JXB Advance Access originally published online on May 23, 2006
Journal of Experimental Botany 2006 57(10):2165-2172; doi:10.1093/jxb/erj174
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH PAPER |
Cloning and characterization of three thioredoxin h isoforms from wheat showing differential expression in seeds
1Laboratoire d'Agrophysiologie, UMR-INRA, Ecole Supérieure d'Agriculture de Purpan, 75 voie du Toec, F-31076 Toulouse cedex 03, France
2Département des Sciences Techniques Agroindustrielles, Institut Supérieur d'Agriculture de Beauvais, rue Pierre Waguet, F-60026 Beauvais cedex, France
3Instituto de Bioquímica Vegetal y Fotosíntesis, Centro de Investigaciones Científicas Isla de la Cartuja, Universidad de Sevilla-CSIC, Avda Américo Vespucio 49, E-41092 Sevilla, Spain
*To whom correspondence should be addressed. E-mail: fjcejudo{at}us.es
Received 13 December 2005; Accepted 27 February 2006
| Abstract |
|---|
|
|
|---|
Plants contain several genes encoding thioredoxin h. In cereals, type-h thioredoxins are abundant in developing and germinating grains, but the mechanism regulating the expression of these genes and their specific function is poorly known. The cloning of three full-length cDNAs encoding thioredoxin h, stated Trxh1, Trxh2 and Trxh3, from wheat (Triticum aestivum cv. Soissons) seeds is described here. TRXh2 and TRXh3 deduced proteins show high identity between them and with other thioredoxins h previously described from wheat, and contain exclusively the two Cys residues forming part of the active site. By contrast, TRXh1 shows a lower level of identity and contains an additional Cys residue. The three wheat thioredoxins were expressed in E. coli and their activity was demonstrated using both the DTT-dependent insulin assay and a coupled assay with recombinant NTR from wheat. Site-directed mutagenesis showed that the additional Cys residue of TRXh1 has a low effect on its activity but is essential for dimerization. Specific expression of the three thioredoxin genes was analysed by real-time RT-PCR in developing and germinating seeds and seedlings under stressed and unstressed conditions. An increase of Trxh1, Trxh2, and Trxh3 transcripts was detected at the beginning of the desiccation phase during seed development. Early after imbibition, Trxh1, but not Trxh2 or Trxh3, transcripts showed a transient increase. Treatment of wheat seedlings with salt or hydrogen peroxide caused a differential pattern of expression of the three Trxh genes between and within tissues, hence suggesting specific functions for these thioredoxins during germination and early seedling growth.
Key words: Development, germination, real-time RT-PCR, spikes, thioredoxin h, wheat seed
| Introduction |
|---|
|
|
|---|
Seed quality depends on a set of parameters including the structural organization of the storage compounds, protection of tissues against oxidative stress during seed desiccation and germination, or the activation of the metabolism of seed cells upon imbibition. For these processes, dithiol-disulphide exchange is of great importance because it is involved in the regulation of the activity of many seed enzymes and is required for the breakdown of reserve compounds (Wong et al., 1995, 2004). Some of the proteins involved in the dithiol-disulphide exchange have in their active site the most conserved redox motif CXXC; that is, two Cys residues separated by two residues, usually Gly and Pro. This motif is found in proteins of the thioredoxin superfamily, such as thioredoxins and glutaredoxins, which reduce intra and intermolecular disulphide bridges in target proteins (Martin, 1995; Buchanan and Balmer, 2005). This motif presents some degree of flexibility since one of the Cys residues can be substituted by Thr or Ser (Fomenko and Gladyshev, 2003).
Type-h thioredoxins (TRXh) are small proteins of 1214 kDa, containing the conserved active site WCGPC, ubiquitously distributed in most plant organs (Schürmann and Jacquot, 2000). These proteins are abundant in cereal seeds both during development and germination. In germinating seeds, TRXh reduces storage proteins and
-amylase inhibitors (Jiao et al., 1992; Kobrehel et al., 1992; Lozano et al., 1996; Yano et al., 2001a). In addition, TRXh reduces, and activates, a seed-specific serine protease, thiocalsin, therefore playing an important role in the mobilization of storage proteins at early stages of germination (Besse et al., 1996). The identification of a large number of thioredoxin targets in cereal grains confirms its relevant role in seed germination and development (Yano et al., 2001b; Marx et al., 2003).
