JXB Advance Access originally published online on September 27, 2006
Journal of Experimental Botany 2006 57(13):3419-3431; doi:10.1093/jxb/erl144
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Flower Development |
Protein interactions of MADS box transcription factors involved in flowering in Lolium perenne
1Plant Research International, Business unit Bioscience, Bornsesteeg 65, 6708 PD, Wageningen, The Netherlands
2Risoe National Laboratory, Biosystems Department 330, PO Box 49, 4000 Roskilde, Denmark
3DLF-TRIFOLIUM A/S 31, Hoejerupvej, PO Box 19, DK-4660 Store Heddinge, Denmark
* To whom correspondence should be addressed. E-mail: Richard.Immink{at}wur.nl
Received 11 May 2006; Accepted 8 August 2006
| Abstract |
|---|
|
|
|---|
Regulation of flowering time is best understood in the dicot model species Arabidopsis thaliana. Molecular analyses revealed that genes belonging to the MADS box transcription factor family play pivotal regulatory roles in both the vernalization- and photoperiod-regulated flowering pathways. Here the analysis of three APETALA1 (AP1)-like MADS box proteins (LpMADS13) and a SHORT VEGETATIVE PHASE (SVP)-like MADS box protein (LpMADS10) from the monocot perennial grass species Lolium perenne is reported. Features of these MADS box proteins were studied by yeast two-hybrid assays. Proteinprotein interactions among the Lolium proteins and with members of the Arabidopsis MADS box family have been studied. The expression pattern for LpMADS1 and the protein properties suggest that not the Arabidopsis AP1 gene, but the SUPPRESSOR OF CONSTANS1 (SOC1) gene, is the functional equivalent of LpMADS1. To obtain insight into the molecular mechanism underlying the regulation of LpMADS1 gene expression in vernalization-sensitive and -insensitive Lolium accessions, the upstream sequences of this gene from a winter and spring growth habit variety were compared with respect to MADS box protein binding. In both promoter elements, a putative MADS box transcription factor-binding site (CArG-box) is present; however, the putative spring promoter has a short deletion adjacent to this DNA motif. Experiments using yeast one-hybrid and gel retardation assays demonstrated that the promoter element is bound by an LpMADS1LpMADS10 higher order protein complex and, furthermore, that this complex binds efficiently to the promoter element from the winter variety only. This strongly supports the model that LpMADS1 together with LpMADS10 controls the vernalization-dependent regulation of the LpMADS1 gene, which is part of the vernalization-induced flowering process in Lolium.
Key words: Lolium, MADS box transcription factor, proteinprotein interaction, vernalization
| Introduction |
|---|
|
|
|---|
Timing of the transition from vegetative to reproductive development is determined by various environmental and endogenous factors. The synchronization of flowering time is a complex process that is best studied and understood in the model system Arabidopsis thaliana. In this species, flowering is determined by four major promoting pathways: long-day photoperiod, gibberellin, the autonomous pathway, and vernalization (reviewed in Jack, 2004). Although, these pathways can act independently, the balance of their signals is integrated by a common set of genes that determine the appropriate time of flowering (Putterill et al., 2004).
The vernalization requirement of Arabidopsis is mainly controlled by two loci: FRIGIDA (FRI) and FLOWERING LOCUS C (FLC). The natural allelic variation at the FRI and FLC loci, among different accessions of Arabidopsis, account for most of the difference in flowering time between early (summer) and late (winter) flowering ecotypes (Napp-Zinn, 1985; Burn et al., 1993; Clarke and Dean, 1994; Koornneef et al., 1994; Johanson et al., 2000; Michaels et al., 2003). In summer-annual ecotypes, flowering is rapidly induced in the absence of vernalization (Michaels et al., 2003). In contrast, in winter-annual accessions, vernalization is required for flowering and prevents the plant for a premature response, before the start of the spring. Dominant alleles at the FLC locus interact synergistically with dominant alleles of FRI to confer an extremely late flowering response (Simpson et al., 1999). FLC encodes a MADS box transcription regulator, and high levels of its expression correlate with the inhibition of flowering. The inhibitory role of FLC on the floral transition appeared to be caused by the repression of so-called floral pathway integrator genes, such as SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS LIKE20 (SOC1/AGL20). SOC1 encodes a MADS box transcription factor as well, and its expression is detected during vegetative growth and particularly in the shoot apical meristem (Borner et al., 2000; Lee et al., 2000; Samach et al., 2000). SOC1 expression is positively regulated by photoperiod and gibberellin, and by vernalization (Ledger et al., 2001; Moon et al., 2003; Sheldon et al., 2006). Detailed expression analyses during plant growth of flowering time mutants indicated that SOC1 mediates the promotion of flowering (Rouse et al., 2002; Moon et al., 2003, 2005; Yoo et al., 2005; Searle et al., 2006). The two closely related MADS box genes AGAMOUS-LIKE24 (AGL24) and SHORT VEGETATIVE PHASE (SVP) act reciprocally in the regulation of flowering time. AGL24 promotes the positive effect of SOC1 in flower transition (Yu et al., 2002, 2004), while SVP acts in a dosage-dependent manner as a repressor of flowering (Hartmann et al., 2000).
Molecular studies of the interactions among the flowering pathway integrators confirmed that SOC1 functions upstream of LEAFY (LFY) and APETALA1 (AP1), which are two genes regulating floral meristem formation (Moon et al., 2005). AP1 fulfils a dual function and is a floral meristem identity gene and, in addition, is functional as a floral homeotic gene, to specify floral organ identity of the outer two whorls (A-function). Remarkably, a similar function for an AP1-like gene in floral organ development has never been shown in other species (Theissen et al., 2000). Ferrandiz and colleagues (2000) showed that AP1 is redundant in floral meristem determination with the closely related paralogues FRUITFULL (FUL) and CALIFLOWER (CAL). Furthermore, the characterization of ful single, ful ap1 double, and ful ap1 cal triple mutants revealed the role of the FUL gene in floral meristem formation, but showed that this gene also has a role in carpel and fruit development (Gu et al., 1998).
