JXB Advance Access originally published online on September 12, 2006
Journal of Experimental Botany 2006 57(14):3601-3618; doi:10.1093/jxb/erl111
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Published by Oxford University Press [2006] on behalf of the Society for Experimental Biology
RESEARCH PAPER |
Additional freeze hardiness in wheat acquired by exposure to 3 °C is associated with extensive physiological, morphological, and molecular changes
1Plant Genetics Research Unit, USDA/ARS, Donald Danforth Plant Science Center, 975 N. Warson Rd, St Louis, MO 63132, USA
2Climate Stress Laboratory, USDA/ARS, Beltsville, MD 20705, USA
3USDA/ARS, and North Carolina State University, Raleigh, NC 27695, USA
4Proteomics Facility, Donald Danforth Plant Science Center, 975 N. Warson Rd, St Louis, MO 63132, USA
* To whom correspondence should be addressed. E-mail: eherman{at}danforthcenter.org
Received 12 June 2006; Accepted 5 July 2006
| Abstract |
|---|
|
|
|---|
Cold-acclimated plants acquire an additional 35 °C increase in freezing tolerance when exposed to 3 °C for 1218 h before a freezing test (LT50) is applied. The 3 °C treatment replicates soil freezing that can occur in the days or weeks leading to overwintering by freezing-tolerant plants. This additional freezing tolerance is called subzero acclimation (SZA) to differentiate it from cold acclimation (CA) that is acquired at above-freezing temperatures. Using wheat as a model, results have been obtained indicating that SZA is accompanied by changes in physiology, cellular structure, the transcriptome, and the proteome. Using a variety of assays, including DNA arrays, reverse transcriptionpolymerase chain reaction (RTPCR), 2D gels with mass spectroscopic identification of proteins, and electron microscopy, changes were observed to occur as a consequence of SZA and the acquisition of added freezing tolerance. In contrast to CA, SZA induced the movement of intracellular water to the extracellular space. Many unknown and stress-related genes were upregulated by SZA including some with obvious roles in SZA. Many genes related to photosynthesis and plastids were downregulated. Changes resulting from SZA often appeared to be a loss of rather than an appearance of new proteins. From a cytological perspective, SZA resulted in alterations of organelle structure including the Golgi. The results indicate that the enhanced freezing tolerance of SZA is correlated with a wide diversity of changes, indicating that the additional freezing tolerance is the result of complex biological processes.
Key words: Aquaporin, cold acclimation, DNA array, electron microscopy, freeze hardiness, proteome, proteomics, transcriptome, wheat
| Introduction |
|---|
|
|
|---|
Physiologists and breeders have noted that freezing tolerance beyond that resulting from exposure to low above-freezing temperature is conferred by exposure of plants to temperatures slightly below freezing but before freezing injury occurs (Trunova, 1965; Olien, 1984; Castonguay, 1993, 1995; Livingston, 1996). The acquisition of additional freezing tolerance under these conditions has been called second phase hardening and is here called subzero acclimation (SZA). SZA can provide 35 °C of additional freeze tolerance that can provide a critical margin to survive winter. This margin corresponds to approximately one zone on the USDA plant hardiness map of the USA (Cathey and Jordan, 1990) that corresponds to 1200 km or more of difference in latitude. Similar maps are available for other regions of the world showing the same effect. Because freezing hardiness is one of the primary determinants of plant biogeography, SZA has both agricultural and ecological implications for plant distribution and crop/cultivar choices.
During cold acclimation (CA) at slightly above-freezing temperatures, a plant adapts physiologically and biochemically, which allows it to survive freezing temperatures. The subject of CA and freezing stress has been reviewed many times (Guy, 1990; Palta and Weiss, 1993; Hughes and Dunn, 1996; Thomashow, 1990, 1999). Recently, much of the emphasis in CA and stress has focused on the identification and function of cold-induced proteins and how the genes that encode these proteins are regulated (Cook et al., 2004; Kaplan et al., 2004). With the advent of genomics tools, large-scale assays have been applied to the examination of transcription patterns of CA in several plants. Large-scale transcriptome studies with DNA arrays have shown that CA induces up- as well as downregulation of a very large number of mRNAs (Ndong et al., 2001; Fowler and Thomashow, 2002; Ivashuta et al., 2002; Seki et al., 2002; Fabio et al., 2003; Rabbani et al., 2003). These assays have shown that diverse plants respond in similar ways by inducing many of the same types of mRNAs such as COR (cold-regulated) proteins and dehydrins. The regulation of many of the genes that are induced by CA is mediated by transcriptional regulators termed CBFs and DREBs (Liu et al., 1998). These factors regulate a large number of disparate genes using a common regulatory mechanism (Jaglo-Ottosen et al., 1998; Gilmour et al., 2000; Vogel et al., 2005). The expression of the transcription-regulating proteins at higher temperatures has been shown to confer freezing tolerance when those plants are tested in freeze assays (Kasuga et al., 1999).
CA leads to adjustment of protein composition that has been broadly examined as a differential proteomic analysis of NA (non-acclimated) and CA in Arabidopsis (Amme et al., 2006). Many of the proteins involved in CA can be summarized into two general groups: antifreeze (AFP) and cryoprotective proteins. The AFPs are involved in inhibition of intracellular ice growth and the regulation of ice crystal morphology, while cryoprotective proteins protect intracellular proteins and membranes during the freezing process (Griffith et al., 1992, 2005; Sieg et al., 1996; Smallwood et al., 1999; Tremblay et al., 2005). Sieg et al. (1996) purified a cryoprotective protein from CA cabbage leaves, and Hincha et al. (1997) suggested that these proteins act to protect thylakoid membranes from freezethaw damage. Winter rye accumulates six proteins with antifreeze activity, ranging in size from 16 to 35 kDa, in leaf apoplast during CA (Griffith et al., 1992; Marentes et al., 1993; Hon et al., 1994). These proteins are related to pathogenesis-related protein groups, namely, endochitinases, endo-ß-1, 3-glucanases, and thaumatin-like proteins (Hon et al., 1995). These antifreeze proteins form oligomeric complexes in their native form in various combinations, and it is suggested that these complexes might be more effective in inhibiting ice growth and re-crystallization than individual polypeptides (Yu and Griffith, 1999). The presence of these proteins allegedly explains differences in ice crystal growth in cold-adapted plants compared with controls (Gusta et al., 2004; Griffith et al., 2005). Apoplastic endochitinase and endo-ß-1,3-glucanase, which were induced by pathogens in freezing-sensitive tobacco, did not show antifreeze activity (Hon et al., 1995). However, Hincha et al. (1997) reported that ß-1,3-glucanase from tobacco, which was induced by CA, protected thylakoids against freezethaw injury in in vitro assays. However, under the same conditions, class I chitinase from tobacco had no effect. These results suggest that antifreeze activity of rye glucanase, chitinase, and thaumatin is not an inherent property of these proteins. It appears that these cold-induced proteins are either isoforms that have antifreeze activity or are post-translationally converted to have antifreeze activity (Thomashow, 1999). Other proteins, such as peach dehydrin (PCA 60) and thaumatin-like protein (AHCSP 33) from peanut, evidently have both antifreeze and cryoprotective activity (Wisniewski, 1997; Dave and Mitra, 1998). In addition, a novel antifreeze protein, with a leucine-rich repeat, has been purified and characterized from carrots (Worrall et al., 1998; Smallwood et al., 1999).
In contrast to the large body of literature on CA, there is relatively little cellular, biochemical, or molecular research on SZA. Fructan hydrolysis (first described by Trunova, 1965) and a concomitant increase in sugars, particularly in the apoplast, has been reported as a partial explanation for the increase in hardiness during SZA (Olien, 1984; Livingston and Henson, 1998). The increase in molarity of the apoplast solution during SZA due to sugar increases was not high enough to lower the freezing point of the apoplast by more than a fraction of a degree (Livingston and Henson, 1998). However, Canny (1995) demonstrated that the solute concentration in the apoplast is not uniform but that solutes tend to accumulate in discrete regions termed sumps. Livingston et al. (2005, 2006b) found regions of oat crowns recovering from freezing that appeared to be barriers to freeze damage that could be evidence of the sumps to which Canny (1995) refers. In addition to sugars being distributed unevenly in the apoplast and in separate regions of the crown, the layer of liquid water into which sugars have apparently been released would be very small due to the presence of apoplastic ice at 3 °C (Gusta and Fowler, 1977; Single and Marcellos, 1981; Pearce and Ashworth, 1992). This could lead to regions of considerably higher sugar concentrations in critical tissue within the crown than if the sugars were distributed evenly throughout the apoplast.