In developing seeds, immunocytological analysis has shown the presence of TRXh in the pedicel of maize (Santandrea et al., 2002) and wheat seeds (Serrato and Cejudo, 2003), suggesting a role in the traffic of compounds to the endosperm. In addition, the accumulation of TRXh in the nucleus of aleurone and scutellum cells suffering oxidative stress during seed maturation and germination (Serrato et al., 2001; Serrato and Cejudo, 2003) has led to the proposal that TRXh interacts with nuclear factors, as has been shown in mammalian cells (Hirota et al., 1997).
By contrast with the low number of thioredoxin genes in mammals, yeast, and bacteria, which contain only two cytosolic thioredoxins (Laurent et al., 1964; Gan, 1991; Spyrou et al., 1997), plants contain a large number of type-h thioredoxin genes (Reicheld et al., 2002). Functional complementation of thioredoxin-deficient yeast mutants and further analysis of the different Trxh from Arabidopsis has shown that they are involved in different cellular processes (Mouaheb et al., 1998; Laloi et al., 2001). Less information is available on the number of type-h thioredoxins in monocots and their specific function or expression. So far, up to three Trxh genes have been isolated from wheat (Gautier et al., 1998; Serrato et al., 2001). The pattern of expression of two of them, TrxhA and TrxhB, was analysed in developing and germinating seeds and were almost indistinguishable (Serrato et al., 2001). To test the presence of additional genes for Trxh in wheat and to analyse their specific biochemical properties and expression pattern in seeds, a collection of cDNAs has been constructed with RNA from developing wheat seeds. Of this cDNA collection, three full-length cDNA clones encoding different Trxh were isolated. Two of them showed extensive similarity to previously reported Trxh genes and contain exclusively the two Cys residues forming part of the active site. In addition, a TRXh containing an additional Cys residue is described, which was subjected to site-directed mutagenesis to address its possible function. It is shown that this new thioredoxin presents slightly different kinetic properties and a different pattern of expression in seed and vegetative tissues.
| Materials and methods |
|---|
|
|
|---|
Plant material
Wheat (Triticum aestivum cv. Soissons) was grown outdoors (Experimental Station of Lamotte, Toulouse, France). Seeds were harvested at different days after anthesis (DAA), immediately frozen in liquid nitrogen and stored at 80 °C until used. After-ripening spikes were collected and stored at 4 °C. The fresh weight of 40 grains from the middle of the spikes was taken and the dry weight was deduced by oven-drying the grains at 80 °C until a constant weight was reached. Mature seeds were allowed to germinate in the dark under controlled, sterile conditions on filter paper soaked with water, 100 mM NaCl, or 10 mM H2O2, for up to 3 d. All reagents were of analytical grade and were purchased from Sigma.
Total RNA extraction and cDNA isolation
Plant tissues were dissected, frozen in liquid nitrogen, and ground with tungsten balls in a Mixer Mill MM300 (Qiagen). Total RNA from whole seeds at different stages of development or dissected tissues, as well as from spikes and mature leaves, was extracted with the RNeasy plant minikit (Qiagen). RNA aliquots were treated with RNase-free DNase and cDNA synthesis was performed in a DNA thermocycler (GeneAmp PCR System 9600, Applied Biosystems).
Total RNA samples (0.2 µg) from 1230 DAA seeds were reverse-transcribed with Superscript II Reverse Transcriptase (Applied Biosystems) using an anchored 3' primer (5'-GACTAGTTCTAGATCGCGAGCGCCT) generating cDNA collections from wheat seeds at different developmental stages. Samples of these cDNA collections were subsequently amplified with proof reading Pfu polymerase (Promega) by PCR using a 5' nested primer (5'-GACTAGTTCTAGATCGCGAG) and 5' consensus primers designed from plant thioredoxin h sequences from accessible databases. Fragments were PCR-screened on the basis of the corresponding WCGPC motif. Positive fragments were subcloned in pGEMt vector and introduced in E. coli JM109. Sequencing of both DNA strands was performed according to standard methods on an ABI PRISM DNA sequencer (Applied BioSystems).
