JXB Advance Access originally published online on January 12, 2006
Journal of Experimental Botany 2006 57(3):589-598; doi:10.1093/jxb/erj043
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH PAPER |
PpEG4 is a peach endo-ß-1,4-glucanase gene whose expression in climacteric peaches does not follow a climacteric pattern*
Department of Biology, University of Padua, Via G. Colombo 3, I-35121 Padova, Italy
To whom correspondence should be addressed. E-mail: livio.trainotti{at}unipd.it
Received 27 June 2005; Accepted 2 November 2005
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
In peach (Prunus persica L. Batsch.) the degradation of the pectic compounds of the cell wall is considered to be the principal component responsible for fruit softening. Many genes encoding enzymes acting on the different polymers of the pectic matrix have been shown to be highly expressed during the late phases of softening, with polygalacturonase being the most important. Nevertheless, it is known that softening starts well before the ethylene climacteric rise which occurs concomitant with the maximal expression of the pectolytic enzymes. The cloning and characterization of PpEG4, an endo-ß-1,4-glucanase (EGase) gene preferentially expressed in preclimacteric fruits, are presented here. PpEG4 belongs to the group of EGases containing, at their carboxy-terminus, a peptide similar to the cellulose binding domain of microbial origin. This EGase is also expressed during abscission of both leaves and fruits. The effect of exogenous ethylene treatments on PpEG4 transcription is null in young fruits and negative in preclimacteric ones, while it is positive in abscission zones. Thus, the expression of PpEG4 seems to be more dependent on the type of separation process rather than being influenced by a direct hormone action. The ability of the PpEG4 regulatory sequences to drive transcription in cells undergoing separation events is also maintained in tomato, where about 3 kb of the gene promoter could drive the expression of gusA in preclimacteric fruits and in the fruit abscission zones.
Key words: Abscission zones, ethylene, fruit ripening, peach, promoter analyses, Prunus persica
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The cell wall of fleshy fruits is a complex and highly dynamic structure. During growth of fruits, it undergoes a significant reorganization in order to allow the ordinate expansion of cells that is typical for this stage of development. However, the attainment of the fruit final size does not exclude the possibility of further metabolic and structural changes. It is typical of fleshy fruits to undergo a softening process, largely based on the dismantling of the cell walls, and whose extent can vary according to the different fruits.
Although each fruit has a different set of enzymes involved in the softening process, the enzymes always seem to have a finely regulated timing of expression. Accordingly, there are enzymes that show maximum activity at the beginning of softening, while other enzymes are expressed in high amounts concomitant with the softening peak. The activity of the early-expressed enzymes might improve the physical and/or chemical accessibility of the late-expressed enzymes to their specific substrates, thus facilitating their degrading activity (Brummell and Harpster, 2001).
In non-climacteric fruits, the transition from the end of growth to the start of softening is not clearly demarcated. For instance, veraison marks the beginning of a developmental stage in grape berries where an increase in size and softening occur at the same time (Davies and Robinson, 2000
). In strawberry cell wall metabolism, it has been found that, beside genes that start to be expressed at the visible onset of ripening, other genes start to be expressed in young growing fruits and continue thereafter to increase their expression until the fruits reach a fully ripe stage. In non-climacteric fruits the regulation of the softening process does not appear to follow a general pattern. For instance, in pepper fruits it has been demonstrated that continuous applications of exogenous ethylene are able to induce the expression of high amounts of cellulase (Ferrarese et al., 1995; Harpster et al., 1997). By contrast, in strawberry fruits, a treatment with exogenous ethylene had no apparent effect on the expression of an endo-ß-1,4-glucanase gene (Civello et al., 1999), while the expression of both the same and other genes encoding cell-wall-degrading enzymes appeared to be regulated by auxin (Medina-Escobar et al., 1997; Harpster et al., 1998; Trainotti et al., 1999).