Until recently, it was unclear whether a comparable model for flowering time regulation by integration of several inductive pathways exists in monocots (Andersen et al., 2004). Cereal species can be characterized as winter or spring accessions depending on their competence and ability to flower after exposure to long periods of low temperature. The spring varieties flower earlier and do not require vernalization, whereas winter varieties depend on extensive cold periods to flower. In many cereal species, the epistatic interactions of two loci, VRN1 and VRN2, determine the setting of the flowering time transition. Molecular analyses in various cereals revealed that the VRN2 locus encodes a CONSTANS (CO)-like gene and the VRN1 locus encodes an AP1-like MADS box gene. Examples of the latter are TmAP1, also named WAP1, BM5, and LpMADS1 from wheat, barley, and Lolium, respectively (Petersen et al., 2004). The expression of these three genes is strongly induced by vernalization in winter varieties (Danyluk, 2003; Murai et al., 2003; Trevaskis et al., 2003; Ciannamea et al., 2006; Petersen et al., 2006). Furthermore, overexpression of AP1-like genes from grass species, and ectopic expression of some of these genes in model species, such as Arabidopsis and tobacco, resulted in early flowering phenotypes (Kang et al., 1997; Jeon et al., 2000; Gocal et al., 2001; Fornara et al., 2004). This all pointed to an important role for the cereal AP1-like genes in floral induction. Remarkably, no FLC-like MADS box gene has been isolated from cereals so far.
All the above-discussed MADS box proteins involved in the flowering process, in both dicots and monocots, belong to the type II class of plant MADS box proteins. This class of proteins contains a conserved modular structure consisting of four different functional domains: from the N- to the C-terminus, the MADS-box (M), the intervening region (I-region), the coiled-coil keratin-like (K-box), and the C-terminal region (Riechmann and Meyerowitz, 1997). Biochemical and molecular studies have proven that specific dimerization and higher order complex formation are important for the functioning of these proteins and the interaction patterns appeared to be conserved for MADS box proteins from various plant species (Egea-Cortines et al., 1999; Immink and Angenent, 2002; Favaro et al., 2003). Furthermore, it has been shown that the CArG box is the consensus binding site for MADS domain transcription factors. This DNA motif consists of 10 bases with the consensus sequence CC(A/T)6GG (Treisman, 1986; Hayes et al., 1988). Several reports revealed that the expression of members of the MADS box family is controlled by the MADS box proteins themselves, establishing an autoregulatory loop mechanism (Schwarz-Sommer et al., 1992; Gomez-Mena et al., 2005; Zhu and Perry, 2005).
In this study, the characterization of three Lolium AP1-like genes, LpMADS1, LpMADS2, and LpMADS3, and one Lolium SVP-like gene, LpMADS10, is presented. Previous studies have shown that the expression of LpMADS1, LpMADS2, and LpMADS3 is induced during vernalization in both leaves and the shoot apex (Petersen et al., 2004), whereas, in contrast, the expression of LpMADS10 is strongly down-regulated by vernalization in the shoot apex (Petersen et al., 2006). Here the further characterization and comparison of the LpMADS1, LpMADS2, and LpMADS3 genes with close relatives from Arabidopsis is reported together with the conservation of the protein interaction patterns of the encoded proteins. Furthermore, part of the putative promoter of the LpMADS1 gene was studied by yeast one-hybrid analyses and by in vitro binding assays. These analyses revealed a specific binding of the LpMADS1LpMADS10 heterodimer to the CArG box present in the vernalization-responsive LpMADS1 promoter.
| Materials and methods |
|---|
|
|
|---|
Sequence analysis
Amino acid sequence alignments were performed using the ClustalW program (Thompson et al., 2004). A NeighborJoining tree was calculated with MEGA3.1, with the model Poisson correction (184 sites, 10 000 bootstrap replicates).
Yeast two-hybrid analyses
The LpMADS1, LpMADS2, LpMADS3, and LpMADS10 open reading frames were generated by polymerase chain reaction (PCR) and subsequently cloned into pENTRTM/D-TOPO (Invitrogen). In the next step, each obtained pENTRTM Directional TOPO vector was recombined with the GATEWAY destination vectors pDESTTM32 (pBDGAL4, bait) and pDESTTM22 (pADGAL4, prey) from Invitrogen. Due to technical problems, it was not possible to obtain the pBDGAL4-LpMADS10 construct. All the generated bait vectors were transformed into yeast strain PJ69-4
(MAT
; James et al., 1996) and all prey vectors into strain PJ69-4
(James et al., 1996), and the transformants were selected on SD plates lacking Leu and Trp, respectively. Subsequently, the obtained bait plasmids containing the full-length sequences of LpMADS1, LpMADS2, and LpMADS3, respectively, were tested for autoactivation of the yeast reporter genes. Addition of 5 mM 3-amino-1,2,4-triazole (3-AT) appeared to be sufficient to abolish the basal HIS3 expression caused by the transcriptional activity of the C-terminal domains of these three proteins. All Lolium proteins were screened for heterodimerization capacity and in a heterologous yeast two-hybrid screening against the pBDGAL4-Arabidopsis MADS collection (de Folter et al., 2005). The mating-based screening and selection for positives has been performed as described by de Folter et al. (2005).
Yeast one-hybrid experiments
The MATCHMAKER One-Hybrid System (catalogue no. K1603-1) was used to study proteinDNA interactions. For this purpose, the putative promoter fragments of LpMADS1 from Lolium perenne (clone F6, DLF-TRIFOLIUM) and from Lolium multiflorum (variety, Westerwoldicum, WW) were amplified by Pfu polymerase and subsequently cloned into the pGEM-T Easy vector (Promega). For the F6 fragment, the primers PRO596 (GAGCTCAATCATGCGCACGAGACGACGC) and PRO597 (TCTAGAAAGGGTTCCGTTCCGGCAAGGG) were used, giving a fragment of 516 bp, and for the WW fragment primers PRO598 (GAGCTCATGCGCACGAGACGACGTAGTC) and PRO599 (TCTAGAATCTGGGGCAGATCGCGG), yielding a fragment of 568 bp. After enzymatic digestion by SacI and XbaI, the F6 and WW promoter fragments were gel purified and cloned into the SacI- and XbaI- linearized pHISi vector (Clontech), resulting in the plasmids pHISi-F6 and pHISi-WW, respectively. Initially, pHISi-F6 and pHISi-WW were integrated into the yeast genome of strain PJ69-4a (James et al., 1996) and, subsequently, the obtained yeast clones were selected on a concentration range of 3-AT, to identify clones with a low level of background (<20 mM 3-AT) expression for the HIS3 reporter gene. For the screening of a promoter fragment against a heterodimer and the heterologous yeast one-hybrid screening, the conventional yeast one-hybrid system was slightly modified, to enable expression of two putative DNA-binding proteins. All identified Arabidopsis MADS box transcription factor dimers (De Folter et al., 2005) and the LpMADS1LpMADS10 heterodimer were reconstituted in yeast strain PJ69-4a. For this purpose, the yeast expression vector pTFT1 (Egea-Cortines et al., 1999) was made Gateway compatible by cloning the Gateway RfB cassette (Invitrogen) into the blunted EcoRI restriction site, giving plasmid pARC352. Subsequently, the complete Arabidopsis MADS box transcription factor collection was recombined into the pARC352 destination vector. In the next step, the various pTFT1-MADS constructs were transformed to yeast clones that already contain a specific pADGAL4-Arabidopsis MADS construct (de Folter et al., 2005). The LpMADS1LpMADS10 heterodimer was reconstituted in yeast as pADGAL4-LpMADS1 and pTFT1-LpMADS10.
