JXB Advance Access originally published online on June 13, 2005
Journal of Experimental Botany 2005 56(418):2037-2046; doi:10.1093/jxb/eri202
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH PAPER |
Different ethylene receptors show an increased expression during the ripening of strawberries: does such an increment imply a role for ethylene in the ripening of these non-climacteric fruits?*

Dipartimento di Biologia, Università di Padova, Via G. Colombo 3, I-35121 Padova, Italy
To whom correspondence should be addressed. Fax: +39 049 8276280. E-mail: giorgio.casadoro{at}unipd.it
Received 12 November 2004; Accepted 18 April 2005
| Abstract |
|---|
|
|
|---|
Notwithstanding the economic importance of non-climacteric fruits like grape and strawberry, little is known about the mechanisms that regulate their ripening. Up to now no growth regulator has emerged with a primary role similar to that played by ethylene in the ripening of the climacteric fruits. Strawberries can produce ethylene, although in limited amounts. Two cDNAs coding for enzymes of the ethylene biosynthetic pathway (i.e. FaACO1 and FaACO2), and three cDNAs encoding different ethylene receptors have been isolated. Two receptors (i.e. FaEtr1 and FaErs1) belong to the type-I while the third (i.e. FaEtr2) belongs to the type-II group. The expression of both the ACO and the receptor-encoding genes has been studied in fruits at different stages of development and in fruits treated with hormones (i.e. ethylene and the auxin analogue NAA). All the data thus obtained have been correlated to the known data about ethylene production by strawberry fruits. Interestingly, a good correlation has resulted between the expression of the genes described in this work and the data of ethylene production. In particular, similarly to what occurs during climacteric fruit ripening, there is an increased synthesis of receptors concomitant with the increased synthesis of ethylene in strawberries as well. Moreover, the receptors mostly expressed in ripening strawberries are the type-II ones, that is those with a degenerate histidinekinase domain. Since the latter domain is thought to establish a weaker link to the CTR1 proteins, even the little ethylene produced by ripening strawberries might be sufficient to trigger ripening-related physiological responses.
Key words: Ethylene biosynthesis genes (FaACO1, FaACO2), ethylene receptor genes (FaEtr1, FaErs1, FaEtr2), Fragariaxananassa, non-climacteric fruit ripening, strawberry
| Introduction |
|---|
|
|
|---|
Fruits are important for plants because they protect the seeds during their development and subsequently favour their dispersal into the environment. In addition to plants, fruits are important for animals in general, and for mankind in particular. However, while the relevance of dry fruits is mostly due to the seeds they contain (e.g. legumes), in the case of fleshy fruits it is the fruits themselves that have an intrinsic economical value since they form a significant part of the animals' diet.
Just because of their characteristics, fleshy fruits are liable to a post-harvest deterioration that impairs their preservation and is a cause of great losses. Therefore, efforts have long been made to understand the regulatory mechanisms of fleshy fruit ripening. Such knowledge is considered particularly useful to delay or, possibly, control this fundamental physiological process.
The finding, many years ago, that ethylene is able to hasten the ripening of several fleshy fruits (i.e. the climacteric ones) has led many researchers in this field to study the role of ethylene in the regulation of climacteric fruit ripening. In particular, the discovery of the hormone biosynthetic pathway has led to the cloning of the genes encoding the two major enzymes of this pathway (i.e. 1-aminocyclopropane-1-carboxylate synthetase [ACS] and 1-aminocyclopropane-1-carboxylate oxidase [ACO]), thus paving the way to the preparation of anti-sense plants with down-regulated ethylene biosynthesis (Oeller et al., 1991
; Hamilton et al., 1990
). With regard to the latter, it is interesting to note that the characterization of those plants has brought on a reassessment of the role of ethylene. On the one hand, the involvement of ethylene and its receptors in the ripening of climacteric fruits has been reaffirmed (Sato-Nara et al., 1999
; Rasori et al., 2002
; El-Sharkawy et al., 2003; Klee, 2004
), while on the other hand, it has emerged that the role played by the hormone is not exclusive since ethylene-independent pathways are also involved in the ripening process (Giovannoni, 2004
).
In contrast to the great deal of information regarding the regulation of ripening in climacteric fruits, much less is known about non-climacteric ones. Moreover, the data available to date seem to exclude the existence of a unique regulative model for all of these fruits. At present, no single growth regulator appears to play a positive role analogous to the role played by ethylene in the ripening of climacteric fruits.
