JXB Advance Access originally published online on October 16, 2006
Journal of Experimental Botany 2006 57(14):3911-3920; doi:10.1093/jxb/erl155
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH PAPER |
Leaf hairs influence phytopathogenic fungus infection and confer an increased resistance when expressing a Trichoderma 
-1,3-glucanase
Instituto de Bioquímica Vegetal y Fotosíntesis, Centro de Investigaciones Científicas Isla de la Cartuja, CSIC and Universidad de Sevilla, Avda. Américo Vespucio 49, E-41092 Sevilla, Spain
* To whom correspondence should be addressed. E-mail: lromero{at}ibvf.csic.es
Received 19 May 2006; Accepted 11 August 2006
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionSupplementary dataReferences |
|---|
The leaf surface of a very large number of plant species are covered by trichomes. Non-glandular trichomes are specialized unicellular or multicellular structures that occur in many different plant species and function in xenobiotic detoxification and protecting the plant against pest attack. By analysing the susceptibility of trichome mutants, evidence is provided that indicates the influence of leaf trichomes on foliar fungal infections in Arabidopsis thaliana, probably by facilitating the adhesion of the fungal spores/hyphae to the leaf surface. A decreased trichome number in the hairless Arabidopsis mutant gl1 enhances tolerance against the necrotrophic fungus Botrytis cinerea. By contrast, the try mutant shows an increased susceptibility to both fungal infection and accumulation. Trichome density does not influence infection by the soil-borne pathogen Rhizoctonia solani. In addition, the influence of trichomes on foliar infection is supported by targeting the high-level expression of the Trichoderma harzianum
-1,3-glucanase protein to the specialized cell structures. Trichome expression of this anti-fungal hydrolase shows a significant resistance to infection by the foliar pathogen Botrytis cinerea. Resistance to this fungus is not dependent on the constitutive induction of the salicylic or jasmonic defence signalling pathways, but the presence of the -1,3-glucanase protein in trichomes. Key words: Antifungal activity, phyllosphere, plant defence, Rhizoctonia solani, Trichoderma harzianum
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary dataReferences |
|---|
Trichomes are specialized unicellular or multicellular structures derived from the epidermal cell layer. Multicellular trichomes occur in many different species and often form glands that secrete various compounds including organic acids, polysaccharides, terpenes, nectar, or salt (Werker, 2000). In Arabidopsis thaliana, the unicellular non-glandular trichomes originate from a single epidermal cell that differentiates to form a characteristic, three-branched structure with an unknown function. Leaf trichomes form on stem and leaf surfaces to an extent that depends on the ecotype (Hülskamp and Kirik, 2000; Werker, 2000). Multiple mutants have been isolated in Arabidopsis with altered trichome number or development. The earliest stages of trichome morphogenesis are blocked by mutations in the GLABROUS1 (GL1) and TRANSPARENT TESTA GLABRA (TTG1) loci. Trichomes are not found in the gl1 leaves, and the epidermal cells are uniform in size and shape. The ttg1 mutants also show the same hairless phenotype and both mutations are epistatic to all the remaining trichome mutations, suggesting that GL1 and TTG1 are required for the specification of the trichome cell (Hülskamp et al., 1994). However, the ttg1 mutant has several pleiotropic defects, one of which is the lack of anthocyanin biosynthesis (Walker et al., 1999). Mutations at the TRYPTYCHON (TRY) locus also affect the number of trichomes and produce a unique phenotype, where nests of up to four trichomes occur in the place of a single trichome (Hülskamp and Kirik, 2000).
Generally, the non-glandular trichomes, such as those present in Arabidopsis, are believed to be physical defensive structures, and it has been demonstrated that natural enemies impose selection for increased trichome density (Eisner et al., 1998; Mauricio and Rausher, 1997). Therefore, a direct plant defence mechanism against herbivore attack is the production of thorns and trichomes in order to avoid wounding by the predator, thus acting as a physical barrier. In the herb plant Mentzelia pumila, leaves and stems are covered with hooked trichomes that are able to entrap and kill several insect species (Eisner et al., 1998). There is also evidence that Arabidopsis trichomes play additional or alternative roles in response to abiotic stress conditions such as the detoxification of heavy metals (Ager et al., 2003; Domínguez-Solís et al., 2004). In cadmium-contaminated soil, leaf trichomes accumulate the toxic metal at a concentration of up to 10-fold higher compared with epidermal cells (Gotor et al., 2003). In addition, high levels of glutathione biosynthesis, a process related to the accumulation of xenobiotic molecules, were measured in Arabidopsis trichome cells (Gutiérrez-Alcalá et al., 2000). The function of trichomes as sinks for toxic molecules may also decrease the nutritional value of the plant and therefore deter herbivore feeding. Although there are many reports that link glandular and non-glandular trichomes with herbivore attacks, information is lacking as to whether trichomes serve an additional function against microbial infection. Trichomes do, however, increase the capture and retention rate of airborne particles such as pollen and fungal spores on leaf surfaces (Roda et al., 2003).