Yoshida et al. (1997) described a change in the physical state of water in crown tissue of SZA plants that resulted in an increase in water binding strength that is critical for freezing survival of plants. Castonguay et al. (1995) reported an increase of raffinose and stachyose in alfalfa during SZA that may have had a protective effect on plant tissues similar to that proposed for sucrose, glucose, and fructose. To our knowledge, apart from these studies, no information is currently available on the biochemical/biophysical adaptations that may explain the increase in hardiness during SZA. Virtually no information is available on the induction, regulation, and function of genes that may be involved in SZA.
In this study, multiple approaches have been used to investigate the biology of SZA using assays directed to show that physiological changes such as a lowered LT50 and changes in water distribution in the crown are correlated with changes in cellular structure, the transcriptome, the proteome, and water channel (aquaporin) expression. The results clearly show that SZA is a complex biological process that has features distinct from CA.
| Materials and methods |
|---|
|
|
|---|
Plant growth
Wheat (Triticum aestivum L. cv. Jackson) seeds were planted in Scotts Metromix 220 (Scotts-Sierra Horticultural Products Co., Marysville, OH, USA) in plastic tubes (2.5 cm diameterx16 cm high) with holes at the bottom for drainage. The tubes were suspended in a grid that held 100 tubes. Plants were treated twice weekly with a modified Hoagland's nutrient solution (Livingston, 1991) and flushed three times weekly with water. Plants were grown for 5 weeks at a day/night temperature regime of 13/10 °C with a 12 h photoperiod in a growth chamber with 240 mmol m2 s1 PAR (80% cool fluorescent and 20% incandescent bulb illumination). These were non-acclimated (NA) plants.
Cold acclimation (CA)
Five weeks after planting, plants were transferred to a chamber at 3 °C with a 12 h photoperiod at 310 mmol m2 s1 for 3 weeks. This 3 week period constituted CA.
To prepare plants for apoplastic extraction and freeze tests, NA and CA plants were removed from tubes and washed free of planting medium in ice water. Roots and leaves of plants were trimmed to allow easier handling; trimming has been shown to have no effect on freezing tolerance of cereal crops (Marshall, 1965; Olien, 1964) and is a routine step in freeze testing winter cereal crops (Mahfoozi et al., 2001).
Subzero acclimation (SZA)
CA plants were trimmed and frozen at 3 °C in the dark for 6 h, 1 d, and 3 d to induce SZA. Freeze test equipment did not perform adequately when longer periods at 3 °C were used. Also, longer periods at 3 °C reduced survival in preliminary tests.
Freeze tests
Trimmed, CA plants were placed into slits cut into the sides of doughnut-shaped, cellulose sponges with a pipe in the middle attached to a flange to promote thermal stabilization. Sponges containing plants were placed in plastic bags, sprinkled with shaved ice, and placed into a freezer at 3 °C for the SZA treatments. Three days later, NA and CA plants were trimmed identically to the SZA plants and added to the same freezer in which SZA plants had been placed. Sponges and plants took 6 h to freeze, after which the freezer temperature was lowered 1 °C h1 to the test temperature. Plants were frozen in separate freezers set to 2, 4, 6, 8, 11, 15, 18, and 20 °C. The actual temperature was monitored using thermocouples placed in selected sponges. The freezers were held at these temperatures for 3 h and then gradually warmed to 3 °C at a rate of 2 °C h1.
When sponges had completely thawed, plants were removed and trimmed of roots to prevent the proliferation of destructive microorganisms (Olien, 1984), and replanted into the same soil mix described above.
Recovering crowns were kept in NA growing conditions for 3 weeks, after which they were rated for survival. Six plants at each temperature were scored either dead or alive in three separate LT50 tests for each treatment (NA, CA, and SZA) and analysed using SAS probit analysis (SAS Institute Inc.). Planned comparisons between selected treatments were made using a t-test.
Apoplastic fluid extraction
For apoplastic fluid extraction, trimmed plants were reduced to crowns by further cutting roots to 1 cm and shoots to 3 cm. Fifteen NA and CA crowns were centrifuged before freezing. For SZA, crowns from 15 plants were placed in plastic bags, covered with a thin layer of shaved ice to avoid supercooling, and bags were sealed loosely to prevent desiccation. Bags containing crowns were frozen at 3 °C and after 3 d were removed and packed into a cut-off portion of a 50 ml syringe barrel with stems facing towards the Luer tip. A 1 ml high-performance liquid chromatography (HPLC) insert vial was placed at the tip of the syringe barrel to collect apoplastic fluid. The barrel, containing the trimmed crown tissue with the 1 ml vial, was placed in a 50 ml centrifuge tube and centrifuged at 500 g for 10 min at 3 °C. This centrifugation process maximized the recuperation of apoplastic fluid while minimizing contamination by cellular solution as indicated by malate dehydrogenase leakage assessment (Livingston and Henson, 1998). This procedure was replicated three times, each time with fresh plant material.
SZA crowns were allowed to thaw for 5 min and pressed gently between paper towels to remove excess water before loading into the syringe cut out. After centrifugation, crowns were placed in an oven at 70 °C for 24 h to determine the percentage of moisture. Percentages were calculated as the weight of liquid extracted (LE) by centrifugation divided by the total weight of water in the plant tissue (LE/fresh weightdry weight). Experiments were designed as a randomized complete block with three replicates, and analysis of variance as well as Fisher's protected least significant difference (LSD) were calculated using MSTAT (Michigan State University).
Electron microscopy
NA, CA, and SZA crowns were plunge-fixed in ice-cold 4% formaldehyde, 2% glutaraldehyde in 50 mM potassium phosphate buffer, pH 7.4. The fixed material from each condition was post-fixed in 1% (w/v) osmium tetroxide. The samples were dehydrated in a graded ethanol series and embedded in LR white resin. Thin sections were stained with uranyl acetate and lead citrate. Other sections were probed with anti-xyloglycan antibodies and indirectly labelled with anti-rabbit IgG10 nm colloidal gold as outlined in Yaklich et al. (1995). The material was visualized and photographed with a Phillips 300 electron microscope equipped with an axial 1x1 kbit CCD camera (Photometrics). Images were acquired with IP Lab (Scanlytics) and further processed using Adobe Photoshop.
RNA isolation and RTPCR analysis
Total RNA was isolated from all tissues using the Ambion RNAqueous kit. The amount and concentration of RNA were determined by OD260. For reverse transcriptionpolymerase chain reaction (RTPCR), first strand cDNA was synthesized using random primers and the Perkin Elmer Gene Amp RNA PCR kit. cDNA amplification was done using the Ambion SuperTaq Polymerase kit. Use of the Ambion Quantum RNA classic 18S kit provided internal control of the RNA concentration and PCRs. Ratios of Ambion 18S rRNA primer:competimer were determined empirically. A cycle number of 2830 rounds for both the specific cDNA and the 18S control was determined to be a linear amplification by removal of reactions after 26, 28, 30, 32, and 34 rounds of amplification. Reactions were run on 11.2% agarose gels and stained with ethidium bromide. Band intensity was measured using the Spot Density program from Alpha-Imager. The amplification of the 18S rRNA band was considered not to be affected by the various growing conditions, and therefore the ratio of band intensity between the specific cDNA band and the 18S band was used to control for possible small differences in RNA concentration and amplification between reactions. Specific primers were generated from the C-terminal end and the 3'-untranslated regions of both mRNAs; primers were checked against both the non-redundant and dBEST databases of GenBank to ensure specificity. Wheat PIP-specific primers did not amplify any other clones. PIP1: forward (947972 bp) CAA TCA GTC TGC CGA CCA TGG ACG G; reverse (11941171 bp) CTC CGT TAA ATC GCG TGC GCA GCG G. PIP2: forward (794820 bp) GCC GCC GTG GCC ACG GTT TAC CAC C; reverse (10591029 bp) GGC ACG AGG CCA TCT CTT GCA GTA ACT AGC.