It has been observed for a long time that auxin can negatively control the ripening of some non-climacteric fruits. In strawberry it has been shown that the expression of many ripening specific genes can be down-regulated by treatments with an exogenous auxin. By contrast, the expression of ripening-specific genes is accelerated following the removal of the achenes which are a source of endogenous auxin. Also in grape auxin seems to play a negative role in the regulation of ripening. In fact, it has been shown that treatments with a synthetic auxin are able to delay the expression of a number of ripening-related genes (Davies et al., 1997
).
Since non-climacteric fruits are also able to synthesize ethylene, and in some cases it has been seen that ethylene can hasten the post-harvest deterioration, the possible involvement of this hormone in the ripening of the non-climacteric fruits has been studied in different laboratories. However, in spite of the many efforts, no results have been obtained that can demonstrate a clear relation between ethylene and the ripening of these fruits.
In pepper fruits, some cultivars seem to be ethylene insensitive, while in other cases continuous treatments with exogenous ethylene have been shown to accelerate ripening (Armitage, 1989
) and to up-regulate the expression of ripening-specific genes (Ferrarese et al., 1995
: Harpster et al., 1997
). In grape berries, treatments with exogenous ethylene were able to stimulate the expression of genes related to anthocyanin biosynthesis (El-Kereamy et al., 2003
). Also an involvement of this hormone in the expression of an alcohol dehydrogenase gene has been demonstrated in grape (Tesniere et al., 2004
). Recently, it has been shown that young Citrus fruitlets are able to synthesize ethylene in a manner that resembles the system II pathway of the climacteric fruits. In these fruitlets, treatments with exogenous ethylene also suggest that such a system II-like biosynthesis is autocatalytic. By contrast, in fully developed Citrus fruits ethylene treatments are able to hasten the de-greening, but not other aspects of the ripening syndrome (Katz et al., 2004
).
An even more complex situation appears to be present in strawberry with regard to the relationship between ethylene and the ripening of fruits. Data have been published by different laboratories that apparently contradict each other and so analysis of those data does not show any well-defined effects of ethylene on strawberry fruits (Bower et al., 2003
). Moreover, in order to explain the variability of results obtained by treating strawberry with ethylene and/or 1-methylcyclopropene (1-MCP), Tian et al. (2000)
proposed the hypothesis that strawberries might have ethylene receptors different from those present in climacteric fruits, and/or that ethylene receptors might carry out different functions in non-climacteric fruits.
In this work, the isolation and characterization of three strawberry cDNAs encoding different ethylene receptors and two ACO encoding cDNA fragments are reported. The expression of all these cDNAs has been analysed in strawberries at different stages of development. Analyses have also been made to study the effects of treatment with hormones on the expression of those genes. The expression patterns obtained have been used to try to establish a possible role for ethylene in the ripening of non-climacteric strawberry fruits.
| Materials and methods |
|---|
|
|
|---|
Plant material and hormone treatments
Strawberry plant material (Fragariaxananassa Duch. cv. Chandler) was obtained from farms near Verona or at Pergine (Trento). According to Huber (1984)
Fruits to be used in the hormone-treatment experiments were first dipped in an antifungal solution containing promycidon (0.06 g l1). The synthetic auxin 1-naphthalene acetic acid (NAA, 2 mmol l1 and Silwet L-77 as surfactant, 200 µl l1) was sprayed on a pool of fruits every 12 h over a period of 48 h. Ethylene treatment was achieved by flushing fruits, placed in an air-tight chamber, with the gaseous hormone (100 µ l l1 in air) at a flow rate of 6.0 l h1. Control fruits were treated in the same way, omitting the hormones.
All fruits used in this work (i.e. either treated or untreated) were quartered, frozen in liquid nitrogen, and stored at 80 °C for subsequent use.
RNA extraction
RNA was extracted using the Nucleon PhytoPure system (Amersham Pharmacia Biotech, UK) following the manufacturer's instructions. Since this system was actually developed to obtain DNA, the total RNA was separated from it by means of an overnight precipitation in 2 mol l1 LiCl at 4 °C. When using fruit tissues, the amount of Nucleon PhytoPure resin had to be doubled and the supernatants obtained after the chloroform extractions had to be clarified with a 1 h centrifugation at 11 000 g in order to obtain high quality RNA (OD260/280 >1.8).
