Skip Navigation


JXB Advance Access originally published online on January 12, 2006
Journal of Experimental Botany 2006 57(3):581-588; doi:10.1093/jxb/erj045
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
57/3/581    most recent
erj045v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Correa-Aragunde, N.
Right arrow Articles by Lamattina, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Correa-Aragunde, N.
Right arrow Articles by Lamattina, L.
Agricola
Right arrow Articles by Correa-Aragunde, N.
Right arrow Articles by Lamattina, L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2006]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

RESEARCH PAPER

Nitric oxide modulates the expression of cell cycle regulatory genes during lateral root formation in tomato

Natalia Correa-Aragunde1, Magdalena Graziano1, Christian Chevalier2 and Lorenzo Lamattina1,*

1Instituto de Investigaciones Biológicas, Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Mar del Plata, CC 1245, 7600 Mar del Plata, Argentina
2Unité Mixte de Recherche 0619 en Physiologie et Biotechnologie Végétales (Institut National de la Recherche Agronomique et Universités de Bordeaux 1 et Victor Segalen-Bordeaux 2) Centre de Recherche INRA de Bordeaux, BP81, 33883 Villenave d'Ornon, cedex, France

* To whom correspondence should be addressed. E-mail: lolama{at}mdp.edu.ar

Received 30 October 2005; Accepted 1 November 2005


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Nitric oxide (NO) is a bioactive molecule involved in diverse physiological functions in plants. It has previously been reported that the NO donor sodium nitroprusside (SNP) applied to germinated tomato seeds was able to induce lateral root (LR) formation in the same way that auxin treatment does. In this paper, it is shown that NO modulates the expression of cell cycle regulatory genes in tomato pericycle cells and leads, in turn, to induced LR formation. The addition of the NO scavenger CPTIO at different time points during auxin-mediated LR development indicates that NO is required for LR primordia formation and not for LR emergence. The SNP-mediated LR promotion could be prevented by the cell cycle inhibitor olomoucine, suggesting that NO is involved in cell cycle regulation. A system was developed in which the formation of LRs was synchronized. It was based on the control of NO availability in roots by treatment with the NO scavenger CPTIO. The expression of the cell cycle regulatory genes encoding CYCA2;1, CYCA3;1, CYCD3;1, CDKA1, and the Kip-Related Protein KRP2 was studied using RT-PCR analysis in roots with synchronized and non-synchronized LR formation. NO mediates the induction of the CYCD3;1 gene and the repression of the CDK inhibitor KRP2 gene at the beginning of LR primordia formation. In addition, auxin-dependent cell cycle gene regulation was dependent on NO.

Key words: Auxin, cell cycle, cyclin, Cyclin Dependent Kinase, lateral root, nitric oxide


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Development throughout the life cycle of a plant relies on the activity of meristems laid down during embryogenesis and the continuous production of new meristems. This ongoing development is generally considered to be an adaptation to the sedentary lifestyle of plants since they cannot move to more suitable environments (Leyser and Fitter, 1998Go). The discovery of the signal molecules that initiate and direct organogenesis and developmental patterning in plants remains a major goal for plant biologists. Lateral root (LR) formation is a good model to study the molecular mechanisms involved in plant organogenesis.

LRs are mainly responsible for providing water and nutrients that the plant requires from the soil. LR placement is not determined but is strongly influenced by the physiological state of the plant and the prevailing environmental conditions. Thus, the initiation of LRs is a fascinating developmental process, since it involves the post-embryonic production of an entire organ from a small number of differentiated cells in response to intrinsic and environmental cues (Malamy, 2005Go). LR formation occurs in the pericycle cells, in which individual quiescent cells are stimulated to dedifferentiate and proliferate to form an LR primordium. Finally, cells in the LR primordium differentiate and elongate causing the LR to emerge through the epidermis. LR emergence appears to be due to expansion of existing cells rather than cell division (Malamy and Benfey, 1997Go).

Strong evidence supports a central role for the plant hormone auxin in LR initiation. Auxin transported from the shoot is necessary for LR formation in seedlings (Reed et al., 1998Go; Casimiro et al., 2001Go; Bhalerao et al., 2002Go). In addition, the number of LRs is impaired in mutants that have altered auxin metabolism (Boerjan et al., 1995Go; Celenza et al., 1995Go; King et al., 1995Go), transport (Marchant et al., 2002Go), or signalling (Hobbie and Estelle, 1995Go). It has been extensively reported that auxin promotes LR initiation through the expression of cell cycle regulatory genes like cyclins and Cyclin Dependent Kinases (CDK) in the pericycle cells (reviewed in Casimiro et al., 2003Go; Malamy, 2005Go). In higher eukaryotes, the association of CYCD and CDKA produces an active protein kinase that phosphorylates the retinoblastoma (Rb) protein at the G1-to-S phase transition. This phosphorylation results in an inactivation of Rb and the subsequent release of E2F transcription factor, which is responsible for the transcription of the S-phase genes (Nakagami et al., 2002Go). Conversely, Kip-Related Proteins (KRPs), which are specific inhibitors of CDK activity (De Veylder et al., 2001Go), prevent the G1-to-S phase transition (Jasinski et al., 2002Go; Schnittger et al., 2003Go). In the next checkpoint, namely at the G2-to-M transition, B-type CDKs and cyclins A and B are involved (Reichheld et al., 1996Go; Segers et al., 1996Go; Joubès et al., 2000aGo; Weingartner et al., 2003Go). Although many auxin targets during root growth and development were identified, like CDKA;1 and mitotic cyclins (Hemerly et al., 1993Go; Ferreira et al., 1994Go; Doerner et al., 1996Go; Himanen et al., 2002Go) the intermediate molecules involved in the auxin signal transduction pathway remains poorly understood.