In climacteric fruits, it has long been considered that the ethylene climacteric rise marks the start of the ripening process (Abeles et al., 1992). Since softening is a very important aspect of the ripening syndrome, substantial research has been made to investigate the events that occur in a fruit following the appearance of the climacteric rise. However, by correlating the ethylene production with the loss of firmness, it has been found that both in kiwifruit (Bonghi et al., 1996) and in three different varieties of peach fruits (Tonutti et al., 1996) the ethylene climacteric is a late event that occurs after the fruits have significantly softened. Molecular analyses carried out with peach fruits have recently confirmed that the expression of genes encoding cell-wall-degrading enzymes starts before the appearance of the ethylene climacteric rise (Trainotti et al., 2003). It thus appears that the molecular events occurring prior to the ethylene climacteric rise should also be considered when studying the softening of climacteric fruits.
Until now three different endo-ß-1,4-glucanase genes have been identified in peach. One gene (PpEG1) is strongly expressed during abscission of both leaves and fruits, but also in ripe fruits at very low levels (Trainotti et al., 1997b; Bonghi et al., 1998). The other two genes have also been found to be expressed both in fruits and in abscission zones, although at levels so low as to be detectable only by RT-PCR (Trainotti et al., 1997a). In this paper, the molecular characterization of a peach gene encoding an endo-ß-1,4-glucanase quite different from the previous ones observed in this species is reported. In particular, at its C-terminus the protein encoded by this gene has an extra peptide with the characteristics of a putative cellulose-binding domain. This gene is particularly expressed in fruits with maximum expression prior to the ethylene climacteric rise and it does not appear to be up-regulated by ethylene as might be expected, peaches being climacteric fruits. PpEG4 is also expressed in the abscission zones of leaves and fruits and both features have been confirmed by experiments where a c. 3.0 kb promoter fragment fused to the GUS reporter gene has been used to transform Micro-Tom plants permanently.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Plant material
Plants of Prunus persica (L.) Batsch cv. Redhaven were grown in a field near Padua. Fruits at various stages of development (S1, S2, S3I, S3II, S4I, and S4II; see Zanchin et al., 1994
), corresponding to 47, 65, 86, 101, 112, and 120 d after full bloom, respectively) were collected and used either without or with a hormone treatment. The ethylene treatment was provided by placing whole fruits (attached to a branch for all stages except for the S4s), in a sealed chamber and flushing them with ethylene (10 µl l–1) in air at a flow rate of approximately 6.0 l h–1. The auxin treatment was performed by dipping whole fruits in 1-naphthalene acetic acid (NAA, 2 mM with 200 µl l–1 Silwet L-77 added as a surfactant) for 15 min; subsequently, fruits were sprayed with the NAA solution every 12 h over a period of 48 h. Fruit abscission zones (AZ3) were collected at the S3 stage. The hormone-treated (and air control) AZ3s were collected from the same fruits used for the mesocarp treatments. Leaf abscission zones (AZ) were collected in June for the experiment of ethylene-induced abscission and at the beginning of autumn for the experiment of ‘natural’ abscission. Ethylene was supplied as above to AZs attached to a branch after deblading most of the leaf. AZs from naturally abscising leaves were the ones that, after branch cutting, shed during their transport from the field to the laboratory. The AZs of those leaves which did not shed from the same branches, were considered as ‘not abscising’. Both treated and untreated samples were frozen in liquid nitrogen and stored at –80 °C for subsequent use.
RNA extraction and northern analysis
Total RNA was extracted from both abscission zones and fruits as described in Schneiderbauer et al. (1991). For northern analyses, RNA loading was checked by means of ethidium bromide staining of agarose gels. Total RNA was separated in 6% formaldehyde/1.2% agarose gels and blotted onto Hybond N membranes (Amersham Biosciences) using 20x SSC as blotting buffer. DNA probes were 32P-labelled using a random-primed DNA labelling kit (Promega). The membranes were prehybridized (2 h) and hybridized (16–20 h at 60 °C) in 5% SDS, 5x Denhardt's solution, 5x SSC, sonicated herring sperm DNA (100 µg ml–1). After hybridization, membranes were washed at 60 °C with solutions containing 1% SDS and decreasing concentration of SSC down to a final wash with 0.5x SSC, and exposed either to X-ray films (Biomax MS, Kodak) at –80 °C or to cyclone Storage Phosphor Screens (Packard). The image has then been acquired with a Cyclone Storage Phosphor System (Packard).