Evidence is provided here that indicates the influence of leaf trichomes on foliar fungal infection in Arabidopsis thaliana. Based on these initial observations, a regulatory DNA fragment was then used that is able to confer high levels of expression in trichomes (Gutiérrez-Alcalá et al., 2005), in order to direct exo--1,3-glucanase (EC 3.2.1.84
[EC]
) protein production in the specialized cell structures. This enzyme was isolated from the mycoparasitic fungus Trichoderma harzianum which has been described as an antagonist fungus against a broad range of phytopathogenic fungi (Papavizas, 1985). With this approach, a phenotype with significant resistance to infection by the foliar pathogen Botrytis cinerea was obtained.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary dataReferences |
|---|
Plant material and growth conditions
Arabidopsis thaliana gl1 mutants in Landsberg erecta and Columbia-0 backgrounds were provided by the Nottingham Arabidopsis Stock Centre (NASC), and the try mutant in the Landsberg erecta background was provided by Dr Martin Hülskamp. Wild-type, transgenic, and mutant plants were grown on moist vermiculite supplemented with Hoagland medium or in soil media at 20/18 °C light/dark, under a 16/8 h light/dark photoperiod as described by Domínguez-Solís et al. (2001). For infectivity assays and PR expression analysis, plants were grown on soil media under a 10/14 h 22/20 °C light/dark cycle.
Fungus infections
Botrytis cinerea strain ME4 was grown in solid strawberry broth for 12 d, and spore suspensions were prepared at a concentration of 5x105 spores ml–1 in 12 g l–1 Potato-Dextrose-Broth (PDB). For needle-wound assays, three leaves per plant were punctured in two positions per leaf and a 5 µl drop of the spore suspension was placed over the wound. Plants were covered with a transparent film in order to keep 100% humidity. After a 4 d incubation period in the growth chamber, lesions were scored. For sprayed assays, plants randomly localized in flat trays were pulverized with a Preval sprayer with 5x105 spore suspension. Around 300 µl of spore suspension per plant was used. Plants were covered with a transparent film and incubated as described above. Symptoms were observed after 4 d.
Rhizoctonia solani, strain CBS 326.84 was grown on potato agar plates at room temperature. Two-week-old Arabidopsis plants were inoculated with Rhizoctonia by placing a 1 cm diameter agar plug of mycelium on the soil in the centre of the pot. Each pot containing 45–50 plants homogeneously distributed was covered with a plastic bag after inoculation and transferred to the growth chamber as described. Infected plants were evaluated 7 d post-inoculation.
Statistical analysis of the results was done with one-way ANOVA.
DNA cloning and plasmid construction
The plasmid pATP-AGN13.1, containing the gene agn13.1 coding for an exo--1,3-glucanase from the fungus Trichoderma harzianum (GenBank/EBI accession no. AJ243799
[GenBank]
) (Ait-Lahsen et al., 2001), was under control of the OASA1 gene promoter (Gotor et al., 1997; Gutiérrez-Alcalá et al., 2005) and constructed by PCR amplification using the proofreading Platinum Pfx DNA polymerase (Invitrogen). Forward and reverse primers used for amplification of the agn13.1 cDNA were AGN13F, AATGGATCCATGCGGTCTCTCGA GGAA (BamHI restriction site underlined) and AGN13R, TCAGAGCTCGATTGATCCCTCCTA GCA (SstI restriction site underlined), respectively. These primers amplified a DNA fragment of 1848 bp coding for the mature AGN13.1 protein beginning at amino acid 28 and therefore lacking the transit peptide. The PCR amplified DNA fragment was cut with BamHI and SstI and ligated to a derivative of pBI121 plasmid (Clontech) containing the OASA1 gene promoter instead of the CaMV 35S promoter (Gutiérrez-Alcalá et al., 2005). This promoter spans from –1435 to +375 of the genomic OASA1 gene sequence (At4g14880) and corresponds to nucleotides 8521846–8520037 of Arabidopsis thaliana chromosome 4.
Transformation of Arabidopsis plants
For plant transformation, the chimeric gene was transformed into the Agrobacterium tumefaciens strain C58pMP90. Arabidopsis thaliana (ecotype Columbia) was transformed by dipping developing floral tissue into a solution containing the Agrobacterium strain, 5% sucrose and 0.02% (v/v) of surfactant Silwet L-77 as described by Clough and Bent (1998). Transgenic plants were recovered by selecting seeds on solid MS medium containing 50 mg l–1 kanamycin, and copy number assessed by monitoring the segregation of resistance to kanamycin. T2 or subsequent generations of each line were used for experiments.
RT-PCR
Arabidopsis RNA was extracted using the RNeasy Mini Kit (Qiagen). RNA (2 µg) was retro-transcribed by the Superscript First-Strand Synthesis System for RT-PCR (Invitrogen). An aliquot of the cDNA (2 µl) was amplified in subsequent PCR reactions using the following oligonucleotides: AGN13F, 5'-AATGGATCCATGCGGTCTCTCGAGGAA-3' and AGN13R, 5'-TCAGAGCTCGATTGATCCCTCCTAGCA-3' for the agn13.1 gene; PR1F, 5'-GTAGGTGCTCTTGTTCTTCCC-3' and PR1R, 5'-CACATAATTCCCACGAGGATC-3' for the pr1 gene; PDF1.2F, 5'-AATGAGCTCTCATGGCTAAGTTTGCTTCC-3' and PDF1.2R, 5'-AATCCATGGAATACACACGATTTAGCACC-3' for the pdf1.2 gene. PCR conditions were as follows: a denaturation cycle of 2 min at 94 °C, 15 (for pr1 and pdf1.2) or 35 (for agn13.1) amplification cycles of 1 min at 94 °C, 1 min at 60 °C and 1 min at 72 °C, and an extension cycle of 3 min at 72 °C. In each case, a control of the constitutive ubq10 gene was made in parallel with the primers UBQ10F, 5'-GATCTTTGCCGGAAAACAATTGGAGGATGGT-3' and UBQ10R, 5'-CGACTTGTCATTAGAAAGAAAGA GATAACAGG-3'.