Nitric oxide (NO) is a diffusible second messenger whose physiological functions were first described in mammals and then in the plant kingdom, even though its presence was first reported in plants (Klepper, 1979Go). Novel and diverse roles are being attributed to this molecule in plants ranging from pathogen defence and growth and developmental processes to stress tolerance (reviewed in Lamattina et al., 2003Go; Neill et al., 2003Go). Recently, it was demonstrated that NO is involved in the auxin signalling cascade during root growth and development including adventitious root development (Pagnussat et al., 2002Go) and LR formation (Correa-Aragunde et al., 2004Go). NO was also shown to participate in the induction of LRs mediated by the plant-growth-promoting rhizobacterium Azospirillum (Creus et al., 2005Go). In this report, the analysis of NO-regulated mechanisms leading to LR promotion is expanded. Evidence is presented that supports the NO modulation of cell cycle regulatory genes involved in G1-to-S phase transition in tomato roots during LR initiation.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Plant material and growth conditions
Tomato (Solanum lycopersicum Mill. cv. Ace 55) seeds were surface-sterilized in 5% sodium hypochlorite for 10 min, rinsed extensively, and imbibed in water for 3 d. Seedlings with radicles 2–3 mm long were transferred to Petri dishes containing a filter paper soaked with different compounds and grown in a chamber at 25±1 °C and at 14/10 h (light/dark) photoperiod. LR primordia were observed after 3 d of treatment by root squash preparations and quantified by bright-field microscopy. LR number was quantified after 5 d of treatment.

Chemicals
Sodium nitroprusside (SNP), 1-naphthylacetic acid (NAA) and olomoucine were from Sigma (St Louis, MO, USA), N-1-naphthylphthalamic acid (NPA) from Chemical Services (West Chester, PA, USA) and 2-(4-carboxyphenyl)-4, 4, 5, 5-tetramethylimidazoline-1-oxyl-3-oxide potassium salt (CPTIO) from Molecular Probes (Eugene, OR, USA). Concentrations used were 200 µM SNP, 0.1 and 10 µM NAA, 5 µM NPA, 50 µM olomoucine, and 1 mM CPTIO.

Semi-quantitative RT-PCR analysis
Endogenous transcript levels of a set of cell cycle regulatory genes were analysed by semi-quantitative RT-PCR. The root apical meristems of the seedlings were cut off and the shoots were removed by cutting below the root–shoot junction in order to obtain RNA samples of only lateral root-inducible segments. Total RNA was extracted with Trizol reagent (Invitrogen, Gaithersburg, MD) and treated with DNAse I (Promega, Madison, WI). One µg of total RNA was used for reverse transcription with an oligo dT primer and M-MLV reverse transcriptase (Promega) in a reaction volume of 20 µl. PCR reactions were performed using 2 µl of a 5-fold dilution of the cDNA, 10 pmol of each oligonucleotide primer and 1 U of Taq polymerase (Invitrogen) in a 20 µl reaction volume. To verify the exponential phase of PCR amplification, a different number of amplification cycles ranging from 20 to 35 was tested for each gene. The oligonucleotide primers of CYCA2;1 (accession number AJ243452), CYCA3;1 (accession number AJ243453), CYCD3;1 (accession number AJ245415), and CDKA1 (accession number Y17225) were as described in Joubès et al. (2000b)Go. KRP2 (accession number AJ441250) oligonucleotide primers used were: forward CCCTCACTGCCCTCTGCTTCTG and reverse CAATTTCATCAGCCCCACCAGC (amplifying a 450 bp fragment) and actin (accession number BT012695) forward AAGAGCTATGAGCTCCCAGATGG and reverse TTAATCTTCATGCTGCTAGGAGC (amplifying a 272 bp fragment). After 30 PCR cycles for the cell cycle genes and 25 cycles for actin with a primer annealing temperature of 50 °C, 10 µl samples of the PCR reaction products were loaded on a 1% (w/v) agarose gel, transferred to Nylon membranes and hybridized with CYCA2;1, CYCA3;1, CYCD3;1, CDKA1, KRP2, and actin 32P-radiolabelled cDNA probes. Several expositions of the autoradiographs were done to obtain correct signals for densitometric analysis when indicated. Photographs of the autogradiographs are representative of at least three independent experiments.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Nitric oxide is involved in the formation of lateral root primordia in tomato
It has previously been reported that NO increases LR number in tomato and that there is a high NO concentration within the growing LR primordium (Correa-Aragunde et al., 2004Go). Since growth is determined by both cell division and elongation, NO may be involved either in inducing dedifferentiation and division in pericycle cells or in increasing the elongation rate of cells in LR primordia. To clarify the mechanism through which NO induces LR number in tomato, the formation of LR primordia was first analysed in roots treated with the NO donor sodium nitroprusside (SNP) for 3 d. SNP applied to germinated tomato seeds was able to mimic the effect of the synthetic auxin 1-naphthylacetic acid (NAA) in inducing LR primordia formation (Fig. 1A). This result correlates with the number of LRs observed after 5 d of treatment (Correa-Aragunde et al., 2004Go). Microscopical analysis showed that NO- and NAA-induced LR primordia presented a similar anatomic structure (Fig. 1B). The effect achieved by SNP was prevented by the specific NO scavenger 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (CPTIO) indicating that the induction of LR primordia is due to an NO release from SNP (Fig. 1A). CPTIO applied alone drastically reduced the number of LR primordia compared with the control treatment (Fig. 1A). Microscopical analysis shows that CPTIO might block primordia formation at a very early stage of development since arrested primordia could not be detected. In NAA-treated seedlings, primordia formation was also inhibited by CPTIO suggesting that endogenous NO is involved in the LR primordia formation triggered by NAA (Fig. 1A). Himanen et al. (2002)Go developed a synchronized LR-inducible system in Arabidopsis, which consists of a treatment with the auxin transport inhibitor naphthylphthalamic acid (NPA). The treatment with NPA prevents the endogenous auxin-mediated induction of LR formation. Then, the shift to a medium containing auxin triggers a synchronized activation of pericycle cells. The inhibitory effect of CPTIO on auxin-induced LR formation led to the hypothesis that the control of the endogenous NO availability may synchronize the initiation of LRs. Thus, tomato seeds were incubated in the presence of CPTIO for 2 d to prevent LR primordia formation and subsequently incubated in the presence of NAA or SNP to induce pericycle activation. LR primordia formation was triggered when the seedlings were shifted to SNP or NAA after 2 d of CPTIO treatment (Fig. 1A).