Isolation of cDNA clones
Different degenerate oligonucleotides to be used as primers were prepared by back-translating some conserved peptides that had been determined by aligning protein sequences of ethylene receptors and ethylene biosynthetic enzymes. For the ethylene receptors, the two which gave positive results were etr 3 (GARTGTGCWTTGTGGATGCC using IUB codes) and etr6 (ATNGCAGCATGKGARAGAGC), whose sequences (the inverse complement for etr6) correspond to conserved peptides ECALWM (aa 178183 of Arabidopsis etr1) and ALSHAA (aa 306311 of Arabidopsis etr1), respectively. For ethylene biosynthetic genes, positive results were only obtained for ACOs, while the attempts to obtain ACS genes were unsuccessful. For ACO genes, four degenerate oligos were synthesized on the sequences of three different conserved peptides. Peptide 1 (FELVSHGI, aa 133154 of the PpACO1 protein) was used to synthesize ACOfor1 (TTGAGYTKGTGARYCATGGGAT); peptide 2 (FQDDKVS, aa 591609 of the PpACO1 protein) was used to synthesize ACOfor2 and ACOrev1 (TTCCARGATGACAAGGTCAG, CTGACCTTGTCATCYTGGAA, respectively) while peptide 3 (VFEDYMKL, aa 874895 of the PpACO1 protein) was used to synthesize ACOrev2 (AGCTTCATGTARTCWTCRAACA). 2 µg of total RNA were used as the starting material for the RT-PCR experiments. The first-strand synthesis was carried out with the SuperScript kit (Life Technologies, USA) using oligo-dT as primer. An aliquot (2 µl) of the first-strand reaction was used for the subsequent PCR amplification. PCR reactions with 200 pmol of the possible primer combinations and 2.5 mmol l1 MgCl2 were performed in 50 µl volumes using a GeneAmp PCR system 9700 (Applied Biosystems, USA) apparatus. Denaturation, annealing, and extension temperatures were 94 °C for 30 s, 48 °C for 30 s, and 72 °C for 45 s, respectively. This cycle was repeated 35 times. The PCR products were separated by gel electrophoresis and the fragments of interest cloned either in the pCR2.1 vector (Invitrogen, USA) or in the pGEM-T vector (Promega, USA).
A cDNA library obtained from red strawberry fruits (reported in Trainotti et al., 1999
) was used for the isolation of the full-length cDNA clones of the ethylene receptors. The screening was carried out by using as probes three different fragments obtained from the RT-PCR experiments. After isolation, the positive phagemids were excised in vivo by means of a helper phage.
DNA sequencing and analysis
DNA sequencing was performed at the University of Padua sequencing facility (CRIBI) using a PCR-based dideoxynucleotide terminator protocol and an automated sequencer (Applied Biosystems ABI PRISM 3700 DNA Analyzer). Sequences were determined on both strands using, when necessary, chemically synthesized oligonucleotides. Sequence manipulations, analyses, and alignments were performed using the Lasergene software package (DNASTAR, USA). Multiple sequence alignments were performed with the CLUSTAL W computer program (Thompson et al., 1994
). Strawberry protein sequences used to construct the sequence alignments were deduced from the nucleic acid sequences, while those regarding other species were obtained from public databases (accession numbers are given in the figure legends).