Expression of wheat thioredoxins h in E. coli
Thioredoxin h cDNAs were amplified with gene-specific oligonucleotides, which included an NdeI site (underlined) in the forward primer and an XhoI site (underlined) in the reverse one. The sequence of gene-specific primers is as follows: Trxh1 (5'-ATCATATGGCGGCGTCGGC; 5'-ATCTCGAGTTACGGGCCGCGTGTAG); Trxh2 (5'-ATACATATGGCCGCCGAGGAGG; 5'-ATCTCGAGTTAGGCAGATGCAGAACC), Trxh3 (5'-ATCATATGGCGGCGGCGGCGACG; 5'-ATCTCGAGCTAGGCAGCCGCGTGGAGC). The purified cDNA fragments were digested with NdeI and XhoI and subcloned into the expression vector pET16b (Novagen), producing plasmids pET-Trxh1, pET-Trxh2, and pET-Trxh3, respectively. After checking the correct sequences, these plasmids were introduced into E. coli BL21(DE3)pLysS (Promega) as described in Hanahan (1983). Expression of the recombinant proteins was induced by addition of 1 mM IPTG for 4 h. The recombinant proteins were purified by Ni-NTA affinity chromatography (Qiagen) according to the manufacturer's instructions.
Site-directed mutagenesis of wheat TRXh1
Site-directed mutagenesis was performed by PCR using as template pET-Trxh1 cDNA. The C43S mutant was produced with oligonucleotides F4 (5'-TTCCTGGTGCGGTCCTTCTCGTGTCATAGC) and R4 (5'-GCTATGACACGAGAAGGACCGCACCAGGAA), which included a single change (underlined) to replace Cys43 by Ser. The C11S mutant was produced with oligonucleotides F1 (5'-AGCCGTGATAGCGTCCCACACCAAGCAAGA) and R1 (5'- TCTTGCTTGGTGTGGGACGCTATCACGGCT), which included a single change (underlined) to replace Cys11 by Ser, using wild-type Trxh1 cDNA. To produce the double mutant C43SC11S, the same pair of oligonucleotides (F1-R1) was used with mutant C43S construct as template. In all cases, PCR (1 cycle at 94 °C, 1 min; 16 cycles at 94 °C, 30 s, 55 °C, 1 min, 68 °C, 14 min) was performed with Pfu polymerase (Promega). The PCR product was then digested with DpnI for 1 h at 37 °C to eliminate the methylated template DNA. This DNA was then used to transform E. coli XL1-Blue. Resulting cDNAs were sequenced to check for the correct introduction of mutations and that no additional mutations occurred during the process.
Protein analysis and activity assay
Protein concentration was determined with the Bradford method using a protein assay kit (Bio-Rad). His-tagged thioredoxin activity was determined using the insulin-disulphide reduction assay (Holmgren, 1979) and a coupled reaction with purified NTR from wheat was performed as described in Serrato et al. (2002).
Gene expression analysis
Total RNA (0.2 µg per sample), extracted as described above, was used to perform random hexamer-primed reverse transcription with the reagents contained in a TaqMan Gold RT-PCR kit (Applied Biosystems) following the manufacturer's instructions. Aliquots (1 µl) from each reverse transcription reaction were subjected to real-time quantitative PCR in an ABI PRISM 7700 Sequence Detection System (Applied Biosystems). Amplifications were performed using the Quantitec SYBR GREEN reagent (Qiagen) in a final volume of 25 µl. The PCR conditions included 1 cycle at 50 °C for 2 min, 1 cycle at 95 °C for 15 min, and 40 cycles at 94 °C for 15 s, 63 °C for 30 s, and 72 °C for 30 s. Agarose gel electrophoresis confirmed the homogeneity of the DNA products. Gene-specific primers were designed with the Primer express software (Applied Biosystems), and are as follows: Trxh1 (5'-ACATGGCTAATGGCAAGGAGA; 5'-CGTTGTATGCTTCAGCGACGT); Trxh2 (5'-GCTATCAAGGAGGAACTGACGAA; 5'-AAAACACACTAGCTTGGATTAAGCAA); Trxh3 (5'-TGTCGGAGCTATCAAGGAGGAG; 5'-CTTGATTCACCATCATCCATAAACTC), 18S rRNA (5'-AGTAAGCGCGAGTCATCAGCT; 5'-CATTCAATCGGTAGGAGCGAC). Relative quantification for a given transcript was calculated with the
method (Livak and Schmittgen, 2001). The relative amount of each seed Trxh transcript was normalized to the amount of 18S RNA transcript (internal control) in the same cDNA and the amount of Trxh2 in mature leaves (calibrator).