Figure 1
View larger version (52K):
[in this window]
[in a new window]
 
Fig. 1. Nitric oxide-mediated induction of lateral root (LR) primordia. (A) Germinated tomato seeds were incubated with water (control), 0.1 µM of the auxin 1-naphthylacetic acid (NAA) or 200 µM of the NO donor sodium nitroprusside (SNP) in the absence (black bars) or the presence (grey bars) of 1 mM of the NO scavenger CPTIO for 3 d. In an another set of experiments, seedlings incubated in 1 mM CPTIO for 2 d were shifted to water, 0.1 µM NAA or 200 µM SNP for another 3 d (shaded bars). LR primordia were observed by root squash preparations and quantified by bright-field microscopy. Means and SE were calculated from three independent experiments (n=5). Different letters indicate a significant difference at P <0.05 (t-test). (B) Photographs showing the LR primordia morphology in seedlings incubated in water, SNP or NAA. Bar: 200 µM.

 
Nitric oxide is required in the early stages of lateral root primordia formation
In order to assess the NO requirement during the formation and/or elongation of the auxin-mediated LR development further, tomato seedlings were incubated for 5 d in the presence of NAA, and CPTIO was added after 0, 1, 2, 3, or 4 d of the NAA treatment. Figure 2A shows that CPTIO when added at 0, 1 or 2 d of the NAA treatment produced a significant reduction (up to 5-fold) of LR formation. By contrast, only a slight effect could be observed in response to the addition of CPTIO after 3 or 4 d of the NAA treatment. Thus, the events in which NO might participate occur within the first 2 d of NAA treatment. These findings might suggest that NO is required for cell cycle progression and establishment of LR primordia in the pericycle and that NO would not be necessary for the elongation and emergence of LRs. According to this, the addition of the cell cycle inhibitor olomoucine to SNP-treated seedlings at different time points resulted in a similar response (Fig. 2B). However, a limited response was observed with olomoucine. Olomoucine has been reported to induce cell cycle arrest at G1 phase by inhibiting CDKA activity in Petunia and Arabidopsis cell suspensions (Glab et al., 1994Go). Similar results were also obtained with the cell cycle inhibitors apigenin and roscovitine (data not shown).


Figure 2
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. Nitric oxide is required during the early events that trigger LR formation. (A) Germinated tomato seeds were incubated in 0.1 µM NAA alone or in the presence of 1 mM of the NO scavenger CPTIO after 0, 1, 2, 3, or 4 d of NAA treatment. LR number was quantified after 5 d of treatment. (B) Germinated tomato seeds were incubated in 200 µM SNP alone or in the presence of 50 µM of the cell cycle inhibitor olomoucine after 0, 1, 2, 3, or 4 d of SNP treatment. Lateral root (LR) number was quantified after 5 d of treatment. Means and SE were calculated from three independent experiments (n=5). Different letters indicate a significant difference at P <0.05 (t-test).

 
Nitric oxide modulates the expression of cell cycle regulatory genes
Based on the results described above, the influence of NO on the expression of cell cycle regulatory genes was analysed. Semi-quantitative RT-PCR analysis was carried out on RNA extracted from tomato roots treated with SNP, NAA, or NAA plus CPTIO for 1, 2, and 3 d. These time points were chosen because LR primordia were observed from the third day of the NAA or SNP treatments (Fig. 1A, B). Figure 3A shows that NAA induced the expression of the CYCA2;1, CYCA3;1, CYCD3;1, and CDKA1 genes after 2 d of treatment. SNP induced the expression of CYCD3;1 and CDKA1 and to a lesser extent CYCA2;1 after 2 d of treatment. The effect of SNP is sustained in time, inducing the expression of CYCA2;1, CYCD3;1 and CDKA up to 3 d. Interestingly, the NAA-induced expression of cell cycle regulatory genes was prevented or delayed when NO was scavenged with CPTIO. In addition, the SNP plus CPTIO treatment prevented the induction of CYCD3;1 (data not shown), indicating that the effect is due to the NO molecule released by the donor. These findings gave preliminary evidence and suggested that endogenous NO could modulate the expression of cell cycle regulatory genes and that it is also required for the NAA-induced effect on these genes. In addition, the effect produced by SNP was more evident for the genes that encode proteins involved in the regulation of the G1-to-S transition phase.