Expression analyses by Quantitative Real-Time PCR (QRT-PCR)
cDNA to be used as templates for Real-Time PCR were prepared with the High Capacity cDNA Archive Kit (Applied Biosystems) from 2 µg of total RNA, pretreated with 1.5 units of DNase I. Primer sequences for the selected genes were: LT269: GGTGACCTCATTCCCGTCTTT and LT270: ACAGGCCTCCATCAGAATTGA for FaEtr1; LT279: CTTCAAGAGATTGGCGACCAC and LT280: GGATCCATTTCTGGGCTGAG for FaErs1; LT186: GTTCGGCGTTGTTTTTAC and LT187: AGCTTCCCTCGTCGTCAC for FaEtr2; LT281: TACCTCAAGCACCTTCCTCGC and LT287: TTAGTGCCAAAGGTAGGACTA for FaACO1; LT286 GAAAGCACCTTCTTCTTGCG and LT288 CACCTTGGTACCAAAATTTGGT for FaACO2; DZ79: TGACCTGGGGTCGCGTTGAA and DZ81: TGACCTGGGGTCGCGTTGAA for the Internal Transcribed Spacer of the ribosomal RNA, used as internal standard (Benitez-Burraco et al., 2003
). Reactions were carried out using 25 µl of the Syber green PCR master mix (Applied Biosystems), with 0.05 pmol of each primer, in the 5700 instrument (Applied Biosystems). PCR condition were as follow: an incubation to 95 °C for 10 min to activate the enzyme. Then the following cycle was repeated 40 times: 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 15 s. The obtained CT values were analysed by means of the Q-gene software (Muller et al., 2002
) by averaging the three independently calculated normalized expression values of the triplicate. For the absolute quantification of ethylene receptors in red fruits, calibration curves have been constructed using several dilution of the three cDNAs and quantification values have been obtained by using the software of the Real-Time PCR instrument. The numerical values obtained with these calculations were transformed into graphics by means of the GraphPad software (GraphPad Software, USA).
| Results |
|---|
|
|
|---|
Cloning of ethylene receptors
RT-PCR experiments performed with degenerate oligonucleotides and RNA extracted from ripe strawberries yielded three cDNA fragments encoding different ethylene receptors (not shown). The sequences of these fragments (of about 400 bp in length) gave sufficient information to understand that they were the orthologues of the Arabidopsis etr1, ers1, and etr2 genes. Accordingly, the three cDNAs were used to screen a cDNA library representative of ripe strawberry fruits (Trainotti et al., 1999
|
A comparison of the three strawberry ethylene receptor sequences with those from other plants yielded some more information (Fig. 2). The Etr1-like FaEtr1 formed a group with other sequences from plants belonging to the same Rosaceous family while the corresponding sequences from non-climacteric plants (i.e. Citrus and Vitis) were situated in another group. Also in the case of the Ers-like receptors, the strawberry FaErs1 clone was more similar to the Rosaceous sequences, although the higher dissimilarity of this group of sequences makes less significant the divergence from the non-climacteric Citrus protein. Finally, the Etr2-like FaEtr2 seemed to be more homologous to the corresponding sequence from muskmelon than to the known tomato counterparts LeEtr4 and LeEtr5, respectively. As observed with other genes, it appears therefore evident that, at least for the Etr1-like and the Ers-like genes, the degree of species evolutionary kinship is more relevant than the physiological similarity to determine the degree of sequence conservation.
|
Cloning of ethylene biosynthetic genes
Besides the ethylene receptors, two cDNA fragments encoding different ACO genes were isolated by RT-PCR. The two different cDNAs were named FaACO1 and FaACO2, respectively. FaACO1 is 767 bp long and its encoded protein corresponds to a fragment (aa 35-288) of the protein encoded by the peach ACO1 gene (Ruperti et al., 2001
|
Expression of ethylene receptor mRNAs
In general, the expression of the three ethylene receptor genes was extremely low in strawberry, therefore QRT-PCR was used to analyse their relative expression in flowers, in fruits at different stages of development, and in mature leaves as an example of vegetative tissues. In the various experiments, the expression data in the different samples were expressed as a percentage of those obtained for the small green fruits (SG) arbitrarily set to 100 (Fig. 4). In mature leaves the transcript amount of two receptor genes (FaEtr1 and FaErs1) was comparable to that found in the small green fruits, while the leaves had a higher mRNA content in the case of the FaEtr2 gene. The pattern of expression of the three ethylene receptor genes appeared quite interesting in flowers and fruits. The transcript amount of the FaEtr1 gene was low in flowers, showed an increase in the small green fruits (SG), and a subsequent decrease in the large green fruits (LG) that was followed by a steep increment which continued throughout the three stages representing the ripening phase. Contrary to what observed with the FaEtr1 gene, the transcript amount of the FaErs1 gene was very high in flowers (over 2-fold that of both mature leaves and small green fruits) and then steadily decreased to reach a minimum in the large green fruits. Afterwards, it increased again till the ripening was completed. A different expression pattern was shown by the FaEtr2 gene. The amount of its transcript was high in the flowers and decreased to a minimum in the small green fruits (SG). During the subsequent fruit growth the transcript signal increased about 3-fold to reach a maximum in the white fruits. Afterwards, although a slight decrease was observed, the transcript amount remained high in the red fruits at well over twice that of the small green fruits.