Electromobility shift assay (EMSA)
As templates for the probes, the plasmids pHISi-F6 and pHISi-WW, described above, were used. The DNA probes for the shifts were produced by PCR with biotinylated primers PRO716 (FW_pHISi vector, GTAATACGACTCACTATAGG) and PRO717 (RV_pHISi vector, ATCGATTCGCGAACGCGT) using Pfu polymerase, and gel purified using the QIAEXII-kit. Either 30 or 40 fmol of probes were used per lane (see figure legends for details). The full LpMADS1 and LpMADS10 coding sequences as well as C-terminally deleted versions were amplified using modified primers introducing NcoI and BamHI sites, and then cloned into the pSPUTK vector. LpMADS1-MIK1 encodes a protein of 158 amino acid residues, and LpMADS1-MIK2 encodes a protein of 174 amino acid residues. The resulting constructs were checked for PCR errors by sequencing. In vitro translation and EMSA assays were performed as described in Kaufmann et al. (2005).
| Results |
|---|
|
|
|---|
Lolium MADS box genes potentially involved in flowering
Previous studies in L. perenne have identified three AP1-like genes named LpMADS1, LpMADS2, and LpMADS3, and one gene that belongs to the SVP/AGL24 clade, named LpMADS10 (Petersen et al., 2004, 2006). Based on their expression patterns and similarities with close relatives from Arabidopsis, these genes may potentially be involved in controlling the transition from vegetative to generative growth. To obtain a better insight into the sequence similarities between the proteins encoded by these Lolium genes and to compare these proteins with the MADS box regulators of flowering in Arabidopsis, a phylogenetic tree has been generated (Fig. 1A). Subsequently, an alignment (Fig. 1B) has been made for the predicted amino acid sequences of LpMADS1, LpMADS2, and LpMADS3, and the Arabidopsis proteins AP1 and FUL, which are the most closely related based on the phylogenetic tree. The same has been done for LpMADS10 and the Arabidopsis proteins SVP and AGL24 (Fig. 1C). The comparison between LpMADS1 and LpMADS2 revealed a high degree of identity (71%, similarity 79%), while, in contrast, LpMADS3 and LpMADS1 share only 48% (similarity 64%) of their amino acid sequences. The Arabidopsis AP1 and FUL proteins have 51% (similarity 68%) and 49% (similarity 68%) of their sequence in common with LpMADS1, respectively, and both Arabidopsis proteins share 45% (similarity 62% and 59%, respectively) of their sequence with LpMADS3. The C-terminal domain of the LpMADS1, LpMADS2, and LpMADS3 proteins showed a less conserved amino acid sequence, though a conserved FUL-like motif (L/MPPWML) can be identified at the very C-terminal region of all three Lolium proteins. Although, there is clear overlap in the protein sequences, based on this comparison it cannot be concluded which of these LpMADS genes is the candidate gene that has a function similar to AP1 from Arabidopsis.
|
LpMADS10 shares 50% (similarity 70%) amino acid sequence with SVP and only 41% (similarity 65%) with AGL24. Furthermore, LpMADS10 appeared to be 76% identical (similarity 90%) to the putative floral repressor TaVRT-2, recently isolated from Triticum aestivum (Kane et al., 2005). Based on this sequence comparison and the expression analyses performed by Kane and colleagues (2005) and Petersen et al. (2006), LpMADS10 might be the most similar in function to TaVRT-2 and SVP, from wheat and Arabidopsis, respectively.
Proteinprotein interactions of the Lolium MADS box proteins
Because comparison of amino acid sequences between Arabidopsis and Lolium AP1-like and SVP/AGL24-like proteins does not provide sufficient clues to predict the functions of the Lolium genes, the properties of the encoded proteins were investigated. The high similarity between LpMADS1 and LpMADS2 protein sequences suggests that they may have similar functions and, hence, overlapping interaction patterns, as has been shown for other redundant proteins such as SEPALLATA1 (SEP1) and SEP3 (de Folter et al., 2005). To obtain insight into the dimerization specificity of the four Lolium proteins, a binary yeast two-hybrid screen has been performed (Table 1). Both LpMADS1 and LpMADS2 were able to form homodimers and heterodimers with each other; while, in contrast, LpMADS3 behaves differently in these interactions. Remarkably, all three AP1-like Lolium proteins were able to heterodimerize with the LpMADS10 protein.
|
To investigate the interaction capacity of the four Lolium proteins in more detail, a heterologous yeast two-hybrid screening was performed by screening against the entire collection of Arabidopsis MADS box proteins fused to the GAL4-binding domain (BD) (de Folter et al., 2005). This heterologous interaction screen may provide information about the conservation of protein features between Lolium and Arabidopsis. Not all combinations could be tested, because some of the Arabidopsis proteins have been shown to give rise to autoactivation in this yeast system (de Folter et al., 2005). The results of the screening for LpMADS1 and LpMADS2 are shown in Table 2. As expected, both proteins have an identical interaction pattern. Notably, many protein interactions were observed between these two Lolium proteins and Arabidopsis MADS box proteins involved in flowering time, such as SVP, AGL24, and SOC1, but also with proteins playing a role in floral organ formation, such as FUL, AGAMOUS (AG), and SEP2. LpMADS10 has a number of interactions in common, but also revealed distinct interactors (Table 2). Remarkably, LpMADS3 failed to interact with any protein of the Arabidopsis MADS box collection. Resequencing the AD-LpMADS3 construct did not reveal mutations, and the same construct was used in the screen for interactions with the other Lolium proteins (Table 1), which exclude a trivial reason for the lack of interactors.