| Results and discussion |
|---|
|
|
|---|
Isolation and characterization of cDNAs encoding TRXh from wheat
After screening a collection of cDNAs generated with RNA from wheat seeds at different stages of development, three full-length cDNAs were identified putatively encoding TRXh, here stated Trxh1 (Accession number AY072771), Trxh2 (Accession number AF286593), and Trxh3 (Accession number AF420472). The deduced amino acid sequence of TRXh2 and TRXh3 showed a high identity (94.3%); both polypeptides are almost identical except at the N-terminus (Fig. 1A), which was larger in TRXh3 and contains a Pro residue (Fig. 1A, dot) not found in any other wheat TRXh. As shown in Fig. 1A, these thioredoxins also showed high similarity with previously reported thioredoxins h from wheat (Gautier et al., 1998); indeed, TRXh2 corresponds to a previously reported wheat cDNA stated TrxhB (Serrato et al., 2001). By contrast, TRXh1 is less similar to TRXh2 (54.6%) and TRXh3 (55.6%). TRXh1 belongs to a subclass of low molecular weight plant thioredoxins h, containing a third Cys residue (Cys11, Fig. 1A, asterisk) besides the two Cys at the active site.
|
The presence of the additional Cys residue was reported in type-h thioredoxins from poplar (Gelhaye et al., 2003) and barley (Maeda et al., 2003) and is found in thioredoxin h sequences from either dicots (Accession numbers AAO42956, P29448, Q39362) and monocots (Accession number Q42443). As the rice phloem sap TRXh (Ishiwatari et al., 1995), TRXh1 lacks the Trp residue at the N-terminus (Fig. 1A, triangle), considered a thioredoxin h signature (Stein et al., 1995), which is replaced by Phe, it is still an aromatic amino acid. The structural model of TRXh1 (Fig. 1B) predicts a location for the additional Cys residue on a rather flexible part of the molecule and opens the possibility to additional interactions with Cys residues of target proteins. Phe17 is in the same position as its homologue Trp in the template (Fig. 1B), therefore no significant effect of this substitution on thioredoxin structure or activity is expected. In addition, the TRXh1 polypeptide presents an Arg residue at position 102 whereas TRXh2 and TRXh3 present Ile at this position (Fig. 1A, inverted triangle). Plant thioredoxins h have been clustered into three groups depending on the presence of the Arg, Ile/Met, or Asn residue at this position (Juttner et al., 2000; Maeda et al., 2003). Based on this classification, it is deduced that TRXh1 is grouped with the barley HvTRXh1 (Maeda et al., 2003) and the rice phloem sap thioredoxin (Ishiwatari et al., 1995). These thioredoxins are also characterized by the third Cys and Phe residues at the N-terminus as mentioned above. The identification of thioredoxins with the features of TRXh1 in monocots and dicots suggests that these genes evolved from an ancestral gene existing before the monocot/dicot diversion (Juttner et al., 2000).
Expression of TRXh1, TRXh2, and TRXh3 polypeptides in E. coli and characterization of TRXh1 mutants
The coding sequences of the three Trxh genes were subcloned in pET16b vector to produce the recombinant proteins in E. coli with a His-tag at the N-terminus. Recombinant TRXh2, TRXh1, and TRXh3 proteins were found in the soluble fraction from the corresponding transformed E. coli cultures after induction with IPTG (Fig. 2A, lanes 1, 4, 7, respectively) and were purified by affinity chromatography on nickel column (Fig. 2A, lanes 3, 6, 9, respectively). SDSPAGE analysis under non-reducing conditions showed that TRXh2 and TRXh1 appeared partially as dimers (Fig. 2B, lanes 1, 3). Despite the high sequence similarity with TRXh2, TRXh3 appeared exclusively in monomeric form (Fig. 2B, lane 2). Under reducing conditions all three TRXh were detected as monomers (Fig. 2B), thus showing that dimerization was produced by disulphide formation.
|
To analyse the effect of the third Cys residue of TRXh1 on activity and dimerization, different mutants were produced. To that end Cys43 and Cys11 were replaced with serine (C43S and C11S mutants), and the double mutant C43S-C11S was also produced. Under non-reducing conditions (DTT) TRXh1 C43S mutant showed a lower level of dimerization than the wild type TRXh1 (Fig. 2C, compare lanes 1 and 2). However, mutant C11S was exclusively detected as monomer (Fig. 2C, lane 3), thus showing the involvement of the third Cys residue in dimer formation of TRXh1. Interestingly, the double mutant C43S-C11S appeared exclusively in dimeric form (Fig. 2C, lane 4), hence suggesting that the only Cys residue present in this mutant protein shows higher reactivity for disulphide formation.