Quantitative PCR (qPCR)
DNA from infected plants was extracted following the described protocol of Specht et al. (1982). qPCR was carried out using a qPCR Core Kit for SYBR Green I-No ROX (Eurogentec) following the manufacturer's instructions. Two or three dilutions of each DNA sample were used and at least three independent experiments were quantified. DNA from the B. cinerea creA gene (Tudzynski et al., 2000) was amplified using the oligonucleotides creABOTF (5'-TCCTGCTCTTGCACCCATGGA-3') and creABOTR (5'-CCGGAGCTTGAGGAACTGGT-3'). As an internal standard to normalize the qPCR, A. thaliana ubq10 DNA was amplified using the oligonucleotides UBQ10F and UBQ10R described above. Relative quantifications were performed according to described mathematical models (Pfaffl, 2001).
Microarray slide treatment
Superamine Telechem slides containing more than 28 000 spots corresponding to the Arabidopsis thaliana oligo set from Qiagen-Operon were obtained from David Galbraith (Arizona University). More information about printing and the oligo sets can be found at the following web site (http://ag.arizona.edu/ microarray/). Printed slides were rehydrated over a 65 °C water bath for 10 s and dried on a 65 °C heating block for 10 s. The hydration step was repeated three times. Oligonucleotides were fixed by UV radiation at 120 mJ. Slides were washed in 1% SDS for 5 min, water for 5 min and in absolute ethanol for 30 s. Finally, slides were dried by centrifugation at 141 g for 3 min.
Prehybridization was performed at 42 °C for 30–45 min in 6x SSC, 0.5% SDS, and 1% BSA. Slides were rinsed five times with distilled water. Fragmented Cy5- and Cy3-amplified RNA (aRNA) probes were mixed (200 pmol of each label) with 20 µg of PolyA (Sigma) and 20 µg of yeast tRNA (Sigma) in a final volume of 90 µl hybridization buffer (50% formamide, 6x SSC, 0.5% SDS, 5x Denhardt's). The probe was denatured at 95 °C for 5 min and applied to the slide using a LifterSlip (Erie Scientific). Slides were then incubated at 37 °C for 16 h in hybridization chambers (Array-It). After incubation, slides were washed twice with 0.5x SSC, 0.1% SDS for 5 min each, twice with 0.5x SSC for 5 min and finally in 0.05x SSC for 5 min. Slides were dried by centrifugation at 563 g for 1 min.
Images from Cy3 and Cy5 channels were equilibrated and captured with a GenePix 4000B (Axon) and spots quantified using GenPix software (Axon). The data from each scanned-slide were first escalated and normalized using the Lowess method and were then log-transformed. The mean for log-ratio intensities and standard deviation among replicates was generated. Two statistical approaches were used to identify differentially-regulated genes; the t test (Smyth et al., 2002) and a z-score (Quackenbush, 2002). Only genes with a P-value of less than 0.05 and a z-score greater than two were considered differentially expressed.
RNA amplification and labelling for microarray analysis
Total RNA (1 µg of each) was amplified and aminoallyl-labelled using MessageAmpTM II aRNA kit (Ambion) and 5-(3-aminoallyl)-2'deoxyuridine-5'-triphosphate (aa-dUTP, Ambion), following the manufacturer's instructions. Approximately 40–50 µg of aRNA was obtained. For each sample, 7.5 µg of aminoallyl-labelled aRNA was resuspended in 0.1 M Na2CO3 (pH 9.0) and labelled with either Cy3 or Cy5 Mono NHS Ester (CyTMDye Post-labeling Reactive Dye Pack, Amersham). The samples were purified following manufacturer's instructions for MegaclearTM (Ambion). Cy3 and Cy5 incorporation was measured using 1 µl of the probe in a Nanodrop spectrophotometer (Nanodrop Technologies Inc.). For each hybridization, 200 pmol of Cy3 and Cy5 probes were mixed, dried in a Speed-Vac, and resuspended in 9 µl of RNase-free water. Labelled aRNA was fragmented by adding 1 µl of 10x Fragmentation buffer (Ambion) and incubating at 70 °C for 15 min. The reaction was stopped with 1 µl of Stop solution (Ambion). Integrity and average size of total RNA, aRNA, and fragmented aRNA were evaluated using a Bioanalyser 2100 (Agilent). The average size of aRNAs was about 1000 nucleotides and of fragmented aRNAs about 100 nucleotides. The final volume of the probe was diluted to 100 µl in hybridization solution.
Determination of -1,3-glucanase activity
Crude extracts were prepared from wild-type and transgenic plant leaves by grinding in liquid nitrogen. The extracts were dialysed against 50 mM potassium acetate buffer, pH 5.5, to eliminate reducing sugars from the extracts before the enzyme activity measurements. -1,3-Glucanase activity was assayed by measuring the reducing sugars produced in the enzyme reaction as previously described by Ait-Lahsen et al. (2001). The substrate of the enzyme reaction was mutan, which is composed of -1,3-glucan with some -1,6-glucan side chains, and was prepared from Streptococcus mutants CECT 4034, as previously described by Robert et al. (1993).
Preparation of trichome protein extracts
Tichomes were isolated from leaves by chemical extraction with EGTA (ethylene glycol-bis[ß-aminoethyl ether]-N,N,N',N'-tetra-acetic acid) based on a previously described method (Zhang and Oppenheimer, 2004). Ten grams of mature leaves were submerged in 100 ml of PMT (25 mM PIPES, 0.5 mM MgSO4, 0.05% (v/v) Triton X-100, pH 7.2) supplemented with 50 mM EGTA, vacuum infiltrated for 20 min, and incubated 16 h at 4 °C. The solution was filtrated through a Miracloth (Calbiochem) to collect the isolated trichomes, which were then rinsed with 500 µl of PMT and centrifuged at 1500 g for 10 min. The resulting pellet containing the trichomes was resuspended in 200 µl of 50 mM TRIS–HCl, pH 7.5. To the trichome suspension, 150 mg of wet glass beads (425–600 µm diameter) was added and the mixture was vortexed for 4–5 min in periods of 1 min with intervals of 1 min at 4 °C. The suspension was then centrifuged at 16 000 g for 20 min at 4 °C and the supernatant collected. To the remaining pellet, another 200 µl of 50 mM TRIS–HCl, pH 7.5, was added, vortexed, and centrifuged as described above. The resulting supernatant was mixed with the previous one and both constituted the final trichome protein extract. The amount of soluble protein was determined using the Bio-Rad dye reagent and the yield routinely was 2–4 µg total protein.