RT-PCR, cloning of the amplified cDNA fragments and isolation of genomic clones
Different oligonucleotides (EGfor: 5'-GGNTAYTAYGAYGCNGGNGA-3'; EGrev: 5'-GCNSCCCANARNARYTCRTC-3'), to be used as primers, were prepared according to del Campillo and Bennett (1996). 2 µg of total RNA extracted from S4 fruits were used as the starting material for the RT-PCR experiments. The first-strand synthesis was carried out with the ‘SuperScript’ kit (Invitrogen) using a specific internal primer (EGrev). 2 µl of the first-strand reaction were used for the subsequent PCR amplification. PCR reactions with 200 pmol of each primer and 1.5 mmol l–1 MgCl2 were performed in 50 µl volumes. Denaturation, annealing, and extension temperatures were 95 °C for 1 min, 55 °C for 1 min and 72 °C for 1 min, respectively. This cycle was repeated 30 times. The PCR products were separated by gel electrophoresis and the bands of interest cloned in the pGemT-easy vector (Promega).
The genomic clone 
EG4-21 was isolated from a library constructed by the cloning of MboI partially digested peach DNA in the BamHI site of the EMBL3 SP6/T7 vector. The pCel4 partial cDNA was used as probe to screen the library following standard procedures (Sambrook et al., 1989). DNA from the purified lambda clones was extracted with a commercial kit (Qiagen), digested and, after electrophoresis and blotting, probed again with pCel4. The hybridizing bands were subcloned in the pBluescript II SK (Stratagene) plasmid vector.
Oligonucleotides LT261 (AATATGGAGAAGTTTGTGAGACT) and LT244 (TTAGGCTAGTGAGTAGCTTGAGA) designed on the basis of the PpEG4 genomic sequence were used in a RT-PCR experiment to clone the cognate cDNA. The PCR fragment obtained from the amplification of first strand cDNA synthesized from S3II-derived mRNA was cloned in the pGem-T-easy vector (Promega) and fully sequenced on both strands.
DNA sequencing and analysis
DNA sequencing was performed at the University of Padua sequencing facility (CRIBI) using a PCR-based dideoxynucleotide terminator protocol and an automated sequencer (Applied Biosystems 3700). Sequences were determined on both strands using, when necessary, chemically synthesized oligonucleotides. Sequence manipulations, analyses and alignments were performed using the ‘Lasergene’ software package (DNASTAR).
Preparation of the glucuronidase gene construct
The plasmids used for the tomato transformation experiment contained the GUS reporter gene interrupted by a plant intron described by Vancanneyt et al. (1990). This promoter deletion was PCR prepared by using a high fidelity DNA polymerase (Pfu, Stratagene).
The fragment was amplified from a plasmid subclone using oligo LT192 (ATTAAACAGTAACAGAGTTGAGT, annealing from base 2974 to base 2952 of the antisense strand) at the 3' end and oligo LT221 (GGGTTTGCCGTGGCCGTGACA, annealing from bp 132 to 152 of the sense strand) at the 5'. The resulting fragment contained 200 bps of the 5'-untranslated region (5' UTR) of the PpEG4 mRNA and 2643 bps of the 5'-untranscribed region. This fragment was cloned into the vector pPR97 (Szabados et al., 1995), a few bases upstream of the starting ATG of the gusA gene. The resulting construct was named PpEG4-30 to reflect both the length and the origin of the inserted promoter fragment.