RNA blot analysis:
Total RNA was isolated using an RNA isolation kit (Gentra Systems, Minneapolis, MN). A 5 µg aliquot of total RNA was denatured in NorthernMax-Gly load dye (Ambine, Austin, TX, USA) and RNA blot analyses were performed. The blots were probed with PCR-amplified PIP1 and PIP2 products. A 1 µg aliquot of wheat total RNA was used to generate first strand cDNA by using SuperScript II RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) with an oligo(dT)20 primer. A 3 µl aliquot of the first strand cDNA was used for the PCR amplification with Pfu DNA polymerase (Stratagene, La Jolla, CA, USA). All SZA samples were amplified using the following conditions: initial denaturation at 95 °C for 2 min, denaturation for 30 s at 95 °C, annealing for 30 s at 55 °C, extension for 1 min at 72 °C, and an additional 10 min extension at 72 °C, 30 cycles. The amplified fragments were isolated and purified from an agarose gel by using a QIAEX II Gel Extraction Kit (QIAGEN, Valencia, CA, USA) and used as probes. For each probe, cDNA was labelled with [
-32P]dCTP using a Random Primed DNA Labeling kit (Applied Biosystems, Foster City, CA, USA) and gel filtered (Edge Gel Filtration Cartridges; Edge BioSystems, Gaithersburg, MD, USA). The analyses were repeated twice to confirm the reproducibility of the results.
The PIP1 (AF366564) fragment was amplified using the primers: forward (PIP1f) 5'-CCGCCATCATCTACAACAAG-3'; and reverse (PIP1r) 5'-GCGCAGCGGTACAATACAGAAG-3', yielding: CCGCCATCATCTACAACAAGAAGCAGGCGTGGGACGACCACTGGATCTTCTGGGTTGGTCCGTTCATCGGTGCGGCGCTGGCGGCCATCTACCACGTGGTGGTGATCAGGGCCATCCCCTTCAAGAGCCGCGACTAGTCAGCCAATCAGTCTGCCGACCATGGACGGGTGGAATCTTATCGCTGTTCATCGTCGATCGATCATGTGGTGGTGGTTGCCCGTGCGTACGTGGCTCATTTCGCACGCTGTAATTCTCTATCTACCGTCCTCTGTCCCTCTCCTCGGTGTGTGTGCCTGCCGACAGCGTCACTGTGGCGCACCTGTTCAAGTCTGCGAGTTGTGTACTTTCCCTCCCTTCTGTATTGTACCGCTGCGC.
The PIP2 (AF366565) fragment was amplified using the primers: forward (PIP2f) 5'-TTCCGGTCCAACTACGA-3'; and reverse (PIP2r) 5'-AGGCCATCTCTTGCAGTAAC-3', yielding: TTCCGGTCCAACTACGACGCCTCCGTCTAGCTACTCCCATTCATCCATCCATTGATGCGTTCCATATCTACTTGTTGATGAGTTGAGATCCACATTATCGATGGATCTACCGTGTGGCTGTTAAAATTGATGGTTAATTAGTATGTTGTTGTGTTACTGAACGTATGTATTGCATTGTATGTTAGTGTTGGGTTTACAGTGTTTGCTAGTTACTGCAAGAGATGGCCT.
DNA arrays
Total RNA was isolated from 100 mg of wheat crown tissue collected from individual plants using the Qiagen RNeasy Plant Mini Kit. DNA was degraded using the Qiagen RNase-Free DNase Set, and an RNA clean up step was performed with the RNeasy MinElute Cleanup Kit.
Hybridization probes for the Affymetrix Barley Genome Array were prepared from this total RNA, as described in Affymetrix protocols. In brief, cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen) and T7(dT)24 Primer (Operon) and then was purified with the GeneChip Sample Cleanup Module (Affymetrix). The Enzo BioArray HighYield RNA Transcript Labeling Kit (Affymetrix) was used to generate biotin-labelled cRNA targets which were subsequently purified and fragmented with the Genechip Sample Cleanup module.
Targets were transported to the Siteman Cancer Center Gene Chip Facility, Washington University School of Medicine, St Louis, MO, USA where 15 µg of each target was hybridized to an Affymetrix Barley Genome Array which was washed, stained, and scanned on Affymetrix instruments following appropriate Affymetrix protocols. The hybridization cocktail contained control oligonucleotide B2 (Geneset) and control cRNA mix. The control oligonucleotide B2 (5'-biotin: GTCGTCAAGATGCTACCGTTCAGGA-3') is designed to hybridize to structural features on the chip to allow for proper scanning and grid alignment. The control cRNA mix is provided by the core facility and is composed of a second set of four, biotinylated, in vitro antisense transcripts of cDNAs encoding the Escherichia coli biotin synthesis genes bioB, bioC, bioD, and the P1 bacteriophage cre recombinase gene. Probes corresponding to these bacterial transcripts are also represented on all Affymetrix GeneChips (including test chips). Each synthetic transcript is quantitated and represented at a copy number of 2x1082x1010, corresponding roughly to the expected dynamic range of detection for the GeneChip. This set of control cRNAs allows for the monitoring of hybridization, washing, and staining conditions, and also provides a second set of reference samples for normalizing between experiments (taken directly from the Siteman website).
The chips were washed in the Affymetrix GeneChip Fluidics Station 400 using the mini-euk2 program, scanned on the Affymetrix GeneChip array scanner, then image data were captured and converted to numerical output using the Microarray Analysis Suite version 4.0 (taken directly from the Siteman website). These data were deposited in NCBI GEO, series accession number GSE2166.
Expression data were analysed with GeneSpring v7 (Silicon Genetics). Parameters were designated as a function of treatment type, and the value order was set at NACASZA. Replicates were grouped by treatment type, and the Cross Gene Error Model based on replicates was used for interpretation. Analysis was performed in Log of Ratio Mode. Data were filtered on flags so that only genes scored as present for both replicates of one treatment type were included in the analysis. Data flagged as marginal were considered to be absent.
Isolation of aquaporin clones and other cDNA probes
Library:
Wheat crowns were isolated from ice-covered wheat seedlings which had been exposed to 3 weeks of CA at 3 °C followed by 3 d of SZA at 3 °C and immediately frozen in liquid N2. A non-directional
ZAP II cDNA library was generated from the frozen tissue by Stratagene as a custom service.
Cloning of wheat PIP2:
The cloning was accomplished using a strategy of PCR followed by dilution of positive plaques. The library was plated to a density of
500 plaques per plate;
5000 plaques (10 plates) were screened. All plaques from each plate were bulk harvested and subjected to PCR. Pools that amplified a band similar to that of the control were diluted 1:10 and re-plated to additional plates. Plates were then sectored and all plaques from individual sectors were pooled and screened by PCR. After additional rounds of dilution/PCR, individual plaques were screened by PCR. Positive clones were screened with different primer pairs to confirm specific amplification. One clone, 6-4, was specifically amplified and this clone was sequenced, identified as an aquaporin based on sequence homology, and renamed wPip2. Isolation primers were based on consensus from barley, maize, rice, and sorghum sequences to amplify either most of the cDNA (GG-37 and GG-39) or an internal fragment of
376 bp (GG-40 and GG-41). Primers were: GG-37, 5'-ATGGAGGG(C/G)AAGGAGGAGGAC; G-39, 5-AGCTTAG(G/C)ACTTGGTCTTGAATG; GG-40, 5'-ACATCATCATGCAGTGCCTGG; GG-41, 5'-GACCCAGAAGATCCAGTGGTC.
PCR was performed under the following conditions: 95 °C 4 min; 35 cycles of 94 °C 45 s, 52 °C 45 s, 72 °C 90 s; 72 °C 10 min; 4 °C hold. The clone was assembled from a double-stranded overlapping sequence.
The cloning of a PIP1(2) aquaporin was a result of a random screen of phagemids derived from the library as part of an expressed sequence tag (EST) project with all clones sequenced using ABI dye-terminator reactions and the ABI device in both directions using T7 or T3 primers. One clone, Wcc302, proved to be a PIP-type aquaporin. All clones were sequenced in multiple directions to confirm the sequence. The final assembled sequences were derived from overlapping consensus sequence from both directions. The complete cDNA sequences for the aquaporins have been deposited in GenBank with accession nos AF366565 for PIP2 and AF366564 for PIP1.