|
Expression of ethylene biosynthetic genes
In parallel with the analysis of the three ethylene receptor genes, the expression of the two ACO genes (Fig. 5) was also performed. In both cases the highest transcript amount was found in flowers. In the case of the FaACO1 gene expression, a continuous decrease to a minimum in the large green fruits was observed that was followed by a slight increase in the white fruits. Then the amount of the FaACO1 transcripts decreased steadily during the following ripening phase to a minimum in the red fruits. Also in the case of the FaACO2 gene the amount of transcripts observed in flowers appeared to be greatly reduced in the small green fruits. However, the subsequent expression pattern appeared different from the one observed for FaACO1. Between the stages small green and large green the gene showed an increased expression that decayed to a minimum in white fruits. From this stage onward the expression of the FaACO2 gene followed a pattern of continuous increment to a maximum in the red fruits.
|
Effect of hormones on mRNA expression of ethylene receptors
The expression of the three receptor genes was further studied in fruits harvested from the plants and subjected to treatments with hormones (i.e. ethylene and the auxin analogue NAA). The fruits used in these experiments were either at the visible start of ripening (white) or at the end of the ripening process (red). The variations in gene expression observed in fruits detached from the plant and kept in air were low, except for FaErs1 in red fruits (Fig. 6). In general, none of the genes exhibited a particularly strong response to the treatment with exogenous ethylene or with auxin except for FaEtr2, which was strongly up-regulated by the gaseous hormones and down-regulated by NAA (Fig. 6). A different behaviour was shown by fruits according to their state of development. White fruits were more responsive in the case of genes FaEtr1 and FaEtr2, while red fruits gave the highest response in the case of gene FaErs1. Interestingly, the expression of the FaEtr2 gene (i.e. the type-II receptor) showed a positive response to the ethylene treatment, and by far the highest increase (about 7-fold) was found in the white fruits after 24 h of hormone treatment.
|
The finding that the FaEtr1 and FaEtr2 genes were more responsive to ethylene in the white fruits than in the red ones is in line with results by Perkins-Veazie et al. (1996)
Effect of hormones on mRNA expression of ethylene biosynthetic genes
In response to the hormone treatments, a divergent expression pattern was exhibited by the ethylene biosynthesis ACO genes (Fig. 7). FaACO1 showed no increased expression in white fruits kept in air and only a slight increase in the case of the red fruits. By contrast, a significant increment in transcript amount was found following the treatment with exogenous ethylene. However, while in the white fruits the highest increment was observed after the 24 h treatment, in the red fruits it was the 48 h sample that showed the highest transcript increase. Although to a lesser extent, the auxin treatment also appeared able to regulate gene expression positively, but in this case the highest increment was always found in the 24 h samples.
|
With regard to the FaACO2 gene, in agreement with its increasing expression from white to red fruits, the highest increment was found in white fruits kept in air for 48 h. However, contrary to what was observed with the FaACO1 gene, both hormones showed a down-regulating effect on the expression of FaACO2, with the strongest inhibitory effect observed in the auxin-treated fruits.
| Discussion |
|---|
|
|
|---|
Ethylene production in strawberries has been studied by different laboratories. Knee et al. (1977)
The pattern of expression of the two strawberry ACO genes is of particular interest when related to the measurements of ethylene production reported in the literature. Both genes showed the highest expression in flowers and a decreasing rate of expression in the young developing fruits. Afterwards, from the large green to the white stages, FaACO1 showed an expression increment followed by a continuous decrease to reach a minimum in red fruits. In the case of the FaACO2 gene, the minimum was in white fruits and was followed by a continuous slight increment throughout ripening. Therefore, the increasing ethylene production observed during the ripening phase (Perkins-Veazie et al., 1996
) might be sustained by the slightly increasing expression observed for the FaACO2 gene. Besides the known data about the hormone production during the late stages of ripening (Abeles and Takeda, 1990
; Perkins-Veazie et al., 1996
), other and more interesting data have been obtained regarding the production of ethylene by strawberries still attached to their parent plant, hence under more natural physiological conditions (Iannetta et al., 2000
). In particular, besides confirming the increase in ethylene production in ripe strawberries, this study has shown that an increment in hormone production also occurs when expanded fruits progress from a pale-green to a white colour. Interestingly, our data show that in tandem with the measured increase in ethylene production that precedes the visible start of ripening (Iannetta et al., 2000
), the strawberry FaACO1 gene is being actively expressed. Although we are aware that sound experimental data are necessary to prove it, the suggestion remains that the increase in ethylene production described by Iannetta et al. (2000)
prior to the visible start of ripening might act as a necessary signal for the progression of the ripening process, thus indicating a sort of climacteric ethylene production in strawberries. A transient increase in ethylene production has recently been demonstrated to occur in non-climacteric grape fruits just before veraison, that is at the inception of ripening (Chervin et al., 2004
).