Transformation of tomato plants and histochemical assay of GUS activity
The PpEG4-30 plasmid was inserted in Agrobacterium tumefaciens (strain LBA4404) cells. These cells were then used for A. tumefaciens-mediated transformation of tomato according to Fillati et al. (1987). For the histochemical assay (Jefferson et al., 1987) the tissues were cut and immersed into 1 mM X-Gluc (5-bromo-4-chloro-3-indolyl ß-D-glucuronide), 100 mM phosphate buffer pH 8.5 (Gelvin and Schilperoort, 1994), 0.1% (v/v) Triton X-100, 0.5 mM K3Fe(CN)6, 0.5 mM K4Fe(CN)6, 10 mM EDTA, and 20% (v/v) methanol. After a vacuum treatment of 5 min to facilitate the penetration of the dying solution, tissues were kept for 12 h in the dark at 37 °C. Destaining was made with 70% (v/v) ethanol.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Cloning of the PpEG4 gene
The use of degenerate primers in RT-PCR experiments with total RNA from peaches at stage S4I yielded a cDNA fragment that, on the basis of comparisons with other sequences from data banks, encodes an endo-ß-1,4-glucanase (EGase) different from the three peach EGases already known (not shown). This cDNA fragment was therefore used to screen a peach genomic library. The result of the screening was a DNA fragment of 8309 bp that was entirely sequenced on both strands (Accession no. AJ890497). An analysis of the sequence revealed that it contained the gene related to the cDNA fragment used to isolate it. Being the fourth known gene encoding an endo-ß-1,4-glucanase in peach, it was named PpEG4 (Prunus persica endo-ß-1,4-glucanase 4). The sequence of this gene was then used to prepare other primers in order to obtain the corresponding cDNA (1863 bp) that was entirely sequenced on both strands (Accession no. AJ890498).
By comparing the cDNA and the gene sequences, the structure of the gene could be obtained (Fig. 1A). The coding region of PpEG4 consists of 3715 bp and is interrupted by 8 introns of various length. 2974 non-coding base pairs are present at the 5' of the open reading frame, while 1620 are present at the 3'. A comparison with other known EGase sequences revealed that the peach EGase EST previously referred to as contig 124 (Trainotti et al., 2003) is cognate to the PpEG4 gene. The cDNA contains an open reading frame that encodes a polypeptide of 620 amino acids. The Kyte and Doolittle (1982) hydrophobicity plot indicates that, similarly to other cell-wall-degrading enzymes, PpEG4 also has a predicted signal peptide (25 amino acids long) at the N-terminus, characteristic of secreted proteins. Without the signal peptide the PpEG4 protein is 595 amino acids long and has a predicted molecular mass of 65.2 kDa. This predicted value is greater than the average value (54 kDa) of most higher plant EGases due to the presence of an extra peptide of about 130 amino acids at the C-terminus of PpEG4. Interestingly, this extra peptide consists of a putative cellulose-binding domain (CBD; Fig. 1A) at the outermost end and a linker region connecting the CBD to the EGase proper. In the CBD sequence there is a potential glycosylation site (Fig. 1C) that is conserved in all plant CBDs (but not in the one of the most diverging EGase, the rice CAE03241.2). When phylogenetic comparisons of higher plant EGases are made, the proteins containing a putative CBD cluster together (Hiwasa et al., 2003).
|
Expression of the PpEG4 gene
Expression of the PpEG4 gene was studied by using the corresponding cDNA as a probe in northern analyses (Figs 2, 3, 4). The tissues to be analysed were obtained from fruits at various developmental stages (Fig. 2), fruits treated with either ethylene or the auxin analogue 1-naphthalene acetic acid (NAA, Fig. 3) and also abscission zones of both leaves (AZs) and fruits (AZ3s) were considered (Fig. 4). Peaches are climacteric fruits with a growth curve that forms a double sigmoid where four different stages (S1, S2, S3, and S4) can be recognized (Zanchin et al., 1994
) with S4 being the stage where the ethylene climacteric rise occurs (Tonutti et al., 1997). It has been found that in peaches from different varieties (among them cv. Redhaven used in this study) fruit softening starts before the appearance of the climacteric rise (Tonutti et al., 1996; Trainotti et al., 2003; Brummell et al., 2004). Therefore, two different times for each of the S3 (i.e. S3I and S3II) and the S4 (i.e. S4I and S4II) stages were considered in this analysis. Furthermore, since it has been shown that there is a good correlation between the expression of the peach ACO-1 gene and the occurrence of the ethylene climacteric rise (Tonutti et al., 1997; Ruperti et al., 2001) the same gene was used as a marker of ethylene production by the peach fruits used in this experiment (Fig. 2).