SDSPAGE and immunoblots
A peptide antibody specific for PIP2 was produced by synthesis of a peptide corresponding to the PIP2 C-terminal (C-QYILRNSAYFRSNYDASV) amino acids with an added N-terminal cysteine residue for coupling to the carrier protein. The peptide was synthesized using an in-house ABI peptide synthesizer. The peptide was coupled to activated haemocyanin (Pierce) and used to elicit antibodies in replicate rabbits. The resulting antiserum was fractionated on a peptideagarose column produced by reacting the N-terminal cysteine with Pierce sulpholink gel according to the manufacturer's directions. Immunopurified monospecific antibodies were used for immunoblot assays. An antibody directed at the phosphorylated site of the PIP2 was produced by custom synthesis (Biosource International) using the sequence ARKV(pS)LVRAL. Monospecific immunopurified antibodies were used to assay PIP2 phosphorylation.
Total protein from NA, CA, and SZA crowns was obtained by grinding crown tissue in liquid nitrogen in SDSPAGE sample buffer containing 6 M urea substituting for the glycerol with 5% (v/v) mercaptoethanol. The lysates were heated to 70 °C for 10 min to denature proteins and the lysates were cleared by a 5 min centrifugation in a microfuge. Membrane samples were prepared by grinding 5 g of CA or SZA crowns in cold 20% (w/v) sucrose, 50 mM TRISHCl pH 7.4 with a mortar and pestle and centrifuging the lysate in a Beckman J-35 Avanti centrifuge at 10 000 rpm for 10 min. The cleared lysate was loaded into Beckman SW-41 rotor ultracentrifuge tubes and centrifuged for 3 h at 39 000 rpm at 4 °C to obtain total membrane pellets. SDSPAGE sample buffer with 6 M urea was added directly to the pellets to solubilize, and heated to 70 °C before removing the sample and for analysis by SDSPAGE immunoblots.
SDSpolyacrylamide gels were run using standard protocols with a 12% uniform resolving gel obtained from BioRad. The fractionated proteins were transferred to PVDF membranes using a BioRad apparatus. The blots were probed with immunoaffinity-purified anti-PIP2 C-terminus or anti-PIP2 phosphopeptide antibodies diluted in TRIS-buffered saline, 5% (w/v) non-fat milk, 0.5% (w/v) Tween-20 by incubating overnight. The blots were washed, probed with anti-rabbit IgG coupled to alkaline phosphatase for 90 min, washed again, and the bound second antibodies visualized with alkaline phosphatase substrate (Sigma). The resulting blots were scanned and the images processed with Photoshop.
Proteomic analysis
Two-dimensional gel electrophoresis and image analysis:
Total protein samples were subjected to 2D gel electrophoresis using 2 g of crown tissue. Total protein extract (400 mg) was loaded onto BioRad 11 cm IPG gel strips (pH 310 NL) during strip rehydration overnight, after which isoelectric focusing (IEF) was performed for a total of 68 kVh using a Protean IEF Cell (BioRad). Second dimension SDSpolyacrylamide gels (816% linear gradient, 8.7x13.3 cm) were run on a BioRad Criterion cell at 60 V for 15 min and then at 180 V for 1 h. Gels were stained with SyproRuby according to the manufacturer's protocols (Molecular Probes, Inc.). Gel images were acquired using a Typhoon laser scanner 9410 (GE Healthcare, USA) and/or a 16-bit cooled CCD camera on a GelPix protein spot excision system (Genetix Ltd, UK). Image analysis was carried out with Phoretix 2D evolution software according to the instruction booklet from Nonlinear Dynamics Ltd (Newcastle, UK). The volume of each spot of interest separated on three replicate gels was normalized against total spot volume, quantified, and excised using the GelPix system.
Protein in-gel digestion and peptide clean-up:
Proteins were subjected to in-gel digestion conducted at 37 °C for 10 h in 50 mM NH4HCO3 containing 6 µg ml1 modified trypsin (Promega, USA). Peptides were firstly extracted with 1% formic acid/2% acetonitrile and then with 60% acetonitrile. The extractions were combined, lyophilized, and resuspended into 1% formic acid/2% acetonitrile, followed by ZipTip sample clean up according to the manufacturer's instructions.
Protein identification by static nanoESI MS/MS analysis:
The protein digests were analysed on an ABI QSTAR XL (Applied Biosystems/MDS Sciex, Foster City, CA, USA) hybrid quadrupole time of flight (QTOF) tandem mass spectrometry (MS/MS) system using a rapid protein identification method. The peptide electrospray tandem mass spectra were processed using Analyst QS software (Applied Biosystems, USA) and searched against the NCBI database and custom databases including Unigene, rice, and wheat using Mascot (version 1.9) with the following constraints: tryptic peptides with up to one missed cleavage site; and 1.0 and 0.1 Da mass tolerances for MS and MS/MS fragment ions, respectively. The charge states of precursor ions selected were 13. Oxidation of methionine and carbamidomethylation of cysteine were specified as variable and fixed modifications, respectively. Positive identification was determined by considering the following criteria: (i) number of peptide sequences; (ii) protein sequence coverage; (iii) total Mascot score and individual ion score [a probabilistic implementation of the MOWSE score (http://www.matrixscience.com/help/scoring_help.html)] at P <0.05 to be significant; and (iv) the quality of MS/MS spectra judged essentially by a full-length y-ion series of peptides comprising at least six consecutive amino acids and no missed cleavage. For the protein sequences without functional annotations, the matched sequences were further queried against the NCBI database by BLAST homology and similarity searches.
| Results |
|---|
|
|
|---|
Additional freezing tolerance resulting from SZA
Exposure of Jackson wheat seedlings to 1 week of CA at 3 °C resulted in a decrease in the LT50 by
4.5 °C beyond that of NA plants (Table 1). Exposure of CA plants to a temperature of 3 °C for 24 h resulted in an additional, but statistically non-significant decrease in the LT50 by 0.4 °C, indicative of possible initial stages of SZA. The LT50 of seedlings that had been cold acclimated for a full 3 weeks and then exposed to SZA for 3 d was >2 °C lower.
|
SZA induces water intracellular displacement to apoplastic space
The volume of apoplastic fluid that was centrifugable from crowns did not change from that of NA plants when they were cold-acclimated and remained at
10% of the total water content of crowns. When CA plants were exposed to SZA, the volume of centrifugable fluid increased 3-fold (Table 2) and represented >20% of the total water content of crowns.
|
Crown cells during SZA exhibit changes in ultrastructure compared with CA cells
The ultrastructure of crown cells from SZA plants was compared with that of cells from CA plants in tissue that was conventionally fixed in glutaraldehyde and formaldehyde. Treated plants were rapidly dissected, the crowns divided longitudinally, and the tissue plunge-fixed in fixative on ice. In designing these experiments, the potential for structural modifications occurring prior to stabilization of the structure was considered. Chemical fixation rates are limited by diffusion (which is temperature dependent) into the tissue and the reaction with the target aldehyde-reactive sites. An attempt was made to conduct parallel high-pressure freezing experiments that would provide an alternative method of structural preservation without the limitations of chemical fixation. However, it was found that the preparation of material for high-pressure freezing was more problematic than chemical fixation. In order to high-pressure freeze the tissue, it is necessary to dissect small pieces of the crown on a temperature-equilibrated platform and then load the tissue into temperature-equilibrated planchets. The time needed to set up the material for high-pressure freezing and the manipulations needed with razor blades and working under the microscope with lights that introduce heating proved unsatisfactory due to mechanical damage and thawing of the samples. Conventional fixation by plunging into ice-chilled fixative resulted in tissue that was consistently well fixed by the criteria of organelle morphology and a lack of obvious common electron microscopy artefacts.