|
To allow a good comparison between the heterologous interaction patterns of the Lolium MADS box proteins and the interaction patterns of the Arabidopsis MADS box proteins involved in flowering, Venn diagrams were created (Fig. 2). Comparison of the LpMADS1 sequence with the sequences of Arabidopsis MADS box genes revealed that AP1 and FUL are the closest relatives, suggesting that they may play a similar developmental role (Fig. 1A, B). However, AP1 expression is not detectable in vegetative organs, but starts to be expressed in the floral meristem at an early stage of floral development and specifies the identity of sepals and petals (Mandel et al., 1992; Mandel and Yanofsky, 1995). In contrast to the function of AP1, there are indications suggesting that LpMADS1 is an early regulator of the flowering process in Lolium (Petersen et al., 2004, 2006). Therefore, it was taken into consideration whether LpMADS1 and SOC1, despite their low sequence identity (38%), may share the same interacting proteins, since both proteins function as flowering regulators in Lolium and Arabidopsis, respectively. Remarkably, almost all proteins with which SOC1 interacts appear to form dimers with LpMADS1 as well (Fig. 2A). The interaction map of AP1 completely overlaps with the interaction map of LpMADS1, and the same is the case for FUL. However, AP1 and FUL lack many interactions observed for LpMADS1 and SOC1, indicating that they are clearly distinct with respect to interaction selectivity.
|
In Fig. 2B the Venn diagram is given for LpMADS10 and the Arabidopsis proteins SVP and AGL24. LpMADS10 has a broader set of interactors than the two Arabidopsis proteins, but all MADS proteins forming dimers with SVP and AGL24 also interact with LpMADS10.
Characterization of the putative LpMADS1 promoter sequence
To obtain more insight into the role of LpMADS1 in the flowering process and how the expression of this gene is regulated, the upstream sequences of a spring and winter growth habit variety were analysed. Recently, Petersen and colleagues (2006) isolated and analysed the putative LpMADS1 promoter from the winter variety L. perenne F6, and from two spring growth habit varieties, L. temulentum and L. multiflorum Westerwoldicum (WW). The F6-1 winter variety is vernalization dependent for flowering and its LpMADS1 gene is up-regulated towards the end of the vernalization process. In contrast, the two spring varieties flower independently from vernalization and have expression of LpMADS1 throughout the vegetative phase. Here, the LpMADS1 F6 (winter) and WW (spring) promoter sequences were compared. In Fig. 3, an alignment is given for these two promoter sequences. Remarkably, among the InDel (internal deletions) and SNPs (single nucleotide polymorphisms) found, a deletion of 9 bp was identified in the spring variety WW, directly adjacent to a conserved putative MADS box transcription factor-binding site, the CArG box [CC(AT)6AG]. Previously, similar work in wheat showed a deletion adjacent to a putative CArG box in the promoter sequences of many spring accessions (Yan et al., 2003, 2004). The presence of a putative MADS box transcription factor-binding site (CArG box) suggests either that LpMADS1 is regulated by another MADS box transcription factor or, alternatively, that it is able to regulate its own expression via an autoregulatory feedback loop. Both negative and positive autoregulatory feedback mechanisms have been hypothesized for plant MADS box transcription factors (Schwarz-Sommer et al., 1992; Trobner et al., 1992; Goto and Meyerowitz, 1994; de Folter et al., 2005; Gomez-Mena et al., 2005).
|
Yeast one-hybrid experiments with LpMADS1 winter and spring promoter fragments
For MADS box transcription factors it is known that they bind DNA either as homodimers or as heterodimers in vitro (Riechmann et al., 1996; West et al., 1998). Based on the observations that the LpMADS1 promoter contains a putative CArG box and that LpMADS1 forms a heterodimer with LpMADS10, it has been hypothesized that the LpMADS1LpMADS10 heterodimer could act as a negative autoregulator complex for the LpMADS1 promoter (Petersen et al., 2006). Furthermore, Petersen and colleagues suggested that the deletion in close proximity to the CArG box in the putative LpMADS1 promoter of the spring accessions may affect the binding by the MADS box protein(s). To test these hypotheses, LpMADS1 winter and spring promoter elements were tested in the yeast one-hybrid system against various Lolium MADS box heterodimers. The results of this screening are presented in Table 3 and revealed that the LpMADS1LpMADS10 heterodimer was able to bind strongly to the F6 winter promoter fragment, while it barely interacted with the WW spring promoter fragment. Similarly, although weaker than the LpMADS1LpMADS10 heterodimer, binding to the LpMADS1 F6 promoter fragment was scored for the LpMADS2LpMADS10 and LpMADS3LpMADS10 heterodimers.
|
EMSAs
In vitro EMSAs were performed to confirm the differences in binding of MADS domain proteins to the two varieties of the LpMADS1 promoter. The probes were derived from DNA fragments surrounding and including the putative CArG box (Fig. 3), cloned into the pHISi vector. Binding of LpMADS1 and LpMADS10 homodimers to the winter (F6) and spring (WW) type CArG boxes was identified; however, binding was stronger to the winter type (Fig. 4A). A similar difference in binding efficiency between the F6 and WW promoter elements was observed with the LpMADS1 and LpMADS10 heterodimer (Fig. 4A). Surprisingly, with this combination of proteins, a supershift was obtained, which suggests that a higher order complex is formed by these two proteins. To gain a better understanding of the composition of the LpMADS1- and LpMADS10-containing complex, deletion constructs have been generated for LpMADS1. Subsequently, these C-terminally deleted versions of LpMADS1 were used together with the full-length LpMADS10 protein, in order to distinguish homo- from heterodimers based on height differences of the retarded bands in the native gel. The results demonstrate that LpMADS10 is able to form DNA-binding heterodimers with both C-terminally deleted versions of LpMADS1. This is indicated by the intermediate bands in the gel shifts (Fig. 4B). No supershifted band was observed in the shifts with C-terminally deleted versions of LpMADS1 together with LpMADS10, underlining the importance of the C-terminus in higher order complex formation of MADS domain proteins.
