horticulturae 543, 161–175.

Wang D, Fan J, Ranu RS. 2004. Cloning and expression of 1-aminocyclopropane-1-carboxylate synthase cDNA from Rosa (Rosaxhybrida). Plant Cell Reports 22, 422–429.[CrossRef][Web of Science][Medline]

Weterings K, Pezzotti M, Cornelissen M, Mariani C. 2002. Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles. Plant Physiology 130, 1190–1200.[Abstract/Free Full Text]

Woltering EJ, de Vrije T, Harren F, Hoekstra FA. 1997. Pollination and stigma wounding: same response, different signal? Journal of Experimental Botany 48, 1027–1033.[Abstract/Free Full Text]

Woltering EJ, Harren F, Boerrigter AM. 1988. Use of a laser-driven photoacoustic detection system for the measurement of ethylene production in Cymbidium flowers. Plant Physiology 88, 506–510.[Abstract/Free Full Text]

Woltering EJ, Somhorst D, De Beer CA. 1993. Roles of ethylene production and sensitivity in senescence of carnation flower (Dianthus caryophyllus) cultivars White Sim, Chinera and Epomeo. Journal of Plant Physiology 141, 329–335.[Web of Science]

Woltering EJ, van Doorn WG. 1988. Regulation of ethylene in senescence of petals: morphological and taxonomic relationships. Journal of Experimental Botany 39, 1605–1616.[Abstract/Free Full Text]

Woodson WR, Park KY, Drory A, Larsen PB, Wang H. 1992. Expression of ethylene biosynthetic pathway transcripts in senescing carnation flowers. Plant Physiology 99, 526–532.[Abstract/Free Full Text]

Xu Y, Hanson MR. 2000. Programmed cell death during pollination-induced petal senescence in petunia. Plant Physiology 122, 1323–1333.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Plant Physiol.Home page
A. M. Price, D. F. Aros Orellana, F. M. Salleh, R. Stevens, R. Acock, V. Buchanan-Wollaston, A. D. Stead, and H. J. Rogers
A Comparison of Leaf and Petal Senescence in Wallflower Reveals Common and Distinct Patterns of Gene Expression and Physiology
Plant Physiology, August 1, 2008; 147(4): 1898 - 1912.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
A. K. Azad, T. Ishikawa, T. Ishikawa, Y. Sawa, and H. Shibata
Intracellular energy depletion triggers programmed cell death during petal senescence in tulip
J. Exp. Bot., May 31, 2008; (2008) ern066v1.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
J. Xue, Y. Li, H. Tan, F. Yang, N. Ma, and J. Gao
Expression of ethylene biosynthetic and receptor genes in rose floral tissues during ethylene-enhanced flower opening
J. Exp. Bot., May 1, 2008; 59(8): 2161 - 2169.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
V. D. Cin, A. Boschetti, A. Dorigoni, and A. Ramina
Benzylaminopurine Application on Two Different Apple Cultivars (Malus domestica) Displays New and Unexpected Fruitlet Abscission Features
Ann. Bot., June 1, 2007; 99(6): 1195 - 1202.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. Della Mea, F. De Filippis, V. Genovesi, D. Serafini Fracassini, and S. Del Duca
The Acropetal Wave of Developmental Cell Death of Tobacco Corolla Is Preceded by Activation of Transglutaminase in Different Cell Compartments
Plant Physiology, June 1, 2007; 144(2): 1211 - 1222.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
N. Ma, H. Tan, X. Liu, J. Xue, Y. Li, and J. Gao
Transcriptional regulation of ethylene receptor and CTR genes involved in ethylene-induced flower opening in cut rose (Rosa hybrida) cv. Samantha
J. Exp. Bot., August 1, 2006; 57(11): 2763 - 2773.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
H. J. ROGERS
Programmed Cell Death in Floral Organs: How and Why do Flowers Die?
Ann. Bot., March 1, 2006; 97(3): 309 - 315.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
V. D. Cin, M. Danesin, A. Boschetti, A. Dorigoni, and A. Ramina
Ethylene biosynthesis and perception in apple fruitlet abscission (Malus domestica L. Borck)
J. Exp. Bot., November 1, 2005; 56(421): 2995 - 3005.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
56/413/1007    most recent
eri094v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wagstaff, C.
Right arrow Articles by Stead, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wagstaff, C.
Right arrow Articles by Stead, A. D.
Agricola
Right arrow Articles by Wagstaff, C.
Right arrow Articles by Stead, A. D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?