Ultrastructural changes during SZA were obvious, primarily in the endomembrane system, with more subtle changes in other organelles. The endoplasmic reticulum (ER) of SZA crown cells often exhibited a more linear morphology, with the lumen of the ER containing electron-dense amorphous deposits (not shown). During CA, Golgi in crown tissue had a typical morphology of five or six closely stacked cisternae assymetrically differentiated from the cis to trans faces, with small secretion vesicles budding from the trans end (Fig. 1A). The five or six stacked Golgi cisternae of SZA crowns appeared to be similar to those in CA tissue, but the trans face in SZA samples was often observed, with several attached and adjacent large translucent vesicles giving the appearance of an enlarged vesicle that failed to detach from the Golgi (Fig. 1B, C).
|
To examine whether these large Golgi-associated vesicles at SZA temperature may have a diagnostic constituent, the distribution of glycans was screened using antibodies and lectins specific for glycosylation status. Among the probes tested were antibodies specific for Golgi fucosyl modification of high mannose side chains, Golgi xyloglycan modification of high mannose side chains, and the lectin concanavalin A for ER origin high mannose. The xyloglycan modification assay provided specificity for the Golgi-associated SZA large vesicles. The xyloglycan antibodies labelled the interior of the large vesicles, which appears to indicate that the vesicular contents were being synthesized by the adjacent Golgi (Fig. 2). The xyloglycan antibodies also labelled the cell wall but not the adjacent vacuole, suggesting that vesicles and their contents are bound for secretion and deposition of the xyloglycan material in the cell wall.
|
Plasma membrane aquaporin is elevated in SZA
Redistribution of water within partially frozen crown tissue (such as during SZA) can be explained thermodynamically as a process whereby equilibrium is re-established between intra- and extracellular spaces by water movement out of cells to regions where ice accumulates. However, a large fraction of water transport and redistribution in plants is facilitated by specific plasma membrane (PIP) and tonoplast membrane (TIP) water pores termed aquaporins (for a review, see Chrispeels and Agre, 1994). Since water transfer during freezing is primarily across the plasma membrane, two distinct PIP isoforms were cloned and sequenced from a cDNA library made from SZA wheat crowns. The two sequences represent examples of the PIP1 and PIP2 (PIP2b) subgroups, with the former correlated with vegetative growth while members of the latter group are often induced in response to abiotic stress such as water deficit (for examples, see Johansson et al., 1996; Lee et al., 2005). RTPCR analysis of PIP1 and PIP2 using gene-specific primer pairs indicated that PIP1 expression levels were relatively constant at NA, CA, and SZA (data not shown), while PIP2 expression levels increased from NA to CA and further increased during SZA (Fig. 3A).
|
The increase in PIP2 abundance was further assayed by immunoblot assay of the protein product of this gene. A specific rabbit antipeptide antibody was elicited using the C-terminal sequence of the PIP2. The resulting antibody labelled a single band in crude protein extracts from wheat crowns fractionated by SDSPAGE. This band increased in abundance from NA to CA and remained the same in SZA extracts (Fig. 3B). This pattern was similar to the results obtained with RTPCR (Fig. 3A), which indicates that CA and SZA induce an increase in abundance of the PIP2 transcript and protein.
PIPs are regulated by phosphorylation (Johansson et al., 1996) and chilling (Azad et al., 2004; Aroca et al., 2005) and are gated to regulate water transfer (Aroca et al., 2005; Lee et al., 2005). To assess whether there is a difference in phosphorylation status of PIP2 between CA and SZA, SDSPAGE-fractionated total crown membranes were assayed by immunoblot using an antibody elicited against a phosphorylated peptide derived from the phosphorylation site on the wheat PIP2 sequence (Fig. 3C). The antibody labelled both CA and SZA membranes, with a slightly higher labelling intensity in the SZA membranes. However, the presence of phosphorylated PIP2 in both CA and SZA samples does not support a simple explanation for water export with PIP2 being activated by SZA.
Northern blot analysis using PCR-amplified PIP1 and PIP2 fragments as probes, that should not be gene specific, indicated that there is a large increase in transcript abundance for PIP1s and PIP2s between NA and CA in crowns and leaf (Fig. 4). Deacclimation for 12 h at 12 °C did not result in any decline in PIP1 and PIP2 transcript abundance (not shown).
|
DNA arrays show large-scale changes in the transcriptome from CA to SZA
To investigate the transcriptome alteration during SZA, changes in comparative mRNA abundance were assayed using 22 000 element Affymetrix barley arrays. Barley and wheat are close relatives, and the developers of the barley array have shown that it is suitable to assay some wheat messages, obtaining 5500 hits in the spots when probing it with the leaf mRNA population (Close et al., 2004). NA, CA, and SZA wheat crowns were used to prepare mRNA samples and probes. These probes were then used to assay replicate 22 000 barley arrays. For analysis of these assays, only positive hits present in both replicates of any one treatment were spot called and the data averaged from each array pair. A total of 5276 spots were called when summing the data for all three conditions. The NA, CA, and SZA plants had 318, 397, and 445 spots present, respectively, that were unique for that treatment. There were 302 spots present in NA/CA but absent from SZA and 227 spots present in CA/SZA but absent from NA. The Venn diagram shown in Fig. 5 illustrates the treatment-specific distribution of the hybridization signals.
|
Scatter plots of NA/CA and CA/SZA data averaged from replicate arrays with a ±2-fold cut-off shows that the transition from NA to CA and from CA to SZA resulted in changes in the transcriptome pattern (Fig. 6). Differences between the NA, CA, and SZA sample sets were scored using only those spots present in both array replicates of each treatment, indicating 279
2-fold upregulated changes between NA and CA and 122
2-fold upregulated changes between CA and SZA. Of these, 105 and 35 were upregulated from NA to CA and from CA to SZA, respectively. An additional 174 were downregulated
2-fold from NA to CA, and 87 from CA to SZA treatments.
|
Despite the limited coverage of the 22 000 barley array, even a casual examination of the mRNAs that are up- and downregulated shows that the transition from CA to SZA is complex. The array data showed a wide diversity of messages; selected examples are shown in Table 3 and the full data set is shown Supplementary Table 1 available at JXB online, listing the 2-fold up- and downregulated cut-offs. Among the most highly upregulated genes with a
2-fold score were mRNAs encoding a number of putative senescence-related proteins, several cold-regulated proteins and ice recrystallization inhibitors, dehydrins and related late embryogenesis abundant (LEA) proteins, and a diverse set of enzymes and transporters including many that are carbohydrate related. Among the carbohydrate-related upregulated genes are xyloglucan endo-1,4-glucanase, sucrose synthase, ß-fructofuranosidase, pyrophosphate-fructose-6-phosphotransferase, 3-glucanase, and glucose-6-phosphate/phosphate translocator. A number of putative and unknown genes included in the array were also upregulated, and many of these have similar homologues in Arabidopsis. The 2-fold downregulated genes are similarly diverse and do not exhibit any strong patterns for a group or classes of genes. Among the downregulated genes were genes encoding components of the photosynthetic apparatus or that were plastid localized, along with a diverse set of enzymes and transporters. Many of the upregulated genes were those that would presumably have a function in mitigating the stress of subzero temperature, while those downregulated are indicative of quiescent or a lower level metabolic activity especially for photosynthesis. Some gene expression patterns appear to form pairs, such as upregulation of actin depolymerization protein and downregulation of actin, both indicating a down-regulation of the actin cytoskeleton in SZA. Up- and down-regulated genes with a two-fold cut-off are available as a online data set (supplementary Table 1 at JXB online). Array assay data for NA, CA, and SZA were deposited in NCBI GEO, series accession number GSE2166.