|
Heterologous targeted yeast one-hybrid screening
To determine whether other MADS box transcription factors are able to bind to one of the two LpMADS1 promoter elements, a yeast one-hybrid screening against a collection of MADS box proteins and MADS box protein dimers was performed. Unfortunately, such a collection is currently not available for Lolium. However, as mentioned before, comparison of proteinprotein interaction maps from MADS box proteins derived from different species, such as Antirrhinum, Petunia, and Arabidopsis, revealed a high degree of conservation (Immink and Angenent, 2002). Therefore, it was decided to screen the Lolium LpMADS1 winter and spring promoter fragments against the collection of Arabidopsis MADS box transcription factors and their identified dimers (De Folter et al., 2005; see Materials and methods). The various yeast clones expressing a single Arabidopsis MADS box protein or a dimer were mated with either the winter or summer promoter element in front of the HIS3 reporter gene and spotted onto selective plates containing 30 mM 3-AT to select for putative binding factors. The results of this experiment were validated by an independent replicate experiment and revealed that a number of single MADS box proteins from Arabidopsis bind to the F6 winter type promoter element, but fail to bind to the WW spring type promoter fragment (Table 4). Possibly, the presence of the deletion flanking the CArG box in the putative spring promoter (WW) affects the DNA binding affinity. In line with this, only the putative winter promoter (F6) revealed interactions with a selective subset of the Arabidopsis MADS box dimers (Table 4). Remarkably, six of these dimers consist of at least one protein that is involved in the flower transition process, such as the dimers AGL24AGL6, AGL97MAF1, and SEP3SVP.
|
| Discussion |
|---|
|
|
|---|
Characterization of the VRN1 loci from cereal species revealed that these loci contain genes of the AP1 clade of the MADS box family. Examples are WAP1/TaVRT-1 (T. aestivum; Danyluk et al., 2003; Murai et al., 2003), TmAP1 (Triticum monococcum; Yan et al., 2003), and BM5 (barley; Trevaskis et al., 2003). Three genes have been isolated from L. perenne that belong to this AP1/AGL9 clade, named LpMADS1, LpMADS2, and LpMADS3 (Petersen et al., 2004), from which LpMADS1 co-localizes with the VRN1 locus (Jensen et al., 2005). The expression of the LpMADS1 gene is strongly up-regulated upon prolonged periods of cold (Petersen et al., 2004; Ciannamea et al., 2006), and is further enhanced by long-day photoperiods (Petersen et al., 2004). The expression of LpMADS2 and LpMADS3 is also induced by vernalization and enhanced by long-day conditions, however, to a lesser extent. These expression patterns and the strong homology with other cereal VRN1 genes suggest a role for LpMADS1, LpMADS2, and LpMADS3 in the vernalization-mediated induction of flowering.
A comparison of LpMADS1 with the Arabidopsis MADS box proteins revealed a high similarity with FUL and, based on this, FUL might be the functional homologue of LpMADS1. However, the activity of the FUL gene is required for carpel and fruit development (Gu et al., 1998) and, furthermore, FUL has an early and redundant function in the specification of floral meristem identity, together with AP1 and CAL (Gu et al., 1998; Ferrandiz et al., 2000). Therefore, despite the fact that LpMADS1 and FUL are close in amino acid sequence, they seem to fulfil different functions. Functionally, LpMADS1 acts more like SOC1 from Arabidopsis, which is a dosage-dependent mediator of flowering and, like LpMADS1, this gene is strongly and positively regulated by the vernalization and autonomous pathways, and weakly by the photoperiod pathway (Moon et al., 2005; Sheldon et al., 2006). Completely in line with this hypothesis, the heterologous yeast two-hybrid screen performed in this study revealed that LpMADS1 forms dimers with the same partners as SOC1. Furthermore, the expression pattern of LpMADS1 is very similar to that of SOC1 (Moon et al., 2005), which also supports the idea that these genes are functionally related. The question remains of how two closely related MADS box genes from Lolium and Arabidopsis have evolved different functions. Recently, Causier and colleagues (2005) showed that two orthologous genes from Arabidopsis and Antirrhinum, SHATTERPROOF (SHP) and PLENA (PLE), respectively, have clearly different functions. Surprisingly, the paralogue of SHP, which is AG in Arabidopsis, is the functional homologue of PLE, while they have not been derived from the same ancestral gene. This example shows that duplicated genes may evolve independently by neo-functionalization and diverge in function from the orthologous genes that originated by speciation. In the case of AP1 and SOC1, their ancestral MADS box gene may have duplicated into an AP1 and SOC1 lineage before the separation of monocot and dicot species, and even before the origin of angiosperms. This is reminiscent of the situation for AG-SHP, one of the ancient paralogues, i.e. AP1 has diverged, while SOC1 retained its original function, which is conserved in monocots. Although evidence was not provided that the Lolium AP1-like gene LpMADS1 is the functional equivalent of the Arabidopsis SOC1 gene, the results suggest that these MADS box genes play a similar role in the floral transition process.
Do LpMADS1, LpMADS2, and LpMADS3 have redundant functions?
LpMADS1, LpMADS2, and LpMADS3 have been placed in the AP1/AGL9 clade of MADS box genes based on phylogenetic analysis and, furthermore, the expression of all three genes is induced by prolonged periods of cold (Petersen et al., 2004). This suggests that these three genes may play redundant roles in vernalization-induced flowering. Previous phylogenetic studies placed LpMADS1 in a subgroup together with the supposed orthologous genes LtMADS1, BM5, OsMADS14, and ZMM4, while LpMADS2 grouped together with LtMADS2, BM8, OsMADS15, and ZAP1, from L. temulentum, barley, rice, and maize, respectively (Gocal et al., 2001; Petersen et al., 2004). Remarkably, there are strong similarities in gene expression patterns between members of the first group (LpMADS1, BM5, and LtMADS1), whose transcripts are induced in leaves from vernalized plants. In contrast, the members of the second group (LpMADS2, BM8, and LtMADS2) are not or only to a small extent expressed in leaves. Nevertheless, in the shoot apical meristem (SAM), the expression of both LpMADS1 and LpMADS2 is induced by vernalization (Petersen et al., 2004). It has been shown here that LpMADS1 and LpMADS2 have an identical heterologous interaction pattern and interact specifically with many of the Arabidopsis MADS box proteins involved in the flowering process. Taken together, these findings strongly suggests that LpMADS1 and LpMADS2 are, at least partially, functionally redundant and are both involved in vernalization-induced flowering. LpMADS3 is also upregulated in the SAM by vernalization, but it is clearly distinct from LpMADS1 and LpMADS2 and is placed in a separate subgroup that contains only monocot genes (Peterson et al., 2004). Like LpMADS1, the LpMADS3 protein forms a heterodimer with LpMADS10, but it is not able to interact with any of the Arabidopsis MADS box proteins. Based on these results, it cannot be ruled out that LpMADS3 also has a function as a floral inducer; however, it has most probably diverged in function when compared with the related genes LpMADS1 and LpMADS2.