Immunoprecipitation of the -1,3-glucanase protein and SDS-PAGE
Trichome extracts containing 2–4 µg total protein were incubated with rabbit polyclonal antibodies raised against the purified AGN13.1 protein (Ait-Lahsen et al., 2001) at 4 °C overnight with gentle shaking. The immunoprecipitates were collected by centrifugation at 16 000 g for 10 min, washed four times with 50 mM TRIS–HCl, pH 7.5, 50 mM NaCl, 2% Triton X-100, and twice with 10 mM TRIS–HCl, pH 7.5. The washed immunoprecipitates were then subjected to SDS-PAGE with 12% acrylamide separating gel.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary dataReferences |
|---|
Influence of trichomes on foliar fungal infection
In an attempt to determine if trichomes have any effect on the infection by pathogens attacking the leaf surface, Arabidopsis wild-type leaves were challenged with a spore suspension of Botrytis cinerea. Figure 1 clearly shows the progress of the B. cinerea infection 4 d post-inoculation and the colonization of leaf trichomes by the wrapping of fungal hyphae. These micrographs may suggest that the presence of trichomes facilitates the fungal infection, acting as physical adhesion points of the hyphae.
|
To confirm that trichomes affect plant infections by foliar pathogenic fungi, a challenge was made with two different fungi, the foliar pathogen B. cinerea and the soil-borne pathogen Rhizoctonia solani, on plant mutants with different trichome numbers (Fig. 2). It was observed that the Arabidopsis Ler-gl1 mutant which is devoid of trichomes shows enhanced tolerance to the fungus B. cinerea when compared with the susceptibility of the wild-type ecotype Landsberg erecta and the trichome over-producer Ler-try mutant (Fig. 2A, B). Several tests were carried out for leaf infection and, in all cases, the gl1 mutant plants were less susceptible to infection by B. cinerea. Botrytis is a foliar necrotrophic fungal pathogen that causes necrotic lesions in the inoculated leaves and is able to spread to non-inoculated tissues. A well-established standard inoculation assay was initially performed on wound leaves to facilitate the initiation of the infection. In this needle-wound test, drops of spore suspension were layered over 0.8 mm needle-prick wounds made on the leaves, and the production of lesions were examined after 4 d of inoculation. With this assay, the contribution of trichomes on the spreading of the infection, after the initial infection had been established on the surface of the leaf, was determined. In a second test, a non-disruptive assay was used to ensure that the trichomes and the leaf surface were not damaged during the inoculation. Therefore, plants were sprayed with the spore suspension and were examined 4 d post-treatment for the appearance of lesions. With this assay, the contribution of trichomes on spore attachment, initiation, and infection spreading was mainly measured. Brown necrotic and chlorotic lesions on the leaf were considered positive infections and the HR (hypersensitive response)-like lesions were considered non-positive infections. After challenging with the fungi, gl1 had up to 14% fewer infections than the wild-type plants in the needle-wound test and this number increased to 24% fewer infections in the spray test (Fig. 2A). The differences observed between both assays clearly indicate that trichome number is as important in the establishment as it is in the spreading of the infection.
|
The wild-type and gl1 plants in the needle-wound test showed a similar 26% of HR-like lesions, yet the number of non-infected inoculations was significantly higher in the gl1 line (data not shown). Similar tests for leaf infection performed to compare gl1 and wild type in Col-0 background showed the same level of resistance to B. cinerea in both Ler-gl1 and Col-gl1 mutants (data not shown). Although the try mutant was more susceptible to B. cinerea infection, the high variability of the data voided the results as statistically significant (Fig. 2A).
To validate these results, quantitative PCR (qPCR) analysis of the creA gene from B. cinerea in the infected leaves was carried out; this test also served as a quantitative determination of fungal biomass. Real-time fluorescence PCR has been proven to be an accurate technique to evaluate disease susceptibility phenotypes for several microbial pathogens (Brouwer et al., 2003; Van Wees et al., 2003). In this experiment, leaves were first challenged with fungi using the needle-wound test and DNA from entire leaves was isolated after 4 d of treatment. The needle-wound test was selected over the spray test because the latter gave very high background amplification even after an exhaustive wash of the leaves prior to DNA extraction. The data confirmed that the gl1 mutant was significantly less susceptible to B. cinerea, with almost 50% less fungal accumulation than the wild type (Fig. 2B). In addition, this quantitative analysis revealed a statistically significant 40% more fungal biomass in the try mutant than the wild-type plant. This result may suggest that the try mutant had an enhanced susceptibility to B. cinerea, probably due to a higher attachment of the fungal hyphae in the try mutant than in wild-type plants.
The soil-borne pathogen Rhizoctonia solani attacks plants at the soil surface and infects the roots and the collar. Infection tests performed with R. solani in both wild type and trichome mutants did not show any significant difference in plant susceptibility to the fungus (Fig. 2C). This observation suggests that the increased resistance to B. cinerea observed in the gl1 mutant is not a general effect but only affects fungal infection through the leaves, and confirms the influence of trichomes for an efficient infection.