|
|
|
Although PpEG4 transcripts start to be visible in very young fruits (S1), the amount peaks at the S3II stage, that is during the preclimacteric phase. Subsequently, and concomitant with the appearance of the climacteric rise (S4I), the amount of the PpEG4 transcripts declines to lower levels in the fully ripe fruits (S4II). The finding that PpEG4 transcripts increase in preclimacteric fruits and decrease in ripening ones suggested that the PpEG4 gene might actually be down-regulated by ethylene during ripening. This hypothesis was tested by monitoring the expression of PpEG4 in fruits at four developmental stages and treated for 48 h with the gaseous hormone. NAA treatments were also performed, because auxin and ethylene may have counteracting effects in many physiological processes, and because IAA can stimulate the expression of EGases involved in cell expansion (Wu et al., 1996
, and references therein). The same samples were also tested with a peach fruit endo-polygalacturonase (PG), a gene known to be up-regulated by ethylene (Lester et al., 1994). The fruit developmental stages selected for this analysis were: S1 because it represents a stage of fast fruit growth, where endogenous high levels of both ethylene and auxin have been reported for the Redhaven peach cultivar (Miller et al., 1987); S3I and S3II because they represent the beginning of a measurable softening stage and the ethylene pre-climacteric stage, respectively; finally, S4I represents the stage when the ethylene climacteric rise occurs. As suspected, the ethylene treatment is very effective in reducing the PpEG4 transcription in S3II fruits (Fig. 3A). Fruits in this stage, where some expression of the ACO-1 gene starts to be seen (Fig. 2B), are extremely sensitive to the gaseous hormone, as shown by the response of the PG gene (Fig. 3B). In particular, the PG gene is so sensitive to ethylene that the exogenous hormone can induce its transcription even in very young S1 fruits which are more than two months away from the melting stage (i.e. S4II). Fruits at the S3II stage are entering the system-two (autocatalytic) pathway of ethylene production (Barry et al., 2000; Ruperti et al., 2001). Thus, the positive effect of auxin on ethylene production (Abeles et al., 1992) could be the cause of the observed opposite effect of NAA on the transcription of PpEG4 (down-regulated) and PG (up-regulated). S4I fruits are going to produce high amounts of autocatalytic ethylene; accordingly, all fruits detached from the plant behave as if they have been treated with high doses of the gaseous hormone, so transcription of PpEG4 is low and unalterable, while PG is further up-regulated. The effect of the two hormones on the expression of PpEG4 at the S1 and S3I stages appears negligible or null.
PpEG4 transcripts were not detected in fully expanded leaves and flowers (not shown), but were detectable in abscission zones of both fruits (AZ3s) and leaves (AZs), in particular after the induction of abscission by exogenous ethylene treatments (Fig. 4). It is known (Trainotti et al., 1997b) that, in the cells of these two peach abscission zones, exogenous ethylene has a strong inductive effect on another EGase gene (PpEG1), whose expression was used as a marker of the effectiveness of the hormone applications. Both EGases respond in a similar way to auxin, which has the effect of delaying abscission and so inhibiting the expression of genes encoding abscission-related cell-wall-degrading enzymes (Tucker et al., 1988; Kalaitzis et al., 1995; del Campillo and Bennett, 1996). Thus, both PpEG4 and PpEG1 are involved in abscission. Nevertheless, their action seems slightly different since in ‘naturally’ abscising autumnal leaves (Fig. 4, lanes A, abscising; and NA, not abscising) only the PpEG1 transcripts are detected in AZs of both detached (A) and still attached (NA) leaves, thus recalling the different behaviour of Cel1 and Cel5 observed during the abscission of tomato flowers (del Campillo and Bennett, 1996).