Figure 3
View larger version (76K):
[in this window]
[in a new window]
 
Fig. 3. Expression analysis of cell cycle regulatory genes by RT-PCR. Total RNA was extracted and used for reverse transcription with an oligo dT primer and M-MLV reverse transcriptase. The cDNA was used for semi-quantitative PCR. The PCR reaction products were loaded on an agarose gel, transferred to Nylon membranes and hybridized with specific 32P-radiolabelled cDNA probes. (A) Germinated tomato seeds were incubated in water for 12 h (To) and then shifted to water or 200 µM SNP or 0.1 µM NAA or 0.1 µM NAA plus 1 mM CPTIO for 1, 2, and 3 d. (B) Germinated tomato seeds were incubated for 2 d in 5 µM NPA (To) and then shifted to water or 10 µM NAA or 200 µM SNP for 2 h and 6 h.

 
The lack of synchrony in the initial events leading to LR formation makes it difficult to attribute a more precise role to NO in cell cycle regulation. Therefore, the NPA-dependent synchronization of the pericycle cells developed by Himanen et al. (2002)Go in Arabidopsis was applied to tomato seedlings. The treatment with NPA induces cell cycle arrest in the G1 phase (Himanen et al., 2002Go). It has been proposed that D-type cyclins play a prominent role in the G1-to-S transition and hence have a major role in the commitment to the mitotic cell cycle. In the present study, the expression of CYCD3;1 was chosen for analysis since it was previously reported that the cyclin D3 overexpression in plants resulted in Rb inactivation and a strong increase of E2F levels (Nakagami et al., 2002Go) and because SNP treatment strongly induces CYCD3;1 (Fig. 3A). Semi-quantitative RT-PCR analysis was used in this system to study the effect of NO on the expression of cell cycle regulatory genes during the activation of the synchronized pericycle. The analysis was performed at short periods of activation time (2 h and 6 h) with NAA and SNP because the cell cycle progression was arrested with NPA for the first 2 d of treatment. Figure 3B shows that CYCD3;1 was induced by NAA and SNP after 2 h of treatment. The induction by SNP was lower than that obtained with NAA. Nevertheless, this result indicates that NO is able to induce CYCD3;1 independently of endogenous auxin. The induction of CYCD3;1 by NAA was higher than that observed in Fig. 3A as a result of the use of a higher NAA concentration (10 µM) as reported by Himanen et al. (2002)Go in this system. In contrast with the non-synchronized system, Fig. 3B shows that the level of the CDKA1 transcript was constitutive, indicating that the synchronization of pericycle cells by NPA in tomato behaved similarly to that reported in Arabidopsis (Himanen et al., 2002Go).

According to the results presented in Fig. 1A showing that the effect of the NO scavenger CPTIO is reversible, the expression of cell cycle regulatory genes was analysed in the CPTIO-inducible system. Germinated seeds were treated with CPTIO for 2 d and then shifted to H2O, NAA, or SNP. Figure 4A shows that at To (2 d of CPTIO treatment), there was a low expression of CYCD3;1. Conversely, CYCD3;1 was induced by either NAA or SNP after 4 h of treatment. The transcript level of CDKA1 was constitutively expressed up to 6 h of treatment (Fig. 4A, B). The expression of the tomato CDK inhibitor KRP2 gene was also included in this study. KRP2 expression was high in the inactive pericycle of CPTIO-treated roots (To) and increased when the seedlings were shifted to water. This increase may be due to stress conditions for the roots during the transfer from CPTIO treatment to H2O. Nevertheless, the NAA and SNP treatments inhibited KRP2 expression under the same conditions. KRP2 was strongly down-regulated by SNP and NAA after 2 h and 6 h of treatment, respectively (Fig. 4A, B).


Figure 4
View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4. Expression analysis of cell cycle regulatory genes in CPTIO-synchronized tomato seedlings. (A) Germinated tomato seeds were incubated in 1 mM CPTIO for 2 d (To) and then shifted to water or 0.1 µM NAA or 200 µM SNP for 2, 4, and 6 h. Total RNA was extracted and was used for reverse transcription with an oligo dT primer and M-MLV reverse transcriptase. The cDNA was used for semi-quantitative PCR. The PCR reaction products were loaded on an agarose gel, transferred to Nylon membranes and hybridized with specific 32P-radiolabelled cDNA probes. (B) Quantitative time-course analysis of CYCD3;1, CDKA1, and KRP2 transcript levels. The data were obtained by densitometric analysis of the gel blots corrected for loading differences by using actin transcript levels. The values represent relative transcript levels with respect to To.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Auxin has been known for a long time to be the main plant hormone involved in LR development. It was recently shown that NO is required for the auxin-mediated LR formation (Correa-Aragunde et al., 2004Go). NO is produced in the pericycle cells that will give place to an LR, indicating that NO is required during the early stages of LR development. The data support a lineal signal transduction cascade involving NO downstream of auxins (Correa-Aragunde et al., 2004Go). This communication goes further in the analysis of the NO-regulated mechanisms leading to LR promotion. Results indicate that NO promotes LR initiation in tomato by the modulation of cell cycle regulatory genes during LR primordia formation, but has no effect during LR emergence.