Transcriptomic analysis of the gl1 mutant
The gl1 mutant does not show any additional phenotypic differences compared with wild type under standard Arabidopsis growth conditions, and therefore, there are no apparent pleiotropic changes in the gl1 mutant. However, to ascertain whether the gl1 mutation may activate plant defence responses, whole-genome expression profiles of wild-type plants and gl1 mutants were compared under the experimental conditions used here. Following standard statistical criteria (P <0.05 and z-score >2; see Materials and methods), 35 differentially-expressed genes were found between both genotypes, 18 of them induced and 17 repressed in the gl1 mutant (Fig. 3; see supplementary material, Tables I and II, at JXB online). These genes were categorized with the MapMan software (Thimm et al., 2004) and all of them appeared in 10 functional categories, six of them only containing one gene. Most of the differentially expressed genes were of unknown function (48%) and only five of them may be related to biotic or abiotic stress. However, it is clear that activation of systemic acquired resistance or of salicylic-, jasmonic- or ethylene-dependent defence signalling pathways does not occur. Changes on the surface of the gl1 mutant were also excluded since none of the differentially expressed genes were categorized within the cell wall metabolism group or were involved in stomatal differentiation or cuticle biosynthesis.
|
Trichome overexpression of the Trichoderma harzianum agn13.1 gene enhances tolerance to Botrytis cinerea
The observed effect of trichomes facilitating the foliar fungal infection prompted the question as to whether the localization of proteins with anti-fungal activity to the trichomes could increase the defence machinery of the plant against B. cinerea infection. In addition, it was hypothesized that the increased resistance of the engineered plants could be used as additional evidence of a trichome effect on fungal infection. For this purpose, a well-characterized promoter that confers high expression levels in trichomes (Gotor et al., 1997; Gutiérrez-Alcalá et al., 2005) was fused to the agn13.1 gene, coding for an exo
-1,3-glucanase from Trichoderma harzianum (Ait-Lahsen et al., 2001); this produced the pATP-AGN13 construct. The -1,3-glucanase enzyme possesses both lytic and anti-fungal activity against fungal plant pathogens (Ait-Lahsen et al., 2001). Arabidopsis plants were transformed with pATP-AGN13 and six independent homozygous lines were selected for further analysis. All six transgenic lines showed significant expression of the agn13.1 gene as analysed by RT-PCR (Fig. 4A). The expression of the agn13.1 gene, under control of the ATP promoter, did not alter the growth of the transgenic plants and showed an identical phenotype to that of the wild-type plants grown under standard conditions.
|
The activity of
-1,3-glucanase was also measured in concentrated total leaf crude extracts and was detectable only at very low levels in all the transgenic lines (data not shown). The low activity levels in the leaf extracts was expected as the main location of the enzyme was the trichome cells whose contribution of cell proteins represent less than 0.01% of the entire pool of leaf proteins. In an attempt to detect the AGN13.1 protein, trichomes were isolated from several transgenic lines using a chemical treatment previously described by Zhang and Oppenheimer (2004) and trichome protein extracts were prepared for immunoprecipitation. Polyclonal antibodies raised against the purified AGN13.1 protein (Ait-Lahsen et al., 2001) were able to immunoprecipitate a single protein with the estimated molecular weight of AGN13.1 from trichome extracts prepared from transgenic leaves, whereas no AGN13.1 protein band was observed in a wild-type extract (Fig. 4B). Curiously, the line AGN13-18 that showed the highest resistance to fungus attack (see below) displayed the most intense AGN13.1 protein band. Leaves of the ATP-AGN13 transgenic lines were challenged with spores of B. cinerea and their susceptibility to disease was then quantified. Brown chlorotic lesions smaller than 3 mm in diameter were distinguished, as well as brown necrotic and chlorotic lesions greater than 3 mm, often expanded over the whole leaf. Both these types of lesion were quantified as positive leaf infections and the HR-like lesions were counted with the non-infections (Fig. 5A). All six transgenic lines displayed a lower susceptibility to a B. cinerea infection than the wild-type plants, both in the needle-wounded and the sprayed assays. Statistically significant differences when compared with wild type were observed for lines AGN13-18, -21, -26, and -44. The most significant results seen were from the line AGN13-18; up to 20% fewer total leaf infections were observed. It was apparent that disease severity was significantly inhibited in the transgenic lines compared with the wild type.
|
To assess the growth of B. cinerea in the leaves of the transgenic lines, fungal biomass was determined by qPCR as previously described. Fungal growth was inhibited in all transgenic lines when compared with wild type. Fungal accumulation was significantly inhibited in lines AGN13-8, AGN13-18, AGN13-26, and AGN13-31 by up to 60% compared with wild type (Fig. 5B). Lines AGN13-21 and AGN13-44 also showed less content of fungal biomass, but the data were not statistically significant due to the high standard deviations.