Promoter analysis of the PpEG4 gene
A computational analysis of the PpEG4 promoter revealed five regions of high homology to the promoter of the orthologue strawberry FaEG3 gene (Fig. 1A; Spolaore et al., 2003). These regions comprise two major blocks, one proximal to the transcription start site while the other is more than 2 kb away from it. In the rest of the promoter the homology is very low despite the fact that the two species belong to the same Rosaceous family. Also, a number of different cis regions for the putative binding of different transcription factors have been outlined. Among them is an ERE (Ethylene Responsive Element) such as the one found in the tomato E4 gene (Montgomery et al., 1993).
The regulatory activity of the PpEG4-30 promoter fragment has been tested in tomato by means of a permanent transformation of Micro-Tom plants. Although the overall activity does not seem to be particularly strong, as judged on the basis of the blue colour appearance, the PpEG4 promoter is active in growing fruit pericarp and septum (Fig. 5A), where a darker staining can be found in fruits at the pre-climacteric stage (Fig. 5B, mature green fruits). The blue staining is also detected at the level of both fruit abscission zones (i.e. the one in the pedicel and the one that separates the remnants of the receptacle from the pericarp: Fig. 5B) even without exogenous ethylene application. No (or very low) GUS activity has been observed in red tomatoes either untreated (Fig. 5C) or following a treatment with ethylene (not shown), or in other plant tissues (not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
In the various species examined so far, higher plant EGases are normally encoded by multigene families which, based on present knowledge, can be divided into three main groups. The most common and numerous group is formed by secreted enzymes with an average MW of 54 kDa (Fischer and Bennett, 1991
); a second group consists of EGases that contain a hydrophobic transmembrane domain at their N-terminus (Brummell et al., 1997b; Nicol et al., 1998); and the third group is formed by secreted EGases with a putative cellulose-binding domain at their C-terminus (Català and Bennett, 1998; Trainotti et al., 1999). Cellulose-binding domains can commonly be found in micro-organism cellulases, which are enzymes able to degrade the crystalline cellulose. They contribute to the binding of the enzyme to the cellulose microfibrils and are also believed to have a role in enhancing the degradation of the polymer in its crystalline form (Gilkes et al., 1991). Arabidopsis contains 25 genes encoding EGases and, among them, three comprise a putative CBD. The characterization of the first peach EGase with a putative CBD is presented here. These RT-PCR experiments with degenerate primers were aimed at finding new EGase genes highly expressed during peach fruit ripening, since those previously characterized appeared to be poorly involved in the softening process (Trainotti et al., 1997b). In spite of extensive searches, all the isolated clones were cognate to the sole PpEG4 gene.