LR formation, as well as several processes associated with developmental patterning and organogenesis, deals with the fate of the spatial and temporal asynchrony of the initiation events. Thus, strategies for the development of synchronized biological systems would help for studying the signals and regulatory pathways governing these processes. Dealing with LR formation, Himanen et al. (2002)Go developed a synchronized system based on the depletion of endogenous auxin in Arabidopsis. This system allowed a detailed histological and molecular analysis of early LR initiation events. Here, an LR-inducible system is reported, based on the control of NO availability in roots by treatment with the NO scavenger CPTIO. It has been seen that the early stages of LR development in tomato are similar to those of Arabidopsis, described by Malamy and Benfey (1997)Go. Based on this analogy, microscopical analysis indicates that the treatment with 1 mM CPTIO blocked primordia formation in a stage below stage III (data not shown). Therefore, a CPTIO-dependent inducible system is proposed as a complementary tool for the study of early events leading to LR development.

In this report, it is shown that NO, as well as auxin, induces the transcription of CYCD3;1 while it keeps CDKA1 transcript levels high, in both NPA- and CPTIO-dependent inducible systems (Figs 3B, 4). NO also induced CYCA2;1 in the non-inducible system (Fig. 3A). CYCD3 is a rate-limiting factor during the G1-to-S phase transition since overexpression of CYCD3 in Arabidopsis or tobacco stimulates cells to exit the G1 phase (Nakagami et al., 2002Go; Dewitte et al., 2003Go). Transcription of D-type cyclins is activated by many extracellular signals and growth regulators such as sugar availability and hormones (auxin, cytokinin, gibberellins, brassinosteroids) (Dewitte and Murray, 2003Go). CYCD3;1 was found to be elevated in Arabidopsis mutants with a high level of cytokinin and to be induced by cytokinin application in both cell cultures and whole plant (Riou-Khamlichi et al., 1999Go). On the other side, the treatment of tobacco BY2 cells with cytokinin induces NO release (Tun et al., 2001Go). Probably, NO is acting in a common signalling cascade downstream of auxin and cytokinin to induce CYCD3;1 gene expression and, consequently, cell cycle activation.

KRPs were reported to be involved in preventing the formation of active CDK/cyclin complexes that regulate the G1-to-S phase transition (Wang et al., 1998Go; Verkest et al., 2005Go). The binding of KRPs to CDK/CYCD complexes might prevent the phosphorylation of Rb, since overproduction of a tobacco KRP protein in Arabidopsis completely complements the phenotype that is obtained by overproduction of CYCD3;1 (Jasinski et al., 2002Go). Moreover, overexpression of a KRP gene in trichomes is able to restore the phenotype induced by CYCD overexpression (Schnittger et al., 2003Go). During LR formation in Arabidopsis, KRP1 and KRP2 genes are down-regulated by NAA. Thus, it was suggested that KRP1 and KRP2 prevent the activity of CDK/cyclin complexes, which regulate the G1-to-S phase transition in the pericycle of Arabidopsis (Himanen et al., 2002Go). The results presented here show that tomato KRP2 behaves similarly to the Arabidopsis KRP genes during LR formation and that it is strongly down-regulated by the presence of not only auxin but also NO in roots.

The results presented in this work suggest that the G1-to-S transition phase could be a target point for the NO-regulated LR initiation. Nevertheless, positive modulation of regulators affecting one phase of the cell cycle may be masked by compensatory changes in another. It was previously argued that it is difficult to distinguish the phase-specific effects of G1 cyclin expression without considering the effects of cyclins in the overall cellular growth (Cooper, 1998Go). In a recent report, Koroleva et al. (2004)Go showed that, in contrast with animal D cyclin, cyclin D1 could promote both G1-to-S phase and G2-to-M phase progression in plants. Schnittger et al. (2002)Go also showed that D-type cyclins could have an additional function at the G2-to-M transition. Therefore, further studies involving specific expression of cyclin and CDK genes at the different cell cycle phases and how they are affected by NO would be necessary to confirm the transition phase(s) that is (are) regulated. In addition, more evidence is needed to confirm that the treatment with CPTIO synchronize pericycle cells in the G0 phase. Flow cytometry analysis is a useful strategy that provides information about the cell cycle, and consequently to study how different stimuli (i.e. drug treatment or transfected genes) affect cell cycle progression. However, flow cytometry measurements cannot be applied in intact roots. The aim was to study the action on cell cycle regulatory genes at the organ level. However, in a very recent report, Otvos et al. (2005)Go showed that NO promotes cell division and embryogenic cell formation in leaf protoplast-derived cells of alfalfa. NO donors were able to stimulate BrdU incorporation in DNA while NO synthase inhibitors diminished it. Additionally, NO was able to activate the somatic embryogenesis marker receptor kinase (SERK) protein, a putative marker of the embryonic capability of alfalfa cells. In cell suspensions, NO transiently induces CYCA2;1 and CYCD3;1 mRNA expression (Otvos et al., 2005Go). This study strongly supports the data presented here. An intriguing point is that while authors found that the effect of NO in protoplasts only occurs in the presence of auxin, the induction of CYCD3;1 by NO in tomato roots (Fig. 3B) as well as LR formation (Correa-Aragunde et al., 2004Go) occur even in the presence of the auxin transport inhibitor NPA. This apparent discrepancy points out that whole plant responses to hormones are probably more complex and do not necessarily reflect those produced in cell culture.