The three recombinant thioredoxins TRXh1, TRXh2, and TRXh3 showed activity as determined with the DTT-dependent insulin reduction assay (Fig. 3A). Under these assay conditions TRXh1 showed slightly higher specific activity, whereas the rate of insulin reduction by TRXh2 and TRXh3 was indistinguishable. An important question concerning the activity of the different TRXh isoforms is its interaction with NTR, which catalyses the transfer of reducing power to TRXh in vivo. This question was addressed using the recombinant NTR from wheat (Serrato et al., 2002). TRXh1 showed a higher activity under these more physiological assay conditions (Fig. 3B). So, both activity assays showed that TRXh1 is the most efficient type-h thioredoxin in wheat. The effect of replacing the third Cys residue of TRXh1 on activity was then analysed using the more physiological NTR-based assay. As expected, mutation of active site Cys43, either alone (C43S mutant) or in combination with Cys11 (C43S-C11S mutant), completely abolished activity (Fig. 3C); by contrast, the Cys11 mutation, which completely abolished dimerization of TRXh1 (Fig. 2C), showed only partial effect on activity (Fig. 3C). So, the additional Cys residue of TRXh1 seems to be more relevant for dimerization than for activity, suggesting an important role for this residue in the ability of TRXh1 to interact with potential targets, in comparison with the other group of TRXhs containing exclusively the active site Cys residues.
|
Type-h thioredoxins are differentially expressed in wheat seeds
The different characteristics of the three wheat Trxh genes suggested that each of these thioredoxins, or at least TRXh1, might have a different function, which might be reflected in a different pattern of expression. Because all three TRXhs were similarly detected by the anti-TRXh antibody (results not shown), this possibility was addressed by analysing the accumulation of transcripts of the three Trxh genes during seed development and germination using real-time RT-PCR with gene-specific primers. Trxh1, Trxh2, and Trxh3 transcripts were detected at a rather low level during the early stages of seed development (Fig. 4A). At later stages, when the water content of the seed was below 40%, an increase of the three Trxh transcripts was observed, although Trxh1 accumulated at a lower level than Trxh2 and Trxh3. The pattern of expression of the Trxh genes was also analysed in spikes (Fig. 4B). Although the level of expression in this tissue was lower than in developing seeds, a slight increase was detected after 24 DAA (Fig. 4B) when the water loss in the corresponding seeds was below 50%, which corresponds to the phase of chlorophyll breakdown in spikes and their progressive desiccation (Carceller and Aussenac, 2001). In contrast to the seed, Trxh1 was the most abundant thioredoxin h transcript in spikes.
|
During seed development, the period between 10 and 20 DAA is characterized by a high activity of disulphide bond formation in gluten proteins (Gupta et al., 1996; Zhu and Khan, 1999; Aussenac and Carceller, 2000). Therefore, the expression of the Trxh genes, lower at these stages, seems not to be related to endosperm filling. By contrast, the accumulation of Trxh transcripts occurred towards the beginning of the maturation phase, when the transcriptional activity in the seed is lower, that is, Trxh transcripts accumulation is associated with desiccation in seeds and spikes. In a way, accumulation of Trxh transcripts follows the profile of genes for late embryogenesis abundant (LEA) proteins, which are expressed during the late stages of seed development, as well as in stress conditions (Delseny et al., 1994). Since it is generally admitted that LEA proteins play a role in the establishment of desiccation tolerance (Close, 1996), the question arises whether any of the wheat seed Trxh has a related function.