Although the expression of the agn13.1 gene in trichomes clearly decreases fungal infection and growth within the plant, these effects may also be due, in part, to a constitutive induction of the plant defence machinery as a consequence of the expression of the transgene. To determine this, the expression of the pr1 and pdf1.2 genes in the transgenic ATP-AGN13 lines were quantified by RT-PCR. PR1 is a pathogenesis-related protein whose gene (pr1) expression is regulated by salicylic acid (SA) and is used as a reporter for SA-dependent defence mechanisms. Similarly, the plant defensin1.2 (pdf1.2) gene, encoding a pathogenesis-related protein, is regulated by ethylene and jasmonic acid (JA) and is used as a reporter of JA-dependent defence responses (Traw and Bergelson, 2003). Wild-type plants were also sprayed with SA or JA, or challenged with B. cinerea as positive controls of pr1 or pdf1.2 expression. The analysis by RT-PCR revealed that the transgenic lines as well as the wild type do not constitutively express the pr1 or pdf1.2 genes as was observed in the positive controls. Thus, the SA- or JA-dependent defence responses are not activated in the ATP-AGN13 transgenic lines (Fig. 6).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary dataReferences |
|---|
Decreased trichome number in Arabidopsis enhance tolerance against the necrotrophic fungus Botrytis cinerea
A plant's defence against a pathogen attack involves a complex process with many local and systemic responses, including the production of antimicrobial metabolites and pathogenesis-related proteins. These defence mechanisms against viral, bacterial, and fungal infections are so sophisticated that plant diseases rarely occur. However, a successful infection of the phyllosphere by bacteria and fungi is influenced by climatological and environmental factors such as moisture, light, temperature, or nutrient availability (Duggar, 2002; Lindow and Brandl, 2003; Yuste, 1999). The internal anatomy and surface features of the leaves also determine plant resistance towards insect herbivores, and there is an opposite correlation between trichome density and insect feeding (Mauricio and Rausher, 1997; Peeters, 2002). Although these factors have been widely studied in insect–plant interaction, the anatomical properties of the host have rarely been studied in relation to fungal infections. However, adhesion of the fungal spore to the host surface is the first step of pathogenesis and is therefore critical in determining a successful infection (Vidhyasekaran, 2004).
In the current study, it was found that trichome density on the leaf surface affects foliar fungal infections, trichomes facilitating the adhesion of the fungal spores/hyphae to the leaf surface. A decrease in trichome number in the hairless Arabidopsis mutant gl1 enhanced the tolerance against the necrotrophic fungus Botrytis cinerea. By contrast, the trichome over-producer try mutant showed an increased susceptibility to fungal infection and accumulation. Therefore, an opposite correlation between trichome number and leaf infection was clearly observed. This conclusion was reached from two different experimental approaches to evaluate plant susceptibility. In the needle-wound test, drops of spore suspension were layered over needle-prick wounds made on the leaves to facilitate the infection on damaged tissue. Therefore, trichome number should not contribute to the initial step of the infection but rather to the spreading of the hyphae throughout the leaf surface. However, in the spray test, since no damage was produced on the leaves, the effect of trichome number on spore retention and initial establishment of the infection can also be determined. The gl1 mutant was less susceptible than the wild type to fungal infection based on both inoculation tests; however, as expected, the differences were less significant if fungal spores were placed on damaged portions of the leaves.
The fact that the observed effect is general to other phytopathogens, such as R. solani that penetrates the plant through the roots, was excluded. In this case, no difference was observed in the susceptibility of the wild type and the trichome mutant lines to be infected by the pathogen. Besides, it was possible to observe microscopically the progression of the fungal hyphae on the surface of the leaves through the attachment to the trichomes. In apple trees, varieties with trichome-rich leaves show more fungal spores and pollen on leaf surfaces as well as an increased density of predatory mites that use them as an alternative food supply (Chamberlain, 1975; Kunkel and Brooks, 2002).
Thus, it seems clear that phyllosphere properties influence the retention of fungal spores but also determine the survival, attachment, and penetration of the hyphae. There is documentation that fungal proteins named hydrophobins are essential for attachment of the hyphae to hydrophobic surfaces and the development of appressoria of fungi (Wosten, 2001). Trichome surfaces are covered by a highly hydrophobic and thick cuticular layer involved in water impermeability and protection against physical damage (Aharoni et al., 2004). After a few days of spore application, skeins of hyphae that developed around the trichomes were observed, suggesting that they are excellent counterparts for recognition and attachment of fungal hydrophobins. The presence of trichomes on the leaf surface should therefore determine the attachment of the spores and further development of the hyphae. These results clearly correlate the presence of trichomes with an enhanced susceptibility to B. cinerea, probably due to a greater attachment of the fungal spores/hyphae in the leaf. Further, trichomes apparently retain water on the plant surface and provide nutrients for microbial growth (Lindow and Brandl, 2003; Monier and Lindow, 2003). Therefore, in addition to the attachment of the spores, trichome structures may also provide a protected microenvironment for fungal growth.
Transcriptional profile analysis of the gl1 mutant indicated very little change in gene expression; 18 genes were up-regulated and 17 genes were down-regulated. Three of the activated genes coded for a putative resistance protein that functions quite upstream of the defence activation signalling pathway. However, this analysis excludes the possibility that mutations in the gl1 locus activate the pathogen defence response of the plant since activation of the pathogenesis-related genes (Kunkel and Brooks, 2002) could not be detected. In addition, changes have not been detected in the transcript profile of genes involved in cell wall biosynthesis or phenotypic changes in the surface of the leaf. Therefore, it is unlikely that the observed effect of enhanced fungal tolerance can be due to pleiotropic changes in the gl1 mutant.
Engineering tolerance by expressing an -1,3-glucanase gene in trichomes
If trichomes are one of the preferential ports for plant colonization by fungi, it can be predicted that targeting antifungal agents in trichomes must inhibit or at least decrease fungal infection. This hypothesis is supported by the results obtained by targeting proteins with anti-fungal activity in the trichomes. The Trichoderma -1,3-glucanase protein, AGN13.1, is considered a cell wall-degrading enzyme that binds and hydrolyses cell walls of various phytopathogenic fungi, including B. cinerea. The lytic activity of this enzyme has anti-fungal effects through the inhibition of hyphal growth and spore germination (Ait-Lahsen et al., 2001). By using the ATP promoter that confers high expression levels in trichome cells, the agn13.1 gene was expressed in Arabidopsis, as demonstrated by RT-PCR and enzyme activity measurements taken from crude extracts. Moreover, the AGN13.1 protein was localized in the trichomes of the over-expressing lines, demonstrating the proper function of the promoter. The overexpression of the agn13.1 gene in trichomes increased the resistance of the plant to infection by B. cinerea and inhibited the accumulation of the fungal pathogen in leaf tissues. This effect is due to a direct contact between the fungus and the -1,3-glucanase enzyme and not to the activation of the systemic resistance after plant transformation since pr1 and pdf1.2 gene transcripts are not present in the transgenic lines grown under standard conditions.