|
Proteome changes
To ascertain whether there was a large-scale remodelling of the protein composition of wheat crowns in the CASZA transition, the total proteome was compared using 2D gels. Protein differences between NA, CA, and SZA crowns were identified using preparative 2D gels that were stained and analysed using gel scanner software (Fig. 7AC). Protein spot differences between the gels were identified by visual examination and by computation of spot volume (Figs 7BD, 8AC). The transition from NA to CA induced a large number of changes in the spot distribution on 2D gels, which was consistent with previous literature showing that CA results in major changes in transcription and induction of new proteins (Ndong et al., 2001; Fowler and Thomashow., 2002; Ivashuta et al., 2002; Seki et al., 2002; Fabio et al., 2003; Rabbani et al., 2003). Differences between CA and SZA treatments were much more subtle, with changes of new proteins or proteins lost among the minor proteins on the gel; other changes were in the increasing or decreasing abundance of proteins. Examination of the 2D gels analysed for spot volume resulted in the putative identification of several protein spots that appeared either to increase or to decrease in abundance. Fifty spots that appeared to change between gels were selected and excised with a spot picker. The spots were digested and analysed by nanoelectrospray QTOF MS/MS. The resulting mass spectrum data were analysed and protein identification was obtained by a database search. Several proteins that increased in the CA to SZA transition were identified including 200 kDa cold-induced protein, methyl-binding protein, an unknown protein, abscisic acid-induced protein, universal stress protein, and L7 ribosome protein (Fig. 8AC). Other proteins that appeared to decrease in abundance included
-tubulin, ATPase synthase
-chain, and ribulose carboxylase large subunit (Fig. 8AC). A few proteins were induced during the transition from NA to CA but declined during SZA. These included drought-induced protein Sdi-6 and translation factor 5A (Fig. 8AC).
|
|
| Discussion |
|---|
|
|
|---|
In this study, the physiological processes that support the acquisition of additional freezing tolerance by exposure to 13 d of 3 °C below freezing have been investigated by multiple types of assays. Additional freezing tolerance, as measured by LT50 assays, was acquired by CA plants after exposure to SZA for 13 d. Abrupt changes in temperature do occur quite often in nature, but more typically winter onset is accompanied by a gradual lowering of temperatures from above to below freezing in a diurnal pattern as the season progresses until both day and night temperatures are below 0 °C. As water in the soil freezes, plants will often experience a prolonged period of temperature that is slightly below 0 °C. The additional freezing resistance acquired by SZA is manifested in the biogeography of plants and in the selection of cultivars optimized for winter survival. Plant cold hardiness maps such as the USDA map of North America (Cathey and Jordan, 1990) illustrate that the most significant factor determining the distribution of plants is the lowest temperature plants are expected to encounter during their life cycle. The processes associated with SZA should be a major factor in the biogeography of plants.
The present study investigated whether there are overt biological processes that may explain the additional freezing tolerance acquired by plants exposed to SZA. The extracellular water content of NA and CA plants is essentially identical, indicating that CA does not induce redistribution of water to extracellular spaces. Lowering the temperature to 3 °C induces rapid redistribution of intracellular water to the extracellular space and peaked within 6 h. The formation of ice in the apoplast at 3 °C reduces the chemical potential of water and induces a gradient between liquid intracellular water and ice in extracellular spaces and vessels. This gradient is probably the driving force behind the redistribution of water during SZA, but the rate at which water is redistributed is a result of kinetic factors (Mazur, 1963). Mazur (1963) found that at 2 °C yeast cells which were cooled at 1 °C min1 lost half their water. The amount of water lost in that system depended on the permeability constant for the membrane. While Mazur (1963) did not speculate on the nature of the permeability constant, it is tempting to suggest that this constant may be a function of the effectiveness and regulation of the activity of the PIP population in the membranes (Mazur, 2004). In such a model, the various isoforms and subtypes of PIPs could be independently regulated to provide a wide variation of water translocation activity. The two PIPs examined here are probably only a fraction of the total aquaporin population of wheat. In Arabidopsis, 13 PIP genes were identified (Weig et al., 1997) so it is likely that with a much larger genome, wheat has many more. The loss of intracellular water in frozen plants concentrates intracellular solutes and would depress the freezing point and prevent desiccation injury of intracellular compartments, as well as restrict formation of intracellular ice. It has now been shown that this water loss is rapid, correlates with the acquisition of freezing tolerance, and that a PIP2 aquaporin and its phosphorylation is induced in parallel. At present, this sequence of events is correlative, and without a null or a knockout of the aquaporin it has not yet been demonstrated that this particular PIP2 aquaporin mediates the water export and the lowering of the LT50. However, the pattern observed supports the suggestion that the acquisition of freezing tolerance during SZA appears to have more than a simple physical basis.
Exposure of wheat plants to SZA results in biological changes in cellular structure as well as transcriptome and proteome content. It is important to note that the 22 000 Affymetrix barley array does not provide complete coverage of the genome and, although barley and wheat are closely related, it is not known whether the
6500 present spots on the arrays assayed by the wheat probes are limited by homology or by representation in the mRNA population. Although partial in its representation, the genes identified by the arrays in the up- and downregulated set from CA to SZA resulted in the identification of genes that would be expected to participate in mitigating the stress and assisting in adaptation to subzero temperature. The cold-induced dehydrins and ice recrystallization inhibition protein genes that are further upregulated in SZA are all obvious candidates for a possible role mitigating freezing stress. The parallel process of water export into the apoplast with the enhanced expression of apoplastic ice recrystallization genes offers the prospect that water trafficking and manipulating ice morphology are linked processes.
The highly induced chitinase gene may be significant; although not an obvious candidate for adaptation to SZA, the cellular damage resulting from SZA can provide a point of entry for attack by snow moulds with the induction of chitinase as one means to impede fungal parasitization (Hiilovaara-Teijo et al., 1999). Several of the genes observed as upregulated by the arrays are homologues of genes that encode enzyme activities induced in cold-adapted and stressed plants, for example, chitinase (Hon et al., 1995) and glucanase (Hincha et al., 1997). Among the other upregulated genes are enzymes involved in possible cell wall modification and several genes otherwise associated with senescence.
The set of genes downregulated during SZA similarly presents a group of genes, many of which can be grouped together by common physiological processes. The plastid and photosynthesis genes, including photosystem I chlorophyll binding and chlorophyll formation, are among the most prominent downregulated genes included in this set. This appears to correlate well with previous observations on the reduction of photosynthesis in CA (Tjus et al., 1998; Baldi et al., 2001) and appears to continue in SZA. Respiration was reduced in SZA oats to 25% of its value at 3 °C (Livingston et al., 2002), plants under SZA conditions give the overt appearance of dormancy, which would require far less photosynthetic capacity than NA or even CA conditions. Other genes downregulated by SZA included actin and kinesin, both important in growing and elongating cells of crown tissue, but probably having more limited roles in the restriction of growth that occurs with SZA. Taken together, the up- and downregulation of genes assayed by DNA arrays indicate that the CA to SZA transition results in key changes in the transcriptome, with cold/dehydration genes being induced and photosynthesis/plastid genes being repressed. Selected examples of these genes are shown in Table 3 with the full set available as supplementary material at JXB online. The changes in the transcriptome are consistent with the proposal that there are biological processes underlying the enhancement of freezing tolerance resulting from SZA. The assay of SZA in plants where whole genome arrays are available is likely to disclose many more up- and downregulated genes; with a more comprehensive list, a more complete picture of the processes involved in SZA may emerge.
Overnight exposure of CA plants to SZA resulted in changes in organelle morphology. The Golgi is a sensitive indicator of biological activity due to its rapid turnover. Protein transit through and glycoform processing of proteins in the Golgi has been shown to be rapid, taking at most a few minutes, at least at permissive temperatures. Because the entire structure is undergoing rapid renewal, the CA to SZA changes in Golgi morphology represent an adaptive alteration of Golgi function (Fig. 1B, C). The formation of large vesicles and retention of these vesicles in the near Golgi cytoplasm is a change that undoubtedly resulted from biological rather than purely physical processes. The contents of the enlarged vesicles formed by the Golgi remain uncharacterized; however, by using glycan-specific antibodies, the contents of these vesicles and the cell wall were labelled for complex glycans (Fig. 2A, B), suggesting an ontological relationship. Also, one of the genes detected with the DNA arrays as upregulated by SZA was a homologue of the Arabidopsis cis-Golgi SNARE protein. Other changes observed in organelle morphology during SZA included an increased electron-dense lumen of the ER and a nucleoplasm that appeared to have a less dispersed chromatin. Chromatin that is less dispersed may be the beginning stages of nuclear pycnosis found in freeze-damaged cells of orchardgrass (Shibata and Shimata, 1986) and oat (Livingston et al., 2005) crowns. Taken together, there are sufficient changes in organelle structure to indicate that SZA induces changes in cellular morphology.