Differential expression of Trxh genes in response to abiotic stress
To test the differential expression of wheat Trxh genes in seed and vegetative tissues, wheat seeds were imbibed for 48 h and the content of the Trxh transcripts was analysed in dissected shoots, roots, scutellum, and the aleurone layer. Very early after imbibition (24 h), Trxh1 transcripts showed a marked and transient accumulation and then declined to the level of the Trxh2 and Trxh3 transcripts (Fig. 5).
|
In young seedlings, Trxh1 transcripts accumulated to a higher level in shoots, roots, and scutellum than in aleurone cells, which showed similar amounts of the three Trxh transcripts (Fig. 6A). Since Trxh transcript accumulation in developing seeds was raised during desiccation, the effect of abiotic stresses on Trxh expression in vegetative tissues was tested. When seeds were allowed to germinate under salt stress, the general profile of expression was not significantly affected except in the aleurone layer, which showed a clear increase of Trxh2, Trxh1 and, to a lower extent, of Trxh3 transcripts (Fig. 6B). The oxidative stress treatment also promoted an increase of Trxh2 and Trxh3 transcripts, but not of Trxh1 in aleurone cells (Fig. 6C), showing no significant effect on the other tissues analysed. These results clearly show the difference in the expression profile of the thioredoxin h genes in aleurone compared with other tissues, which show the predominant expression of the Trxh1 gene. Environmental stresses have a poor effect on Trxh genes expression, except in the aleurone layer.
|
The different behaviour of the aleurone layer must be underlined because of the important role of these cells in seed germination. The starchy endosperm is a starch and protein storage tissue, whereas the aleurone cells store a large amount of lipids, mainly triglycerides, in oleosomes. This lipid reserve is used as the source of energy for the metabolic activation of aleurone cells upon imbibition, which allows the production of hydrolytic enzymes required for the breakdown of reserve molecules of the starchy endosperm. Lipid catabolism generates fatty acid hydroperoxides and H2O2, which can easily cause damage to cell membranes and induce subsequent cell death (Bethke et al., 2001; Domínguez et al., 2004). Therefore, the early induction of Trxh2 and Trxh3 expression triggered by H2O2 in aleurone cells could contribute to protection against oxidative damage, which is essential for the completion of germination.
The pattern of expression of Trxh genes in aleurone might also be related to the fact that oxidative stress is involved in the regulation of the expression of specific genes, including Trx in mammals (Hayashi et al., 1993), although the mechanism is not understood in plant tissues. Variation in the intracellular redox state, as it is mediated by a sublethal level of reactive oxygen species, can transiently modify the activity of several transcription factors and therefore of gene expression. In this regard it is worth mentioning that TRXh accumulates in the nucleus of seed cells suffering oxidative stress (Serrato et al., 2001; Serrato and Cejudo, 2003). The identification of nuclear targets of TRXh will be required to understand its role in gene expression.
| Acknowledgements |
|---|
This work was supported by grants BIO200402023 from Ministerio de Educación y Ciencia (Spain) and CVI-182 from Junta de Andalucía (Spain).
| Abbreviations |
|---|
DAA, days after anthesis; HAI, hours after imbibition; IPTG, isopropyl ß-D-thiogalactoside; NTR, NADPH thioredoxin reductase; Trxh, thioredoxin h.
| References |
|---|
|
|
|---|
Aussenac T and Carceller J-L. (2000) SDS-unextractable glutenin polymer formation in wheat kernels. In Shewry PR and Tatham AS (Eds.). Wheat gluten (Royal Society of Chemistry, Cambridge) pp. 475479.
Besse I, Wong JH, Kobrehel K, Buchanan BB. (1996) Thiocalsin: a thioredoxin-linked, substrate-specific protease dependent on calcium. Proceedings of the National Academy of Sciences, USA 93:31693175.
Bethke PC, Fath A, Jones RL. (2001) Regulation of viability and cell death by hormones in cereal aleurone. Journal of Plant Physiology 158:429438.[CrossRef][Web of Science]
Buchanan BB and Balmer Y. (2005) Redox regulation. A broadening horizon. Annual Reviews in Plant Biology 56:187220.
Carceller J-L and Aussenac T. (2001) SDS-insoluble glutenin polymer formation in developing grains of hexaploid wheat: the role of the ratio of high to low molecular weight glutenin subunits and drying rate during ripening. Functional Plant Biology 28:193201.[CrossRef]
Close TJ. (1996) Dehydrins: emergence of a biochemical role of a family of plant dehydration proteins. Physiologia Plantarum 97:795803.[CrossRef]
Delseny M, Gaubier P, Hull G, Saez Vasquez J, Gallois P, Raynal M, Cooke R, Grellet F. (1994) Nuclear genes expressed during seed desiccation: relationship with response to stress. In Basra AS (Ed.). Stress-induced gene expression in plants (Harwood Academic Publishing, Reading) pp. 2559.