Regulation of LpMADS1 expression
Although there is strong evidence that LpMADS1 is involved in the induction of flowering upon a prolonged period of cold, it is still not clear how the up-regulation of its expression by vernalization is regulated at the molecular level. Based on the facts that the expression of LpMADS10 is down-regulated upon vernalization, that the upstream sequence of the LpMADS1 gene contains a CArG box, which is the consensus binding site for MADS box transcription factors, and that LpMADS1 and LpMADS10 are able to heterodimerize, it is tempting to speculate that this heterodimer is involved in the regulation of LpMADS1 expression. Recently, Petersen and colleagues (2006) hypothesized a possible scenario for the regulation of LpMADS1 expression. According to their model, LpMADS1 expression is repressed by a default status, characterized by non-inductive environmental conditions. Then, during vernalization, down-regulation of LpMADS10, the presumed SVP orthologue, permits the increase of LpMADS1 expression. Thus, the control of flowering is controlled by the delicate balance between LpMADS10 and LpMADS1 transcripts levels. A similar method of regulation has been suggested for the LpMADS1 homologue from wheat, TaVRT1 (Kane et al., 2005). The yeast one-hybrid and EMSA experiments performed in this study support this hypothesized control mechanism. Both the LpMADS1 and LpMADS10 homodimers are able to bind the putative LpMADS1 promoter and bind more efficiently to the LpMADS1 F6 (winter) promoter element than to the LpMADS1 WW (spring) promoter sequence. Besides binding by these homodimers, the LpMADS1LpMADS10 heterodimer appeared to bind strongly to the F6 (winter) promoter element only. Probably, the LpMADS10 homodimer is involved in the initial repression of LpMADS1 expression in winter accessions during the vegetative stage. Subsequently, LpMADS10 expression drops due to the prolonged exposure to low temperatures, which coincides with an up-regulation of LpMADS1 expression. This may result in the preferred formation of LpMADS1LpMADS10 heterodimers, which then further activate LpMADS1 expression. Finally, LpMADS10 expression is completely switched off, and LpMADS1 expression can be maintained via a positive autoregulatory loop by an LpMADS1-containing protein complex.
For all tested Lolium homodimers and heterodimers, a weaker binding, or even no binding, was obtained when the LpMADS1 WW (spring) promoter element was used. This lack of binding suggests that the small deletion present in the WW (spring) promoter fragment, just downstream of the CArG box, disturbs the proteinDNA binding. This is particularly interesting because the CArG box itself is identical in both promoter fragments and it provides for the first time evidence that DNA sequences flanking the CArG box are important for MADS box transcription factor binding.
Surprisingly, the LpMADS1LpMADS10 heterodimer seems to bind to the LpMADS1 F6 (winter) promoter element as a higher order complex. In line with the quartet model (Egea-Cortines et al., 1999; Theissen and Saedler, 2001), it is hypothesized that this is a complex consisting of two LpMADS1LpMADS10 heterodimers (Fig. 5). However, the quartet model predicts that the two dimers within the complex bind to two adjacent CArG boxes, upon bending of the DNA, but the LpMADS1 promoter fragments used in this study contains only one CArG sequence motif. However, a 2.1 kb LpMADS1 upstream sequence has been isolated recently (K Petersen and KK Nielsen, unpublished results), and this DNA sequence appeared to contain two additional putative CArG boxes, which can be used as binding sites by the higher order complex. In conclusion, the results presented here provide strong evidence that LpMADS1 plays an important role in the vernalization-induced flowering process, in a way similar to SOC1 in Arabidopsis. Furthermore, LpMADS1 expression could be regulated by the LpMADS1 protein itself via an autoregulatory mechanism, possibly in a higher order complex with other MADS box proteins. This study shows once more the importance of plant MADS box transcription factors, and their dynamic behaviour, in the regulation of the flowering process in both monocots and dicots.
|
| Acknowledgements |
|---|
We would like to thank Barry Causier and Brendan Davies for their help with the yeast one-hybrid system.
| Abbreviations |
|---|
3-AT, 3-amino-1,2,4-triazole; EMSA, electromobility shift assay; SAM, shoot apical meristem.
| References |
|---|
|
|
|---|
Andersen CH, Jensen CS, Petersen K. (2004) Similar genetic switch systems might integrate the floral inductive pathways in dicots and monocots. Trends in Plant Science 9:105107.[CrossRef][Web of Science][Medline]
Borner R, Kampmann G, Chandler J, Gleissner R, Wisman E, Apel K, Melzer S. (2000) A MADS domain gene involved in the transition to flowering in Arabidopsis. The Plant Journal 24:591599.[CrossRef][Web of Science][Medline]
Burn JE, Smyth DR, Peacock WJ, Dennis ES. (1993) Genes conferring late flowering in Arabidopsis thaliana.. Genetica 90:147155.[CrossRef]
Causier B, Castillo R, Zhou JL, Ingram R, Xue YB, Schwarz-Sommer Z, Davies B. (2005) Evolution in action: following function in duplicated floral homeotic genes. Current Biology 15:15081512.[CrossRef][Web of Science][Medline]
Ciannamea S, Busscher-Lange J, Folter SD, Angenent GC, Immink RGH. (2006) Characterization of the vernalization response in Lolium perenne by a cDNA microarray approach. Plant and Cell Physiology 47:481492.
Clarke JH and Dean C. (1994) Mapping FRI, a locus controlling flowering time and vernalization response in Arabidopsis thaliana.. Molecular Genetics and Genomics 242:81.
Danyluk J, Kane NA, Breton G, Limin AE, Fowler DB, Sarhan F. (2003) TaVRT-1, a putative transcription factor associated with vegetative to reproductive transition in cereals. Plant Physiology 132:18491860.
de Folter S, Immink RG, Kieffer M, et al. (2005) Comprehensive interaction map of the Arabidopsis MADS box transcription factors. The Plant Cell 17:14241433.