The transcript profile presented in this work allows a simple model to be proposed that involves NO in cell cycle activation during LR initiation. In CPTIO or NPA treatment, pericycle cells display low levels of CYCD3;1 and high levels of the CDK inhibitor KRP2. In these treatments, CDKA1 transcripts remain at high levels indicating that pericycle cells are competent for cell division. When auxin or NO concentrations in roots increase, KRP2 transcript levels drastically decrease accompanied by the accumulation of CYCD3;1, favouring the association with CDKA1 and the progression from G1-to-S phase. This study constitutes the first report that involves the NO-induced activation of the cell cycle in the process leading to LR formation through the modulation of CYCD3;1 and an acute decline of KRP2. However, it should be noteworthy that non-localized or non-specific activation of the cell cycle is not sufficient to induce the formation of LRs. It was reported that overexpression of cyclins leads to an increased growth rate without a differential increase in the initiation of LRs (Doerner et al., 1996Go; Cockcroft et al., 2000Go), probably because its expression is induced in the whole plant. Moreover, LR formation requires the induction of genes involved in root meristem identity. To date, several regulatory genes are known to be required for the development of root meristems (Celenza et al., 1995Go; Xie et al., 2000Go; Aida et al., 2004Go; Hawker and Bowman, 2004Go). Since NO can increase LR number, it suggests that NO is specifically stimulating some pericycle cells triggering cell cycle activation and LR formation. Probably, NO takes part in a signalling cascade downstream of auxin, present in competent pericycle cells, that finally activates cell cycle regulatory genes. In addition, NO should be able to modulate the expression of genes associated with root meristem identity. It will be interesting to explore whether NO is involved in the regulation of those genes and how the target pericycle cells are specified.

Studies on cell cycle transition have been focused in learning about the mechanisms of action of cell cycle regulatory components and understanding how cell proliferation, growth and development are integrated (Gutierrez et al., 2002Go). The results presented in this study open a wide field of research for the role of NO on cell cycle regulation during organogenesis. It will allow going further into a more complete understanding of the components that control plant cell differentiation and proliferation.


    Acknowledgements
 
This work was supported by Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT, PICTs 1-9767/00, and 1-14457/03 to LL), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET, PIP 0898/98 to LL), Fundación Antorchas and institutional grants from Universidad Nacional de Mar del Plata (UNMdP), Argentina. LL is a member of the research staff, NC-A and MG are postgraduate fellows from CONICET, Argentina. LL is a fellow from the JS Guggenheim Foundation.


    Footnotes
 
Abbreviations: CDK, Cyclin Dependent Kinase; CPTIO, 2-(4-carboxyphenyl)-4,4,5,5,-tetramethylimidazoline-1-oxyl-3-oxide; LR, lateral root; NAA, 1-naphthylacetic acid; NO, nitric oxide; NPA, naphthylphthalamic acid; SNP, sodium nitroprusside; KRP, Kip-Related Protein.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Aida M, Beis D, Heidstra R, Willemsen V, Blilou I, Galinha C, Nussaume L, Noh YS, Amasino R, Scheres B. 2004. The PLETHORA genes mediate patterning of the Arabidopsis root stem cell niche. Cell 119, 109–120.[CrossRef][Web of Science][Medline]

Bhalerao RP, Eklof J, Ljung K, Marchant A, Bennett M, Sandberg G. 2002. Shoot-derived auxin is essential for early lateral root emergence in Arabidopsis seedlings. The Plant Journal 29, 325–332.[CrossRef][Web of Science][Medline]

Boerjan W, Cervera MT, Delarue M, Beeckman T, Dewitte W, Bellini C, Caboche M, Van Onckelen H, Van Montagu M, Inzé D. 1995. Superroot, a recessive mutation in Arabidopsis, confers auxin overproduction. The Plant Cell 7, 1405–1419.[Abstract]

Casimiro I, Beeckman T, Graham N, Bhalerao R, Zhang H, Casero P, Sandberg G, Bennett MJ. 2003. Dissecting Arabidopsis lateral root development. Trends in Plant Science 8, 165–171.[CrossRef][Web of Science][Medline]

Casimiro I, Marchant A, Bhalerao RP, et al. 2001. Auxin transport promotes Arabidopsis lateral root initiation. The Plant Cell 13, 843–852.[Abstract/Free Full Text]

Celenza Jr JL, Grisafi PL, Fink GR. 1995. A pathway for lateral root formation in Arabidopsis thaliana. Genes and Development 9, 2131–2142.[Abstract/Free Full Text]

Cockcroft CE, den Boer BG, Healy JM, Murray JA. 2000. Cyclin D control of growth rate in plants. Nature 405, 575–579.[CrossRef][Medline]

Cooper S. 1998. On the interpretation of the shortening of the G1-phase by overexpression of cyclins in mammalian cells. Experimental Cell Research 238, 110–115.[CrossRef][Web of Science][Medline]

Correa-Aragunde N, Graziano M, Lamattina L. 2004. Nitric oxide plays a central role in determining lateral root development in tomato. Planta 218, 900–905.[CrossRef][Web of Science][Medline]

Creus C, Graziano M, Casanovas E, Pereyra M, Simontacchi M, Puntarulo S, Barassi C, Lamattina L. 2005. Nitric oxide is involved in the Azospirillum brasilense-induced lateral root formation in tomato. Planta 221, 297–303.[CrossRef][Web of Science][Medline]

De Veylder L, Beeckman T, Beemster GT, Krols L, Terras F, Landrieu I, van der Schueren E, Maes S, Naudts M, Inzé D. 2001. Functional analysis of cyclin-dependent kinase inhibitors of Arabidopsis. The Plant Cell 13, 1653–1668.[Abstract/Free Full Text]

Dewitte W, Murray JA. 2003. The plant cell cycle. Annual Review of Plant Biolology 54, 235–264.