Domínguez F, Moreno J, Cejudo FJ. (2004) A gibberellin-induced nuclease is localized in the nucleus of wheat aleurone cells undergoing programmed cell death. Journal of Biological Chemistry 279:1153011536.
Fomenko DE and Gladyshev VN. (2003) Identity and functions of CxxC-derived motifs. Biochemistry 42:1121411225.[CrossRef][Medline]
Gan ZR. (1991) Yeast thioredoxin genes. Journal of Biological Chemistry 266:16921696.
Gautier MF, Lullien-Pellerin V, Lamotte-Guery F, Guirao A, Jourdrier P. (1998) Characterisation of wheat thioredoxin h cDNA and production of an active Triticum aestivum protein in E. coli. European Journal of Biochemistry 252:314324.[Web of Science][Medline]
Gelhaye E, Rouhier N, Vlamis-Gardikas A, Girardet J-M, Sautière P-E, Sayzet M, Martin F, Jacquot J-P. (2003) Identification and characterization of a third thioredoxin h in poplar. Plant Physiology and Biochemistry 41:629635.[CrossRef]
Gupta RB, Masci S, Lafiandra D, Bariana HS, McRichtie F. (1996) Accumulation of protein subunits and their polymers in developing grains of hexaploid wheats. Journal of Experimental Botany 47:13771385.
Hanahan D. (1983) Studies on transformation of E. coli with plasmids. Journal of Molecular Biology 166:557580.[Web of Science][Medline]
Hayashi T, Ueno Y, Okamoto T. (1993) Oxidoreductive regulation of nuclear factor kappa B. Journal of Biological Chemistry 268:1138011388.
Hirota K, Matsui M, Iwata S, Nishiyama A, Mori K, Yodoi J. (1997) AP-1 transcriptional activity is regulated by a direct association between thioredoxin and Ref-1. Proceedings of the National Academy of Sciences, USA 94:36333638.
Holmgren A. (1979) Reduction of disulfides by thioredoxin. Exceptional reactivity of insulin and suggested functions of thioredoxin in mechanism of hormone action. Journal of Biological Chemistry 254:96279632.
Ishiwatari Y, Honda C, Kawashima I, Nakamura S, Hirano H, Mori S, Fijowara T, Hayashi H, Chino M. (1995) Thioredoxin h is one of the major proteins in rice phloem sap. Planta 195:456463.[Web of Science][Medline]
Jiao J, Yee BC, Kobrehel K, Buchanan BB. (1992) Effects of thioredoxin-linked reduction on the activity and stability of the Kunitz and BowmanBirk soybean trypsin inhibitor proteins. Journal of Agricultural and Food Chemistry 40:23332336.[CrossRef]
Juttner J, Olde D, Langridge P, Baumann U. (2000) Cloning and expression of a distinct subclass of plant thioredoxins. European Journal of Biochemistry 267:71097117.[Web of Science][Medline]
Kobrehel K, Wong J, Balogh A, Kiss F, Yee BC, Buchanan BB. (1992) Specific reduction of wheat storage proteins by thioredoxinh. Plant Physiology 99:919924.
Laloi C, Rayapuram N, Chartier Y, Grienenberger J-M, Bonnard G, Meyer Y. (2001) Identification and characterization of a mitochondrial thioredoxin system in plants. Proceedings of the National Academy of Sciences, USA 98:1414414149.
Laurent TC, Moore EC, Reichard P. (1964) Enzymatic synthesis of deoxyribonucleotides. IV. Isolation and characterization of thioredoxin donor from Escherichia coli. Journal of Biological Chemistry 239:34363444.
Livak KJ and Schmittgen TD. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the
method. Methods 25:402408.[CrossRef][Web of Science][Medline]
Lozano RM, Wong J, Yee BC, Peters A, Kobrehel K, Buchanan BB. (1996) New evidence for a role for thiredoxin h in germination and seedling development. Planta 200:100106.[Web of Science]
Maeda K, Finnie C, Ostergaard O, Svensson B. (2003) Identification, cloning and characterization of two thioredoxin h isoforms, HvTrxh1 and HvTrxh2, from barley seed proteome. European Journal of Biochemistry 270:26332643.[Web of Science][Medline]
Martin JL. (1995) Thioredoxin: a fold for all reasons. Structure 3:245250.[Medline]
Marx C, Wong JH, Buchanan BB. (2003) Thioredoxin and germinating barley: targets and protein redox changes. Planta 216:454460.[Web of Science][Medline]
Mouaheb N, Thomas D, Verdoucq L, Monfort P, Meyer Y. (1998) In vivo functional discrimination between plant thioredoxins by heterologous expression in the yeast Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences, USA 95:33123317.