Similar approaches have been used previously by expressing the Trichoderma ThEn-42 gene under control of the cauliflower mosaic virus 35S subunit (CaMV 35S) promoter. The constitutive expression of the endochitinase-encoded gene in tobacco and potato confers resistance to several pathogens such as Alternaria alternata, A. solani, B. cinerea, and R. solani (Lorito et al., 1998). Therefore, the isolation of genes from the bio-control agent T. harzianum, coding for anti-fungal proteins and their further transfer to a plant genome, can result in a significant improvement in plant defence against fungal pathogens. In addition, trichome overexpression of these genes is enough to confer an increased resistance, and therefore, it is possible to avoid gene expression in edible parts (fruits) or other tissues suitable for airborne spread, such as pollen or seeds.
From the results obtained, it can be concluded that trichomes should affect fungal infection through the attachment of the fungal spore/hyphae to the surface of the trichome. Penetration through the trichome cell can be used for further plant colonization. This last step can be inhibited in our engineered plants by the contact of the hyphae with the antifungal -1,3-glucanase protein targeted to the trichome.
|
Supplementary data |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary dataReferences |
|---|
Supplementary data can be found at JXB online.
|
Acknowledgements |
|---|
This work was funded by grants BIO2000-0270 and BIO2003-0168 from the Spanish Ministry of Science and Technology, a grant from the University of Seville (grant USE-Monte 2000/101) and Junta de Andalucia (grant CVI273). LC is indebted to the MEC and CSIC for fellowship supports. IG is indebted to the European Commission for grant support from the Marie Curie research training programme and Junta de Andalucía for current grant support. We thank Dr Martin Hülskamp, University of Koln (Germany), for kindly provided the try mutant and also thank NewBiotechnics S.A. (Sevilla, Spain) for providing the strains of Botrytis cinerea and Rhizoctonia solani, a plasmid containing the agn13.1 cDNA gene from Trichoderma harzianum, and the rabbit polyclonal antibodies raised against the purified AGN13.1 protein. We also thank Dr Roberto Solano and Dr Gloria García for performing the microarray hybridizations and analysis under the GEFA project funded by MEC (GEN2001-4890-c07-01).
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary dataReferences |
|---|
Ager FJ, Ynsa MD, Domínguez-Solís JR, López-Martín MC, Gotor C, Romero LC. (2003) Nuclear micro-probe analysis of Arabidopsis thaliana leaves. Nuclear Instruments and Methods in Physics Research B 210:401–406.[CrossRef]
Aharoni A, Dixit S, Jetter R, Thoenes E, van Arkel G, Pereira A. (2004) The SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis. The Plant Cell 16:2463–2480.
Ait-Lahsen H, Soler A, Rey M, de la Cruz J, Monte E, Llobell A. (2001) An antifungal exo--1,3-glucanase (AGN13.1) from the bicontrol fungus Trichoderma harzianum. Applied and Environmental Microbiology 67:5833–5839.
Brouwer M, Lievens B, van Hemelrijck W, van den Ackerveken G, Cammue BPA, Thomma BPHJ. (2003) Quantification of disease progression of several microbial pathogens on Arabidopsis thaliana using real-time fluorescence PCR. FEMS Microbiology Letters 228:241–248.[CrossRef][ISI][Medline]
Chamberlain AC. (1975) The movement of plant particles in plant communities. In Monteith JL (Ed.). Vegetation and the atmosphere(Academic Press, New York) pp. 155–204.
Clough SJ and Bent AF. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant Journal 16:735–743.[CrossRef][ISI][Medline]
Domínguez-Solís JR, Gutiérrez-Alcalá G, Vega JM, Romero LC, Gotor C. (2001) Cytosolic O-acetylserine(thiol)lyase is regulated by heavy metals and can function in cadmium tolerance. Journal of Biological Chemistry 276:9297–9302.
Domínguez-Solís JR, López-Martín MC, Ager FJ, Ynsa MD, Romero LC, Gotor C. (2004) Increased cysteine availability is essential for cadmium tolerance and accumulation in Arabidopsis thaliana. Plant Biotechnology Journal 2:469–476.[CrossRef][Medline]
Duggar BM. (2002) Fungus diseases of plants(Agrobios, Jodhpur (India)).
Eisner T, Eisner M, Hoebeke ER. (1998) When defense backfires: detrimental effect of a plant's protective trichomes on an insect beneficial to the plant. Proceedings of the National Academy of Sciences, USA 95:4410–4414.
Gotor C, Cejudo FJ, Barroso C, Vega JM. (1997) Tissue-specific expression of ATCYS-3A, a gene encoding the cytosolic isoforms of O-acetylserine(thiol)lyase in Arabidopsis thaliana. The Plant Journal 11:347–352.[CrossRef][ISI][Medline]
Gotor C, Domínguez-Solís JR, Gutiérrez-Alcalá G, López-Martín MC, Calo L, Romero LC. (2003) Heavy metal regulation of cysteine biosynthesis and sulfur metabolism related to stress in Arabidopsis trichomes. In Davidian JC, Grill D, De Kok LJ, Stulen I, Hawkesford MJ, Schnug E, Rennenberg H (Eds.). Sulfur transport and assimilation in plants: regulation, interaction, signaling(Backhuys Publishers, Leiden) pp. 91–99.