That cell structure is altered during hardening at subzero temperatures is not surprising, because the export of intracellular water would probably require cellular remodelling whether or not this involves reworking existing constituents or adding or removing proteins, lipids, or carbohydrates. The hydrolysis of fructans to simple sugars (Trunova, 1965; Olien, 1984; Livingston et al., 1996), during SZA particularly in regions of the crown that are most likely to benefit from acclimation (Livingston et al., 2006a), should also have cellular implications for the synthesis, transport, and accumulation of carbohydrates. However, cellular remodelling does not differentiate between those changes that occur due to directed programmed changes to prepare for an altered environment and those changes that occur simply as an adaptive response to environmental conditions. The difference is not trivial and is one of the limitations of overt physiology and cell morphology. Changes in morphology are suggestive of changes in the transcription and translation pattern as well as turnover, but morphological changes do not prove this.
The transcriptome and proteomic data presented here represent only a partial data set of the total potential gene and protein changes that may occur during SZA. The DNA array used was of barley sequences, not wheat, and in the present experiments it was found that a little more than 6000 genes (6123 NA, 6588 CA, and 6529 SZA) scored as present out of the 22 000 on the array. The arrays are useful to demonstrate that SZA is accompanied by transcriptome changes, but the choice of genes present on the array coupled with the limitations of cross-species hybridization, even for closely related species, makes the data set only a partial representation of changes in the total mRNA population. Similarly, the proteome results are limited to relatively abundant proteins of wheat obtained by analysing total crown protein samples. However, even in this data set, proteins increased and decreased during SZA. Follow-up proteomic experiments will need to focus on analysing specific protein subfractions and organelle preparations from specific tissue within the crown (Livingston et al., 2005, 2006a, b). The transcriptome variations suggest that more detailed proteomic data would probably disclose many more examples of protein changes during SZA using concentrated samples from a subset of the total crown protein population.
The present data set indicates that there is a biological basis for the acquisition of added freezing tolerance during SZA with changes in the transcription and translation of specific genes. Determining which of the changes are critical to the acquisition of added freezing resistance will be key to understanding how plants obtain maximum freezing resistance. Understanding and characterizing genes involved in SZA will provide new markers for breeding projects and potentially new targets for gene transfer experiments directed at obtaining the maximum potential freezing tolerance from crop plants.
| Supplementary data |
|---|
|
|
|---|
Supplementary data can be found at JXB online.
| Abbreviations |
|---|
AFP, antifreeze protein; CA, cold acclimation; NA, non-acclimated; SZA, subzero acclimation.
| References |
|---|
|
|
|---|
Amme S, Matros A, Schlesier B, Mock H-P. (2006) Proteome analysis of cold stress response in Arabidopsis thaliana using DIGE-technology. Journal of Experimental Botany 57:15471551.
Aroca R, Amodeo G, Fernández-Illescas S, Herman EM, Chaumont F, Chrispeels MJ. (2005) The role of aquaporins and membrane damage in chilling and hydrogen peroxide induced changes in the hydraulic conductance of maize roots. Plant Physiology 137:341353.
Azad AK, Sawa Y, Ishikawa T, Shibata H. (2004) Phosphorylation of plasma membrane aquaporin regulates temperature-dependent opening of tulip petals. Plant and Cell Physiology 45:608617.
Baldi P, Vale G, Mazzucotelli E, Govoni C, Faccioli P, Stabca AM, Cattevelli L. (2001) The transcript of several components of the protein synthesis machinery are cold-regulated in a chloroplast-dependent manner in barley and wheat. Journal of Plant Physiology 158:15411546.[CrossRef][Web of Science]
Cathey HM and Jordan R. (1990) USDA Miscellaneous Publication No. 1475 Issued January 1990, http://www.usna.usda.gov/Hardzone/ushzmap.html.
Canny MJ. (1995) Apoplastic water and solute movement: new rules for an old space. Annual Review of Plant Physiology and Plant Molecular Biology 46:215236.[CrossRef][Web of Science]
Castonguay Y, Nadeau P, Laerge S. (1993) Freezing tolerance and alteration of translatable mRNAs in alfalfa hardened at subzero temperatures. Plant and Cell Physiology 34:3138.
Castonguay Y, Nadeau P, Lechasseur P, Chouinard L. (1995) Differential accumulation of carbohydrates in alfalfa cultivars of contrasting winter hardiness. Crop Science 35:509515.
Chrispeels MJ and Agre P. (1994) Aquaporins: water channel proteins of plants and animals cells. Trends in Biochemical Science 19:421425.
Close TJ, Wanamaker S, Caldo RA, Turner SM, Ashlock DA, Dickerson JA, Wing RA, Muehlbauer GJ, Kleinhofs A, Wise RP. (2004) A new resource for cereal genomics: 22K barley GeneChip comes of age. Plant Physiology 134:960968.
Cook D, Fowler S, Fiehn O, Thomashow MF. (2004) A prominent role for the CBF cold response pathway in configuring the low-temperature metabolome of Arabidopsis. Proceedings of the National Academy of Sciences, USA 101:1524315248.
Dave RS and Mitra RK. (1998) A low temperature induced apoplastic protein isolated from Arachis hypogaea. Phytochemistry 49:22072213.[CrossRef][Web of Science][Medline]
Fábio TSN, De Rosa VE Jr, Menossi M, Ulian EC, Arruda P. (2003) RNA expression profiles and data mining of sugarcane response to low temperature. Plant Physiology 132:18111824.
Fowler S and Thomashow MF. (2002) Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold-acclimation in addition to the CBF cold response pathway. The Plant Cell 14:16751690.
Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF. (2000) Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold-acclimation. Plant Physiology 124:18541865.
Griffith M, Ala P, Yang DSC, Hon WC, Moffat BA. (1992) Antifreeze protein produced endogenously in winter rye leaves. Plant Physiology 100:593596.
Griffith M, Lumb C, Wiseman SB, Wisniewski M, Johnson RW, Marangoni AG. (2005) Antifreeze proteins modify the freezing process in planta. Plant Physiology 138:330340.
Guy CL. (1990) Cold-acclimation and freezing stress tolerance: role of protein metabolism. Annual Review of Plant Physiology and Plant Molecular Biology 41:187223.[Web of Science]
Gusta LV and Fowler DB. (1977) Factors affecting the cold survival of winter cereals. Canadian Journal of Plant Science 57:213219.
Gusta LV, Wisniewski M, Nesbitt NT, Gusta ML. (2004) The effect of water, sugars, and proteins on the pattern of ice nucleation and propagation in acclimated and nonacclimated canola leaves. Plant Physiology 135:16421653.
Hiilovaara-Teijo M, Hannukkala A, Griffith M, Yu XM, Pihakaski-Maunsbach K. (1999) Snow-mold-induced apoplastic proteins in winter rye lack antifreeze activity. Plant Physiology 121:665674.
Hincha DK, Meins F Jr, Schmitt JM. (1997) ß-1,3-Glucanase is cryoprotective in vitro and is accumulated in leaves during cold accumulation. Plant Physiology 114:10771083.[Abstract]
Hon WC, Griffith M, Chong P, Yang DSC. (1994) Extraction and isolation of antifreeze proteins from winter rye (Secale cereale L.) leaves. Plant Physiology 104:971980.[Abstract]
Hon WC, Griffith M, Mlynarz A, Kwok YC, Yang DSC. (1995) Antifreeze proteins in winter rye are similar to pathogenesis-related proteins. Plant Physiology 109:878889.
Hughes MA and Dunn MA. (1996) The molecular biology of plant acclimation to low temperature. Journal of Experimental Botany 47:291305.
Ivashuta S, Uchiyama K, Gau M, Shimamoto Y. (2002) Linear amplification coupled with controlled extension as a means of probe amplification in a cDNA array and gene expression analysis during cold-acclimation in alfalfa (Medicago sativa L.). Journal of Experimental Botany 53:351359.
Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Schabenberger O, Thomashow MF. (1998) Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 280:104106.
Johansson I, Larsson C, Ek B, Kjellbom P. (1996) The major integral proteins of spinach leaf plasma membrane are putative aquaporins and are phosphorylated in response to Ca2+ and apoplastic water potential. The Plant Cell 8:11811191.[Abstract]
Kaplan F, Kopka J, Haskell DW, Zhao W, Schiller C, Gatzke N, Sung DY, Guy CL. (2004) Exploring the temperature-stress metabolome of Arabidopsis. Plant Physiology 136:41594168.
Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. (1999) Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nature Biotechnology 17:287291.[CrossRef][Web of Science][Medline]
Lee SH, Chung GC, Steudle E. (2005) Gating of aquaporins by low temperature in roots of chilling-sensitive cucumber and chilling-tolerant figleaf gourd. Journal of Experimental Botany 56:985995.
Livingston DP III. (1991) Non-structural carbohydrate accumulation in winter oat crowns before and during cold-acclimation. Crop Science 31:751755.
Livingston DP III. (1996) The second phase of cold-acclimation: freezing tolerance and fructan isomer changes in winter cereal crowns. Crop Science 36:15681573.
Livingston DP III and Henson CA. (1998) Apoplastic sugars, fructans, fructan exohydrolase and invertase in winter oat: responses to second-phase cold-acclimation. Plant Physiology 116:403408.
Livingston DP III and Premakumar R. (2002) Apoplastic carbohydrates do not account for differences in freezing tolerance of two winter oat cultivars that have been second phase cold acclimated. Cereal Research Communications 30:375381.
Livingston DP III, Premakumar R, Tallury SP. (2006a) Carbohydrate partitioning in crown tissue of oat and rye during cold acclimation and freezing. Cryobiology 52:200208.[CrossRef][Medline]
Livingston DP III, Tallury SP, Owens SA, Livingston JD, Premakumar R. (2006b) Freezing in non-acclimated oats: thermal response and histological observations of crowns during recovery. Canadian Journal of Botany 84:199210.
Livingston DP III, Tallury SP, Premakumar R, Owens S, Olien CR. (2005) Changes in the histology of cold acclimated oat crowns during recovery from freezing. Crop Science 45:15451558.
Liu X, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. (1998) The transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. The Plant Cell 10:13911406.
Mahfoozi S, Limin AE, Fowler DB. (2001) Influence of vernalization and photoperiod responses on cold hardiness in winter cereals. Crop Science 41:10061011.
Marentes E, Griffith M, Mlynarz A, Brush RA. (1993) Proteins accumulate in the apoplast of winter rye during cold-acclimation. Physiologia Plantarum 87:499507.[CrossRef]
Marshall HG. (1965) A technique of freezing plant crowns to determine the cold resistance of winter oats. Crop Science 5:8386.[Medline]
Mazur P. (1963) Kinetics of water loss from cells at subzero temperatures and the likelihood of intracellular freezing. Journal of General Physiology 47:347369.
Mazur P. (2004) Principles of cryobiology. In Fuller BJ, Lane N, Benson EE (Eds.). Life in the frozen state(CRC Press, Bocan Raton, FL) pp. 451.
Ndong C, Dabyluk J, Huner NPA, Sarhan F. (2001) Survey of gene expression in winter rye during changes in growth temperature, irradiance or excitation pressure. Plant Molecular Biology 45:691703.[CrossRef][Web of Science][Medline]
Olien CR. (1964) Freezing processes in the crown of Hudson barley Hordeum vulgare (L. emend. Lam.) Hudson. Crop Science 4:9195.[Medline]
Olien CR. (1984) An adaptive response of rye to freezing. Crop Science 24:5154.
Palta JP and Weiss L. (1993) Ice formation and freezing injury: an overview on the survival mechanisms and molecular aspects of injury and cold-acclimation in herbaceous plants. In Li PH and Christersson L (Eds.). Advances in plant cold hardiness(CRC Press, Boca Raton, FL) pp. 143176.
Pearce RS and Ashworth EN. (1992) Cell shape and localization of ice in leaves of overwintering wheat during frost stress in the field. Planta 188:324331.[Web of Science]
Provart NJ, Gil P, Chen W, Han B, Chang HS, Wang X, Zhu T. (2003) Gene expression phenotypes of Arabidopsis associated with sensitivity to low temperatures. Plant Physiology 132:893906.
Rabbani MA, Maruyama K, Abe H, et al. (2003) Plasma membrane aquaporins are involved in winter embolism recovery in walnut tree. Plant Physiology 133:630641.
Seki M, Narusaka M, Ishida J, et al. (2002) Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA microarray. The Plant Journal 31:279292.[CrossRef][Web of Science][Medline]
Shibata S and Shimada T. (1986) Anatomical observation of the development of freezing injury in orchardgrass crown. Journal of Japanese Grassland Science 32:197204.
Sieg F, Schroder W, Schmitt JM, Hincha DK. (1996) Purification and characterization of a cryoprotective protein (cryoprotectin) from the leaves of cold-acclimated cabbage. Plant Physiology 111:215221.[Abstract]
Single WV and Marcellos H. (1981) Ice formation and freezing injury in actively growing cereals. In Olien CR and Smith MN (Eds.). Analysis and improvement of plant cold hardiness(CRC Press, Boca Raton, FL) pp. 3559.
Smallwood M, Worrall D, Byass L, Elias L, Ashford D, Doucet CJ, Holt C, Telford J, Lillford P, Bowles DJ. (1999) Isolation and characterization of a novel antifreeze protein from carrot. Biochemical Journal 340:385391.
Thomashow MF. (1990) Molecular genetics of cold-acclimation in higher plants. Advances in Genetics 28:99131.
Thomashow MF. (1999) Plant cold-acclimation: freezing tolerance, genes and regulatory mechanisms. Annual Review of Plant Physiology and Plant Molecular Biology 50:571599.[CrossRef][Web of Science]
Tjus SE, Moller BL, Scheller HV. (1998) Photosystem I is an early target of photo inhibition in barley illuminated at chilling temperature. Plant Physiology 116:755764.
Tremblay K, Ouellet F, Fournier J, Danyluk J, Sarhan F. (2005) Molecular characterization and origin of novel bipartite cold-regulated recrystallization inhibition proteins from cereals. Plant and Cell Physiology 56:884891.
Trunova TI. (1965) Light and temperature systems in the hardening of winter wheat and the significance of oligosaccharides for frost resistance. Fiziologiya i Biokhimiya Kulturnykh Rastenii 12:7077.
Vogel JT, Zarka DG, Van Buskirk HA, Fowler SG, Thomashow MF. (2005) Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis. The Plant Journal 41:195211.[CrossRef][Web of Science][Medline]
Weig A, Deswarte C, Chrispeels MJ. (1997) The major intrinsic protein family of Arabidopsis has 23 members that form three distinct groups with functional aquaporins in each group. Plant Physiology 114:13471357.[Abstract]
Wisniewski M. (1997) Immunolocalization and in vitro cryoprotective activity of PCA 60: a peach dehydrin. Biol. Bull. Poznan 34:(Suppl), 82.
Worrall D, Elias L, Ashford D, Smallwood M, Sidebottom C, Lillford P, Telford J, Holt C, Bowles D. (1998) A carrot leucine-rich-repeat protein that inhibits ice recrystallization. Science 282:115117.
Yaklich R and Herman EM. (1995) Protein storage vacuoles of soybean aleurone cells accumulate a unique glycoprotein as well as proteins thought to be embryo specific. Plant Science 107:5767.[CrossRef]
Yoshida M, Abe J, Moriyama M, Shimokawa S, Nakamura Y. (1997) Seasonal changes in the physical state of crown water associated with freezing tolerance in winter wheat. Physiologia Plantarum 99:363370.[CrossRef]
Yu XM and Griffith M. (1999) Antifreeze proteins in winter rye leaves form oligomeric complexes. Plant Physiology 119:13611369.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R. B. Heinen, Q. Ye, and F. Chaumont Role of aquaporins in leaf physiology J. Exp. Bot., June 19, 2009; (2009) erp171v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Thapa, R. Arora, A. D. Knapp, and E. C. Brummer Applying Freezing Test to Quantify Cold Acclimation in Medicago truncatula J. Amer. Soc. Hort. Sci., September 1, 2008; 133(5): 684 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.C. Koo, B.S. Bushman, and I.W. Mott Transcripts Associated with Non-Acclimated Freezing Response in Two Barley Cultivars The Plant Genome, July 1, 2008; 1(1): 21 - 32. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