Dewitte W, Riou-Khamlichi C, Scofield S, Healy JM, Jacqmard A, Kilby NJ, Murray JA. 2003. Altered cell cycle distribution, hyperplasia, and inhibited differentiation in Arabidopsis caused by the D-type cyclin CYCD3. The Plant Cell 15, 79–92.[Abstract/Free Full Text]

Doerner P, Jorgensen JE, You R, Steppuhn J, Lamb C. 1996. Control of root growth and development by cyclin expression. Nature 380, 520–523.[CrossRef][Medline]

Ferreira PC, Hemerly AS, Engler JD, van Montagu M, Engler G, Inzé D. 1994. Developmental expression of the Arabidopsis cyclin gene cyc1At. The Plant Cell 6, 1763–1774.[Abstract/Free Full Text]

Glab N, Labidi B, Qin LX, Trehin C, Bergounioux C, Meijer L. 1994. Olomoucine, an inhibitor of the cdc2/cdk2 kinases activity, blocks plant cells at the G1 to S and G2 to M cell cycle transitions. FEBS Letters 353, 207–211.[CrossRef][Web of Science][Medline]

Gutierrez C, Ramirez-Parra E, Castellano MM, del Pozo JC. 2002. G(1) to S transition: more than a cell cycle engine switch. Current Opinion in Plant Biology 5, 480–486.[CrossRef][Web of Science][Medline]

Hawker NP, Bowman JL. 2004. Roles for Class III HD-Zip and KANADI genes in Arabidopsis root development. Plant Physiology 135, 2261–2270.[Abstract/Free Full Text]

Hemerly AS, Ferreira P, de Almeida Engler J, Van Montagu M, Engler G, Inzé D. 1993. cdc2a expression in Arabidopsis is linked with competence for cell division. The Plant Cell 5, 1711–1723.[Abstract]

Himanen K, Boucheron E, Vanneste S, de Almeida Engler J, Inze D, Beeckman T. 2002. Auxin-mediated cell cycle activation during early lateral root initiation. The Plant Cell 14, 2339–2351.[Abstract/Free Full Text]

Hobbie L, Estelle M. 1995. The axr4 auxin-resistant mutants of Arabidopsis thaliana define a gene important for root gravitropism and lateral root initiation. The Plant Journal 7, 211–220.[CrossRef][Web of Science][Medline]

Jasinski S, Riou-Khamlichi C, Roche O, Perennes C, Bergounioux C, Glab N. 2002. The CDK inhibitor NtKIS1a is involved in plant development, endoreduplication and restores normal development of cyclin D3; 1-overexpressing plants. Journal of Cell Science 115, 973–982.[Abstract/Free Full Text]

Joubès J, Chevalier C, Dudits D, Heberle-Bors E, Inzé D, Umeda M, Renaudin JP. 2000a. CDK-related protein kinases in plants. Plant Molecular Biology 43, 607–620.[CrossRef][Web of Science][Medline]

Joubès J, Walsh D, Raymond P, Chevalier C. 2000b. Molecular characterization of the expression of distinct classes of cyclins during the early development of tomato fruit. Planta 211, 430–439.[CrossRef][Web of Science][Medline]

King J, Stimart D, Fisher R, Bleecker A. 1995. A mutation altering auxin homeostasis and plant morphology in Arabidopsis. The Plant Cell 7, 2023–2037.[Abstract]

Klepper LA. 1979. Nitric oxide (NO) and nitrogen dioxide (NO2) emissions from herbicide-treated soybean plants. Atmospheric Environment 13, 537–542.[CrossRef]

Koroleva OA, Tomlinson M, Parinyapong P, Sakvarelidze L, Leader D, Shaw P, Doonan JH. 2004. CycD1, a putative G1 cyclin from Antirrhinum majus, accelerates the cell cycle in cultured tobacco BY-2 cells by enhancing both G1/S entry and progression through S and G2 phases. The Plant Cell 16, 2364–2379.[Abstract/Free Full Text]

Lamattina L, Garcia-Mata C, Graziano M, Pagnussat G. 2003. Nitric oxide: the versatility of an extensive signal molecule. Annual Review of Plant Biology 54, 109–136.[CrossRef][Medline]

Leyser HM, Fitter AH. 1998. Roots are branching out in patches. Trends in Plant Science 3, 203–204.[CrossRef][Web of Science]

Malamy JE. 2005. Intrinsic and environmental response pathways that regulate root system architecture. Plant, Cell and Environment 28, 67–77.[CrossRef][Medline]

Malamy JE, Benfey PN. 1997. Organization and cell differentiation in lateral roots of Arabidopsis thaliana. Development 124, 33–44.[Abstract]

Marchant A, Bhalerao R, Casimiro I, Eklof J, Casero PJ, Bennett M, Sandberg G. 2002. AUX1 promotes lateral root formation by facilitating indole-3-acetic acid distribution between sink and source tissues in the Arabidopsis seedling. The Plant Cell 14, 589–597.[Abstract/Free Full Text]

Nakagami H, Kawamura K, Sugisaka K, Sekine M, Shinmyo A. 2002. Phosphorylation of retinoblastoma-related protein by the cyclin D/cyclin-dependent kinase complex is activated at the G1/S-phase transition in tobacco. The Plant Cell 14, 1847–1857.[Abstract/Free Full Text]

Neill SJ, Desikan R, Hancock JT. 2003. Nitric oxide signalling in plants. New Phytologist 159, 11–35.[CrossRef][Web of Science]