Gutiérrez-Alcalá G, Calo L, Gros F, Caissard J-C, Gotor C, Romero LC. (2005) A versatile promoter for the expression of proteins in glandular and non-glandular trichomes from a variety of plants. Journal of Experimental Botany 56:2487–2494.
Gutiérrez-Alcalá G, Gotor C, Meyer AJ, Fricker M, Vega JM, Romero LC. (2000) Glutathione biosynthesis in Arabidopsis trichome cells. Proceedings of the National Academy of Sciences, USA 97:11108–11113.
Hülskamp M, Miséra S, Jürgens G. (1994) Genetic dissection of trichome cell development in Arabidopsis. Cell 76:555–566.[CrossRef][ISI][Medline]
Hülskamp M and Kirik V. (2000) Trichome differentiation and morphogenesis in Arabidopsis. In Hallahan DL and Gray JC (Eds.). Advances in botanical research(Academic Press, New York) Vol. 31: pp. 37–75.[CrossRef]
Kunkel BN and Brooks DM. (2002) Cross talk between signalling pathways in pathogen defense. Current Opinion in Plant Biology 5:325–331.[CrossRef][ISI][Medline]
Lindow SE and Brandl MT. (2003) Microbiology of the phyllosphere. Applied and Environmental Microbiology 69:1875–1883.
Lorito M, Woo SL, García I, et al. (1998) Genes from mycoparasitic fungi as a source for improving plant resistance to fungal pathogens. Proceedings of the National Academy of Sciences, USA 95:12734–12739.
Mauricio R and Rausher MD. (1997) Experimental manipulation of putative selective agents provides evidence for the role of natural enemies in the evolution of plant defense. Evolution 51:1435–1444.[CrossRef]
Monier J-M and Lindow SE. (2003) Differential survival of solitary and aggregated bacteria cells promotes aggregate formation on leaf surfaces. Proceedings of the National Academy of Sciences, USA 100:15977–15982.
Papavizas GC. (1985) Trichoderma and Gliocadium: biology, ecology and potential for biocontrol. Annual Review of Phytopathology 23:23–54.[CrossRef][ISI]
Peeters PJ. (2002) Correlation between leaf structural traits and the densities of hervivorous insect guilds. Biological Journal of the Linnean Society 77:43–65.
Pfaffl MW. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acid Research 29:2002–2007.
Quackenbush J. (2002) Microarray data normalization and transformation. Nature Genetics 32:(Supplement), 496–501.[CrossRef][ISI][Medline]
Robert G, Quivey JR, Kriger PS. (1993) Raffinose-induced mutanase production from Trichoderma harzianum. FEMS Microbiology Letters 112:307–312.[CrossRef][ISI][Medline]
Roda A, Nyrop J, English-Loeb G. (2003) Leaf pubescence mediates the abundance of non-prey food and the density of the predatory mite Typhlodromus pyri. Experimental and Applied Acarology 29:193–211.[CrossRef][ISI][Medline]
Smyth GH, Yang YH, Speed TP. (2002) Statistical issues in cDNA microarray data analysis. In Brownstein MJ and Khodursky AB (Eds.). Functional genomics: methods and protocols. Methods in Molecular Biology Series(Humana Press, Totowa, NJ).
Specht CA, DiRusso CC, Novotny CP, Ullrich RC. (1982) A method for extracting high-molecular-weight deoxyribonucleic acid from fungi. Analytical Biochemistry 119:158–163.[CrossRef][ISI][Medline]
Thimm O, Blasing O, Gibon Y, Nagel A, Meyer S, Kruger P, Selbig J, Muller LA, Rhee SY, Stitt M. (2004) MAPMAN: a user-driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes. The Plant Journal 37:914–939.[CrossRef][ISI][Medline]
Traw MB and Bergelson J. (2003) Interactive effects of jasmonic acid, salicylic acid and gibberellin on induction of trichomes in Arabidopsis. Plant Physiology 133:1367–1375.
Tudzynski B, Liu S, Kelly JM. (2000) Carbon catabolite repression in plant pathogenic fungi: isolation and characterization of the Gibberella fujikuroi and Botrytis cinerea creA genes. FEMS Microbiology Letters 184:9–15.[CrossRef][ISI][Medline]
Van Wees SCM, Chang H-S, Zhu T, Glazebrook J. (2003) Characterization of the early response of Arabidopsis to Alternaria brassicicola infection using expression profiling. Plant Physiology 132:606–617.
Vidhyasekaran P. (2004) Concise encyclopedia of plant pathology(The Haworth Press, Binghamton, NY).
Walker AR, Davison PA, Bolognesi-Winfield AC, James CM, Srinivasan N, Blundell TL, Esch JJ, Marks MD, Gray JC. (1999) The transparent testa glabra1 locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein. The Plant Cell 11:1337–1350.
Werker E. (2000) Trichome diversity and development. In Hallahan DL and Gray JC (Eds.). Advances in botanical research(Academic Press, New York) Vol.31: pp. 37–75.[CrossRef]
Wosten HAB. (2001) Hydrophobins: multipurpose proteins. Annual Review of Microbiology 55:625–646.[CrossRef][ISI][Medline]
Yuste MP. (1999) Handbook of Agriculture(Marcel Dekker, New York).
Zhang X and Oppenheimer DG. (2004) A simple and efficient method for isolating trichomes for downstream analyses. Plant Cell Physiology 45:221–224.
CiteULike 
Connotea 
Del.icio.us What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||