The strawberry FaACO1 gene shows a high percentage of similarity to an ACO gene (CsACO1) described in the non-climacteric fruit of Citrus. However, while in Citrus the expression of the CsACO1 gene is up-regulated by ethylene in the very young fruits and is apparently insensitive to the hormone in mature fruits (Katz et al., 2004
), the strawberry FaACO1 gene shows the highest response to ethylene in red ripe fruits rather than in the white ones.
For many ripening-specific genes of strawberry it has been shown that auxin has a negative regulatory effect on their expression (Aharoni et al., 2002
), and a similar inhibitory effect of auxin has been shown here for the FaACO2 gene. Therefore, both the increased expression of FaACO2 that occurs during the ripening phase and the negative regulation of its expression by auxin suggest that this strawberry gene might be correlated to the ripening process.
In tomato and other climacteric fruits there is a great increase in the expression of ethylene receptor genes during the ripening phase (Sato-Nara et al., 1999
; Rasori et al., 2002
; El-Sharkawy et al., 2003; Klee, 2004
). In the non-climacteric strawberry, the expression of the two type-I receptor genes (i.e. FaEtr1 and FaErs1) shows a continuous increment during the ripening phase. As regards the type-II gene (i.e. FaEtr2) its maximum expression is observed in white fruits, that is when ripening starts to become visible, and remains high throughout ripening (Fig. 4). This finding is of particular interest in the light of the fact that LeEtr4, another type-II receptor, has been demonstrated to be very important for the ripening of tomato fruits (Tieman et al., 2000
).
The absolute transcript abundance of the three receptor genes has been determined in the red strawberries (Fig. 8A). By using these values and assuming that the PCR efficiency remains constant in all the samples, the amount of the ethylene receptor genes has been calculated throughout growth and ripening of the strawberry fruits (Fig. 8B). Thus, it appears evident that an overall receptor increase occurs when fruits progress from the large green to the white stages of development that is concurrent with a burst of ethylene production (Iannetta et al., 2000
) and a peak in FaACO1 expression. Then, the high receptor amount remains almost constant throughout ripening in spite of slight quantitative variations among the various gene transcripts. These data imply that the three receptors, together with the ethylene that acts through them, might have some physiological role in the ripening of the non-climacteric strawberries. Moreover, the fact that the type-II FaEtr2 is the most abundant receptor suggests some interesting considerations about possible relations between ethylene and the ripening of strawberries. According to Cancel and Larsen (2002)
, the degenerate histidinekinase domain of the type-II receptors would lead to a weaker affinity for the amino-terminal domain of CTR1 than that of type-I receptors. This means that CTR1 might be released by type-II receptors, like FaEtr2, by lower amounts of ethylene. Therefore, even the little ethylene synthesized by strawberries during their ripening (Abeles and Takeda, 1990
; Perkins-Veazie et al., 1996
; Iannetta et al., 2000
) might be sufficient to trigger some physiological response.
|
What type of responses could be regulated by ethylene in strawberries? Besides being very limited, molecular data about the possible relations between ethylene and the expression of genes during the ripening of strawberries are not all in agreement. According to Civello et al. (1999)
| Acknowledgements |
|---|
We wish to thank Dr P Perini (Consorzio Verde Europa, Verona) and Dr P Faletti (Coop. S. Orsola, Pergine, Trento) for kindly providing the plant material used in this research.
| Footnotes |
|---|
* The nucleotide sequence data reported in this paper will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession numbers AJ297511 (FaEtr1), AJ297512 (FaErs1), AJ297513 (FaEtr2), AJ851828 (FaACO1), and AJ851829 (FaACO2).
| References |
|---|
|
|
|---|
Abeles FB, Takeda F. 1990. Cellulase activity and ethylene in ripening strawberry and apple fruits. Scientia Horticulturae 42, 269275.