Otvos K, Pasternak TP, Miskolczi P, Domoki M, Dorjgotov D, Szucs A, Bottka S, Dudits D, Feher A. 2005. Nitric oxide is required for, and promotes auxin-mediated activation of, cell division and embryogenic cell formation but does not influence cell cycle progression in alfalfa cell cultures. The Plant Journal 43, 849–860.[CrossRef][Web of Science][Medline]

Pagnussat GC, Simontacchi M, Puntarulo S, Lamattina L. 2002. Nitric oxide is required for root organogenesis. Plant Physiology 129, 954–956.[Free Full Text]

Reed RC, Brady SR, Muday GK. 1998. Inhibition of auxin movement from the shoot into the root inhibits lateral root development in Arabidopsis. Plant Physiology 118, 1369–1378.[Abstract/Free Full Text]

Reichheld JP, Chaubet N, Shen WH, Renaudin JP, Gigot C. 1996. Multiple A-type cyclins express sequentially during the cell cycle in Nicotiana tabacum BY2 cells. Proceedings of the National Academy of Sciences, USA 93, 13819–13824.[Abstract/Free Full Text]

Riou-Khamlichi C, Huntley R, Jacqmard A, Murray JA. 1999. Cytokinin activation of Arabidopsis cell division through a D-type cyclin. Science 283, 1541–1544.[Abstract/Free Full Text]

Schnittger A, Schobinger U, Bouyer D, Weinl C, Stierhof YD, Hulskamp M. 2002. Ectopic D-type cyclin expression induces not only DNA replication but also cell division in Arabidopsis trichomes. Proceedings of the National Academy of Sciences, USA 99, 6410–6415.[Abstract/Free Full Text]

Schnittger A, Weinl C, Bouyer D, Schobinger U, Hulskamp M. 2003. Misexpression of the cyclin-dependent kinase inhibitor ICK1/KRP1 in single-celled Arabidopsis trichomes reduces endoreduplication and cell size and induces cell death. The Plant Cell 15, 303–315.[Abstract/Free Full Text]

Segers G, Gadisseur I, Bergounioux C, de Almeida Engler J, Jacqmard A, Van Montagu M, Inzé D. 1996. The Arabidopsis cyclin-dependent kinase gene cdc2bAt is preferentially expressed during S and G2 phases of the cell cycle. The Plant Journal 10, 601–612.[CrossRef][Web of Science][Medline]

Tun NN, Holk A, Scherer GF. 2001. Rapid increase of NO release in plant cell cultures induced by cytokinin. FEBS Letters 509, 174–176.[CrossRef][Web of Science][Medline]

Verkest A, Manes CL, Vercruysse S, Maes S, Van Der Schueren E, Beeckman T, Genschik P, Kuiper M, Inzé D, De Veylder L. 2005. The cyclin-dependent kinase inhibitor KRP2 controls the onset of the endoreduplication cycle during Arabidopsis leaf development through inhibition of mitotic CDKA;1 kinase complexes. The Plant Cell 17, 1723–1736.[Abstract/Free Full Text]

Wang H, Qi Q, Schorr P, Cutler AJ, Crosby WL, Fowke LC. 1998. ICK1, a cyclin-dependent protein kinase inhibitor from Arabidopsis thaliana interacts with both Cdc2a and CycD3, and its expression is induced by abscisic acid. The Plant Journal 15, 501–510.[CrossRef][Web of Science][Medline]

Weingartner M, Pelayo HR, Binarova P, Zwerger K, Melikant B, de la Torre C, Heberle-Bors E, Bogre L. 2003. A plant cyclin B2 is degraded early in mitosis and its ectopic expression shortens G2-phase and alleviates the DNA-damage checkpoint. Journal of Cell Science 116, 487–498.[Abstract/Free Full Text]

Xie Q, Frugis G, Colgan D, Chua NH. 2000. Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development. Genes and Development 14, 3024–3036.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Exp BotHome page
A. Kasprowicz, A. Szuba, D. Volkmann, F. Baluska, and P. Wojtaszek
Nitric oxide modulates dynamic actin cytoskeleton and vesicle trafficking in a cell type-specific manner in root apices
J. Exp. Bot., April 1, 2009; 60(6): 1605 - 1617.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
K. Guo, K. Xia, and Z.-M. Yang
Regulation of tomato lateral root development by carbon monoxide and involvement in auxin and nitric oxide
J. Exp. Bot., September 1, 2008; 59(12): 3443 - 3452.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
T. Flores, C. D. Todd, A. Tovar-Mendez, P. K. Dhanoa, N. Correa-Aragunde, M. E. Hoyos, D. M. Brownfield, R. T. Mullen, L. Lamattina, and J. C. Polacco
Arginase-Negative Mutants of Arabidopsis Exhibit Increased Nitric Oxide Signaling in Root Development
Plant Physiology, August 1, 2008; 147(4): 1936 - 1946.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Laxalt, N. Raho, A. t. Have, and L. Lamattina
Nitric Oxide Is Critical for Inducing Phosphatidic Acid Accumulation in Xylanase-elicited Tomato Cells
J. Biol. Chem., July 20, 2007; 282(29): 21160 - 21168.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
57/3/581    most recent
erj045v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Correa-Aragunde, N.
Right arrow Articles by Lamattina, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Correa-Aragunde, N.
Right arrow Articles by Lamattina, L.
Agricola
Right arrow Articles by Correa-Aragunde, N.
Right arrow Articles by Lamattina, L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?