Egea-Cortines M, Saedler H, Sommer H. (1999) Ternary complex formation between the MADS-box proteins SQUAMOSA, DEFICIENS and GLOBOSA is involved in the control of floral architecture in Antirrhinum majus.. EMBO Journal 18:53705379.[CrossRef][Web of Science][Medline]
Favaro R, Pinyopich A, Battaglia R, Kooiker M, Borghi L, Ditta G, Yanofsky MF, Kater MM, Colombo L. (2003) MADS-box protein complexes control carpel and ovule development in Arabidopsis. The Plant Cell 15:26032611.
Ferrandiz C, Liljegren SJ, Yanofsky MF. (2000) Negative regulation of the SHATTERPROOF genes by FRUITFULL during Arabidopsis fruit development. Science 289:436438.
Fornara F, Pa
enicová L, Falasca G, Pelucchi N, Masiero S, Ciannamea S, Lopez-Dee Z, Altamura MM, Colombo L, Kater M. (2004) Functional characterization of OsMADS18, a member of the AP1/SQUA subfamily of MADS box genes. Plant Physiology 135:22072219.
Gocal GF, King RW, Blundell CA, Schwartz OM, Andersen CH, Weigel D. (2001) Evolution of floral meristem identity genes. Analysis of Lolium temulentum genes related to APETALA1 and LEAFY of Arabidopsis. Plant Physiology 125:17881801.
Gomez-Mena C, de Folter S, Costa MM, Angenent GC, Sablowski R. (2005) Transcriptional program controlled by the floral homeotic gene AGAMOUS during early organogenesis. Development 132:429438.
Goto K and Meyerowitz EM. (1994) Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes and Development 8:15481560.
Gu Q, Ferrandiz C, Yanofsky MF, Martienssen R. (1998) The FRUITFULL MADS-box gene mediates cell differentiation during Arabidopsis fruit development. Development 125:15091517.[Abstract]
Hartmann U, Hohmann S, Nettesheim K, Wisman E, Saedler H, Huijser P. (2000) Molecular cloning of SVP: a negative regulator of the floral transition in Arabidopsis. The Plant Journal 21:351360.[CrossRef][Web of Science][Medline]
Hayes TE, Sengupta P, Cochran BH. (1988) The human c-fos serum response factor and the yeast factors GRM/PRTF have related DNA-binding specificities. Genes and Development 2:17131722.
Immink RGH and Angenent GC. (2002) Transcription factors do it together: the hows and whys of studying proteinprotein interactions. Trends in Plant Science 7:531534.[CrossRef][Web of Science][Medline]
Jack T. (2004) Molecular and genetic mechanisms of floral control. The Plant Cell 16:Supplement, S1S17.
James P, Halladay J, Craig EA. (1996) Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144:14251436.[Abstract]
Jensen LB, Andersen JR, Frei U, Xing Y, Taylor C, Holm PB, Lubberstedt T. (2005) QTL mapping of vernalization response in perennial ryegrass (Lolium perenne L.) reveals co-location with an orthologue of wheat VRN1. Theoretical and Applied Genetics 110:527536.[CrossRef][Web of Science][Medline]
Jeon J-S, Lee S, Jung K-H, Yang W-S, Yi G-H, Oh B-G, An G. (2000) Production of transgenic rice plants showing reduced heading date and plant height by ectopic expression of rice MADS-box genes. Molecular Breeding 6:581592.[CrossRef]
Johanson U, West J, Lister C, Michaels S, Amasino R, Dean C. (2000) Molecular analysis of FRIGIDA, a major determinant of natural variation in Arabidopsis flowering time. Science 290:344347.
Kane NA, Danyluk J, Tardif G, Ouellet F, Laliberte J-F, Limin AE, Fowler DB, Sarhan F. (2005) TaVRT-2, a member of the StMADS-11 clade of flowering repressors, is regulated by vernalization and photoperiod in wheat. Plant Physiology 138:23542363.
Kang HG, Jang S, Chung JE, Cho YG, An G. (1997) Characterization of two rice MADS box genes that control flowering time. Molecular Cell 7:559566.
Burn JE, Smyth DR, Peacock WJ, Dennis ES. (1993) Genes conferring late flowering in Arabidopsis thaliana.. Genetica 90:147155.[CrossRef]
Kaufmann K, Anfang N, Saedler H, Theissen G. (2005) Mutant analysis, proteinprotein interactions and subcellular localization of the Arabidopsis B-sister (ABS) protein. Molecular Genetics and Genomics 274:103118.[CrossRef][Web of Science][Medline]
Koornneef M, Blankestijn-De-Vries H, Hanhart C, Soppe W, Peeters T. (1994) The phenotype of some late-flowering mutants is enhanced by a locus on chromosome 5 that is not effective in the Landsberg erecta wild-type. The Plant Journal 6:911919.[CrossRef]
Ledger S, Strayer C, Ashton F, Kay SA, Putterill J. (2001) Analysis of the function of two circadian-regulated CONSTANS-LIKE genes. The Plant Journal 26:1522.[CrossRef][Medline]
Lee H, Suh SS, Park E, Cho E, Ahn JH, Kim SG, Lee JS, Kwon YM, Lee I. (2000) The AGAMOUS-LIKE 20 MADS domain protein integrates floral inductive pathways in Arabidopsis. Genes and Development 14:23662376.
Mandel MA, Gustafson-Brown C, Savidge B, Yanofsky MF. (1992) Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 360:273277.[CrossRef][Medline]
Mandel MA and Yanofsky MF. (1995) A gene triggering flower formation in Arabidopsis. Nature 377:522524.[CrossRef][Medline]
Michaels SD, He Y, Scortecci KC, Amasino RM. (2003) Attenuation of FLOWERING LOCUS C activity as a mechanism for the evolution of summer-annual flowering behavior in Arabidopsis. Proceedings of the National Academy of Sciences, USA 100:1010210107.
Moon J, Lee H, Kim M, Lee I. (2005) Analysis of flowering pathway integrators in Arabidopsis. Plant and Cell Physiology 46:292299.
Moon J, Suh SS, Lee H, Choi KR, Hong CB, Paek NC, Kim SG, Lee I. (2003) The SOC1 MADS-box gene integrates vernalization and gibberellin signals for flowering in Arabidopsis. The Plant Journal 35:613623.[CrossRef][Web of Science][Medline]
Murai K, Miyamae M, Kato H, Takumi S, Ogihara Y. (2003) WAP1, a wheat APETALA1 homolog, plays a central role in the phase transition from vegetative to reproductive growth. Plant and Cell Physiology 44:12551265.