Aharoni A, Keizer LCP, Van Den Broeck HC, Blanco-Portales R, M
noz-Blanco J, Bois G, Smit P, De Vos RCH, O'Connell AP. 2002. Novel insight into vascular, stress, and auxin-dependent and -independent gene expression programs in strawberry, a non-climacteric fruit. Plant Physiology 129, 10191031.
Armitage AM. 1989. Promotion of fruit ripening of ornamental peppers by ethephon. HortScience 24, 962964.
Benitez-Burraco A, Blanco-Portales R, Redondo-Nevado J, Bellido ML, Moyano E, Caballero JL, M
noz-Blanco J. 2003. Cloning and characterization of two ripening-related strawberry (Fragariaxananassa cv. Chandler) pectate lyase genes. Journal of Experimental Botany 54, 633645.
Bower JH, Biasi WV, Mitcham EJ. 2003. Effects of ethylene and 1-MCP on the quality and storage life of strawberries. Postharvest Biology and Technology 28, 417423.[CrossRef]
Cancel JD, Larsen PB. 2002. Loss-of-function mutations in the ethylene receptor ETR1 cause enhanced sensitivity and exaggerated response to ethylene in Arabidopsis. Plant Physiology 129, 15571567.
Castillejo C, de la Fuente JI, Iannetta P, Botella MÁ, Valpuesta V. 2004. Pectin esterase gene family in strawberry fruit: study of FaPE1, a ripening-specific isoform. Journal of Experimental Botany 55, 909918.
Chervin C, El-Kereamy A, Roustan JP, Latché A, Lamon J, Bouzayen M. 2004. Ethylene seems required for the berry development and ripening in grape, a non-climacteric fruit. Plant Science 167, 13011305.[CrossRef]
Civello PM, Powell ALT, Sabehat A, Bennett AB. 1999. An expansin gene expressed in ripening strawberry fruit. Plant Physiology 121, 12731279.
Davies C, Boss PK, Robinson SP. 1997. Treatment of grape berries, a non-climacteric fruit with a synthetic auxin, retards ripening and alters the expression of developmentally regulated genes. Plant Physiology 115, 11551161.[Abstract]
El-Kereamy A, Chervin C, Roustan JP, et al. 2003. Exogenous ethylene stimulates the long-term expression of genes related to anthocyanin biosynthesis in grape berries. Physiologia Plantarum 119, 175182.[CrossRef]
El-Sharkawi I, Jones B, Li Z, Lelievre J, Pech JC, Latche A. 2003. Isolation and characterization of four ethylene perception elements and their expression during ripening in pears with/without cold requirement. Journal of Experimental Botany 54, 16151625.
Ferrarese L, Trainotti L, Moretto P, Polverino de Laureto P, Rascio N, Casadoro G. 1995. Differential ethylene-inducible expression of cellulase in pepper plants. Plant Molecular Biology 29, 735747.[CrossRef][Web of Science][Medline]
Giovannoni JJ. 2004. Genetic regulation of fruit development and ripening. The Plant Cell 16, S170S180.
Hamilton AJ, Lycett GW, Grierson D. 1990. Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants. Nature 346, 284287.[CrossRef]
Harpster MH, Lee KY, Dunsmuir P. 1997. Isolation and characterization of a gene encoding endo-ß-1,4-glucanase from pepper (Capsicum annuum L.). Plant Molecular Biology 33, 4759.[CrossRef][Web of Science][Medline]
Huber DJ. 1984. Strawberry fruit softening: the potential roles of polyuronides and hemicelluloses. Journal of Food Science 49, 13101315.[CrossRef]
Iannetta PP, Loorhoven LJ, Davies HV, Harren F. 2000. Ethylene production by strawberry flowers and the ripening fruit. Communication to the 9th international workshop on LASER based photoacoustic trace gas detection in life science. Nijmegen, The Netherlands.
Katz E, Lagunes PM, Riov J, Weiss D, Goldschmidt EE. 2004. Molecular and physiological evidence suggests the existence of a system II-like pathway of ethylene production in non-climacteric Citrus fruit. Planta 219, 243252.[CrossRef][Web of Science][Medline]
Klee HJ. 2004. Ethylene signal transduction. Moving beyond Arabidopsis. Plant Physiology 135, 660667.