Reicheld JP, Mestres-Ortega D, Laloi C, Meyer Y. (2002) The multigenic family of thioredoxin h in Arabidopsis thaliana: specific expression and stress response. Plant Physiology Biochemistry 40:685690.[CrossRef][Web of Science]
Santandrea G, Guo Y, O'Connell T, Thompson RD. (2002) Post-phloem protein trafficking in the maize caryopsis: ZmTRXh1, a thioredoxin specifically expressed in the pedicel parenchyma of Zea mays L, is found predominatly in the placentochalaza. Plant Molecular Biology 50:743756.[CrossRef][Web of Science][Medline]
Schürmann P and Jacquot J-P. (2000) Plant thioredoxin systems revisited. Annual Review of Plant Physiology and Plant Molecular Biology 51:371400.[CrossRef][Web of Science]
Serrato AJ and Cejudo FJ. (2003) Type-h thioredoxins accumulate in the nucleus of developing wheat seed tissues suffering oxidative stress. Planta 217:392399.[CrossRef][Web of Science][Medline]
Serrato AJ, Crespo JL, Florencio FJ, Cejudo FJ. (2001) Characterization of two thioredoxin h with predominant localization in the nucleus of aleurone and scutellum cells of germinating wheat seeds. Plant Molecular Biology 46:361371.[CrossRef][Web of Science][Medline]
Serrato AJ, Pérez-Ruiz JM, Cejudo FJ. (2002) Cloning of thioredoxin h reductase and characterization of the thioredoxin reductasethioredoxin h system from wheat. Biochemical Journal 367:491497.[CrossRef][Web of Science][Medline]
Spyrou G, Enmark E, Miranda-Vizuete A, Gustafsson J. (1997) Cloning and expression of a novel mammalian thioredoxin. Journal of Biological Chemistry 272:29362941.
Stein M, Jacquot JP, Jeannette E, Decottignies P, Hodges M, Lancelin JM, Mittard V, Schmitter JM, Miginiac-Maslow M. (1995) Thioredoxin: structure of the genes coding for the chloroplastic m and cytosolic h isoforms: expression in Escherichia coli of the recombinant proteins, purification and biochemical properties. Plant Molecular Biology 28:487503.[CrossRef][Web of Science][Medline]
Wong JH, Cai N, Tanaka CK, Vensel WH, Hurkman WJ, Buchanan BB. (2004) Thioredoxin reduction alters the solubility of proteins of wheat starchy endosperm: an early event in cereal germination. Plant and Cell Physiology 45:407415.
Wong JH, Jiao J-A, Kobrehel K, Buchanan BB. (1995) Thioredoxin-dependent deinhibition of pullulanase of barley malt by inactivation of a specific inhibitor protein. Plant Physiology 108:67.
Yano H, Wong JH, Cho MJ, Buchanan BB. (2001b) A strategy for the identification of proteins targeted by thioredoxin. Proceedings of the National Academy of Sciences, USA 98:47944799.
Yano H, Wong JH, Lee YM, Cho MJ, Buchanan BB. (2001a) Redox changes accompanying the degradation of seed storage proteins in germinating rice. Plant Cell Physiology 42:879883.
Zhu J and Khan K. (1999) Characterization of monomeric and glutenin polymeric proteins of hard red spring wheat during grain development by multistacking SDS-PAGE and capillary zone electrophoresis. Cereal Chemistry 76:261269.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. Shahpiri, B. Svensson, and C. Finnie The NADPH-Dependent Thioredoxin Reductase/Thioredoxin System in Germinating Barley Seeds: Gene Expression, Protein Profiles, and Interactions between Isoforms of Thioredoxin h and Thioredoxin Reductase Plant Physiology, February 1, 2008; 146(2): 789 - 799. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Traverso, F. Vignols, R. Cazalis, A. Pulido, M. Sahrawy, F. J. Cejudo, Y. Meyer, and A. Chueca PsTRXh1 and PsTRXh2 Are Both Pea h-Type Thioredoxins with Antagonistic Behavior in Redox Imbalances Plant Physiology, January 1, 2007; 143(1): 300 - 311. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