Napp-Zinn K. (1985) Arabidopsis thaliana. In Halevy AH (Ed.). CRC handbook of flowering(CRC Press, Inc., Boca Raton, FL) pp. 492503.
Petersen K, Didion T, Andersen CH, Nielsen KK. (2004) MADS-box genes from perennial ryegrass differentially expressed during transition from vegetative to reproductive growth. Journal of Plant Physiology 161:439.[CrossRef][Web of Science][Medline]
Petersen K, Kolmos E, Folling M, Salchert K, Storgaard M, Jensen CS, Didion T, Nielsen KK. (2006) Two MADS-box genes from perennial ryegrass are regulated by vernalization and involved in the floral transition. Physiologia Plantarum 126:268278.[CrossRef]
Putterill J, Laurie R, Macknight R. (2004) It's time to flower: the genetic control of flowering time. Bioessays 26:363373.[CrossRef][Web of Science][Medline]
Riechmann JL and Meyerowitz EM. (1997) MADS domain proteins in plant development. Biological Chemistry 378:10791101.[Web of Science][Medline]
Riechmann JL, Wang M, Meyerowitz EM. (1996) DNA-binding properties of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA and AGAMOUS. Nucleic Acids Research 24:31343141.
Rouse DT, Sheldon CC, Bagnall DJ, Peacock WJ, Dennis ES. (2002) FLC, a repressor of flowering, is regulated by genes in different inductive pathways. The Plant Journal 29:183191.[CrossRef][Web of Science][Medline]
Samach A, Onouchi H, Gold SE, Ditta GS, Schwarz-Sommer Z, Yanorfsky MF, Coupland G. (2000) Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science 288:16131616.
Searle I, He YH, Turck F, Vincent C, Fornara F, Krober S, Amasino RA, Coupland G. (2006) The transciption factor FLC confers a flowering response to vernalization by repressing meristem competence and systemic signalling in Arabidopsis. Genes and Development 20:898912.
Schwarz-Sommer Z, Hue I, Huijser P, Flor PJ, Hansen R, Tetens F, Lonnig WE, Saedler H, Sommer H. (1992) Characterization of the Antirrhinum floral homeotic MADS-box gene deficiens: evidence for DNA binding and autoregulation of its persistent expression throughout flower development. EMBO Journal 11:251263.[Web of Science][Medline]
Sheldon CC, Finnegan EJ, Dennis ES, Peacock WJ. (2006) Quantitative effects of vernalization on FLC and SOC1 expression. The Plant Journal 45:871883.[Web of Science][Medline]
Simpson GG, Gendall AR, Dean C. (1999) When to switch to flowering. Annual Review of Cell and Developmental Biology 15:519550.[CrossRef][Web of Science][Medline]
Theissen G, Becker A, Di Rosa A, Kanno A, Kim JT, Munster T, Winter KU, Saedler H. (2000) A short history of MADS-box genes in plants. Plant Molecular Biology 42:115149.[CrossRef][Web of Science][Medline]
Theissen G and Saedler H. (2001) Plant biology. Floral quartets. Nature 409:469471.[CrossRef][Medline]
Thompson JD, Higgins DG, Gibson TJ. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22:46734680.
Treisman R. (1986) Identification of a protein-binding site that mediates transcriptional response of the c-fos gene to serum factors. Cell 46:567.[CrossRef][Web of Science][Medline]
Trevaskis B, Bagnall DJ, Ellis MH, Peacock WJ, Dennis ES. (2003) MADS box genes control vernalization-induced flowering in cereals. Proceedings of the National Academy of Sciences, USA 100:1309913104.
Trobner W, Ramirez L, Motte P, Hue I, Huijser P, Lonnig WE, Saedler H, Sommer H, Schwarz-Sommer Z. (1992) GLOBOSA: a homeotic gene which interacts with DEFICIENS in the control of Antirrhinum floral organogenesis. EMBO Journal 11:46934704.[Web of Science][Medline]
West AG, Causier BE, Davies B, Sharrocks AD. (1998) DNA binding and dimerisation determinants of Antirrhinum majus MADS-box transcription factors. Nucleic Acids Research 26:52775287.
Yan L, Helguera M, Kato K, Fukuyama S, Sherman J, Dubcovsky J. (2004) Allelic variation at the VRN-1 promoter region in polyploid wheat. Theoretical and Applied Genetics 109:1677.[CrossRef][Web of Science][Medline]
Yan L, Loukoianov A, Tranquilli G, Helguera M, Fahima T, Dubcovsky J. (2003) Positional cloning of the wheat vernalization gene VRN1. Proceedings of the National Academy of Sciences, USA 100:62636268.
Yoo SK, Chung KS, Kim J, Lee JH, Hong SM, Yoo SJ, Yoo SY, Lee JS, Anh JH. (2005) CONSTANS activates SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 through FLOWERING LOCUS T to promote flowering in Arabidopsis. Plant Physiology 139:770778.
Yu H, Ito T, Wellmer F, Meyerowitz EM. (2004) Repression of AGAMOUS-LIKE 24 is a crucial step in promoting flower development. Nature Genetics 36:157161.[CrossRef][Web of Science][Medline]
Yu H, Xu Y, Tan EL, Kumar PP. (2002) AGAMOUS-LIKE 24, a dosage-dependent mediator of the flowering signals. Proceedings of the National Academy of Sciences, USA 99:1633616341.
Zhu C and Perry SE. (2005) Control of expression and autoregulation of AGL15, a member of the MADS-box family. The Plant Journal 41:583594.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
F. Fornara, V. Gregis, N. Pelucchi, L. Colombo, and M. Kater The rice StMADS11-like genes OsMADS22 and OsMADS47 cause floral reversions in Arabidopsis without complementing the svp and agl24 mutants J. Exp. Bot., May 2, 2008; (2008) ern083v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
Flowering Newsletter bibliography for 2006 J. Exp. Bot., April 20, 2007; (2007) erm028v2. [Full Text] [PDF] |
||||
![]() |
B. Trevaskis, M. Tadege, M. N. Hemming, W. J. Peacock, E. S. Dennis, and C. Sheldon Short Vegetative Phase-Like MADS-Box Genes Inhibit Floral Meristem Identity in Barley Plant Physiology, January 1, 2007; 143(1): 225 - 235. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