Knee M, Sargent JA, Osborne DJ. 1977. Cell wall metabolism in developing strawberry fruits. Journal of Experimental Botany 28, 377396.
Muller PY, Janovjak H, Miserez AR, Dobbie Z. 2002. Processing of gene expression data generated by quantitative real-time RT-PCR. BioTechniques 32, 13721378.[Web of Science][Medline]
Oeller PW, Lu MW, Taylor LP, Pike DA, Theologis A. 1991. Reversible inhibition of tomato fruit senescence by antisense RNA. Science 254, 437439.
Perkins-Veazie PM, Huber DJ, Brecht JK. 1996. In vitro growth and ripening of strawberry fruit in the presence of ACC, STS or propylene. Annals of Applied Biology 128, 105116.
Rasori A, Ruperti B, Bonghi C, Tonutti P, Ramina A. 2002. Characterization of two putative ethylene receptor genes expressed during peach fruit development and abscission. Journal of Experimental Botany 53, 23332339.
Ruperti B, Bonghi C, Rasori A, Ramina A, Tonutti P. 2001. Characterization and expression of two members of the peach 1-aminocyclopropane-1-carboxylate oxidase gene family. Physiologia Plantarum 111, 336344.[CrossRef][Medline]
Sato-Nara K, Yuhashi KI, Higashi K, Hosoya K, Kubota M, Ezura H. 1999. Stage- and tissue-specific expression of ethylene receptor homolog genes during fruit development in muskmelon. Plant Physiology 119, 321329.
Tesniere C, Pradal M, El-Kereamy A, Torregrosa L, Chatelet P, Roustan JP, Chervin C. 2004. Involvement of ethylene signalling in a non-climacteric fruit: new elements regarding the regulation of ADH expression in grapevine. Journal of Experimental Botany 55, 22352240.
Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 46734680.
Tian MS, Prakash S, Elgar HJ, Young H, Burmeister DM, Ross GS. 2000. Responses of strawberry fruit to 1-methylcyclopropene (1-MCP) and ethylene. Plant Growth Regulation 32, 8390.[CrossRef]
Tieman DV, Taylor MG, Ciardi JA, Klee HJ. 2000. The tomato ethylene receptors NR and LeETR4 are negative regulators of ethylene response and exhibit functional compensation within a multigene family. Proceedings of the National Academy of Sciences, USA 97, 56635668.
Trainotti L, Spinello R, Piovan A, Spolaore S, Casadoro G. 2001. ß-Galactosidases with a lectin-like domain are expressed in strawberry. Journal of Experimental Botany 52, 16351645.
Trainotti L, Spolaore S, Pavanello A, Baldan B, Casadoro G. 1999. A novel E-type endo-ß-1,4-glucanase with a putative cellulose-binding domain is highly expressed in ripening strawberry fruits. Plant Molecular Biology 40, 323332.[CrossRef][Web of Science][Medline]
Trainotti L, Zanin D, Casadoro G. 2003. A cell wall-oriented genomic approach reveals a new and unexpected complexity of the softening in peaches. Journal of Experimental Botany 54, 18211832.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
P. Wang, B. Zhang, X. Li, C. Xu, X. Yin, L. Shan, I. Ferguson, and K. Chen Ethylene signal transduction elements involved in chilling injury in non-climacteric loquat fruit J. Exp. Bot., October 30, 2009; (2009) erp302v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Lin, S. Zhong, and D. Grierson Recent advances in ethylene research J. Exp. Bot., August 1, 2009; 60(12): 3311 - 3336. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-r. Yin, K.-s. Chen, A. C. Allan, R.-m. Wu, B. Zhang, N. Lallu, and I. B. Ferguson Ethylene-induced modulation of genes associated with the ethylene signalling pathway in ripening kiwifruit J. Exp. Bot., May 1, 2008; 59(8): 2097 - 2108. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chervin, N. Terrier, A. Ageorges, F. Ribes, and T. Kuapunyakoon Influence of Ethylene on Sucrose Accumulation in Grape Berry Am. J. Enol. Vitic., December 1, 2006; 57(4): 511 - 513. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