It has been shown in many species that EGases have roughly two types of expression profiles: those expressed during cell separation events related to a juvenile status such as cel3, (Brummell et al., 1997b) cel4 (Brummell et al., 1997a), and cel7 (Catalá et al., 1997) in tomato, EGL1 in pea (Wu et al., 1996), cel1 in Arabidopsis (Shani et al., 1997), and those expressed in senescence-related cell separation events like organ abscission and fruit softening such as the bean abscission cellulase (Tucker et al., 1988), the avocado fruit cellulase (Christoffersen et al., 1984), cel1, cel2, and cel5 in tomato (Lashbrook et al., 1994; Kalaitzis et al., 1999), and pcel1 and pcel2 in pepper (Ferrarese et al., 1995). Interestingly, the data now available on the expression of EGases with a CBD show their involvement in cell separation events related both to a juvenile status such as tissue expansion in strawberry (Trainotti et al., 1999) and peach, but also to senescence, such as fruit ripening and organ abscission. This particular behaviour might be explained by the extremely small number of CBD-EGase genes available per genome, at least as deduced from Arabidopsis and rice. In other words, such limited and specialized EGases might fulfil different functions through an extreme specialization of their expression, so finely tuned as to be present in cell separation events of different nature. Accordingly, the expression of the PpEG4 gene might be more dependent on the tissue stage of development rather than to exogenous hormone treatments, as it has been shown for other EGases with a CBD like the strawberry FaEG3 (Trainotti et al., 1999), the pear PC-EG2 (Hiwasa et al., 2003) or the tobacco cel8, expressed in roots during nematode infection (Goellner et al., 2001). The transcriptional regulation would thus respond to a precise developmental status rather than directly to a hormonal stimulus. However, hormones are key players in regulating the switch from one developmental status to another. Consequently, the reduction of the PpEG4 transcripts following the ethylene treatment observed in the only S3II stage of fruit development might be due to an acceleration of fruit ripening rather than to a direct effect of the hormone on the transcription of this gene. On the other hand, in naturally ripening peaches the expression of PpEG4 decreases concomitant with the start of the ethylene climacteric rise (i.e. the S4I stage). The positive effect of ethylene (counteracted by auxin) on PpEG4 transcription in abscission zones could also be explained by the induction of a particular developmental condition (i.e. the induction of leaf/fruit shedding) and not just as a direct response of the gene to the hormone applications. Based on the results of PpEG4 expression in fruits, it thus appears that the E4-like ERE (Montgomery et al., 1993) observed in the gene promoter is not functional. However, the possibility exists that such an ERE might be activated by trans acting factors only expressed during abscission events, thus rendering PpEG4 positively regulated by ethylene only in such a particular physiological process.
The strict control mediated by the separation process might also explain the sequence divergence observed between the promoter region of PpEG4 and that of its strawberry orthologue, FaEG3. Despite the kinship of the two plant species (both belong to the Rosaceae family), there is a large divergence in the two promoters, specially in the mid portion (Fig. 1A).
The spatial and temporal activity of the PpEG4-30 promoter fragment could only be tested in a heterologous system because of the difficulties in transforming peach (Pérez-Clemente et al., 2004). As this has been done for other genes from woody plants involved in fruit ripening (e.g. apple; Atkinson et al., 1998), tomato was chosen as a recipient of our construct. Tomato is a berry and peach is a drupe, but both develop from the ovary, so the mesocarp tissue has the same origin. Transgenic micro-Tom harbouring the PpEG4-30 promoter showed gusA expression in the mesocarp of fruits at the mature green and breaker stages. With the progress of ripening the blue staining steadily disappeared, thus mimicking the PpEG4 expression profile observed in peach fruits. A strong staining was also observed in the abscission zone that separates the receptacle from the fruit (similar in function to the peach AZ3) and in the one located in the middle of the petiole (similar in function to the peach AZ1; Zanchin et al., 1995), even in the absence of exogenous ethylene. However, contrary to what has been observed for the promoter of PpEG1 in tobacco (Trainotti et al., 1997b), in tomato, the action of exogenous ethylene does not have the contradictory effect of decreasing the GUS expression in abscission zones, even though it is not able to increase it. The inability of these promoters to respond positively to ethylene in heterologous systems might be explained by the possibility that the necessary cis acting sequences could be located outside of the fragments used in these works. Should this be the case, the idea that the E4-like ERE present in PpEG4-30 is not functional would be strengthened. Another possible explanation might be that the tomato/tobacco ethylene-responsive genes to be transcribed in abscission zones would have a higher affinity for the endogenous trans acting factors than the peach promoters. Thus, upon ethylene induction, these trans acting factors might be recruited by the endogenous genes necessary for abscission to occur, so leaving the transgenes less active.
The functional role of higher plant EGases with a CBD has not yet been demonstrated even in the model system Arabidopsis. As far as is known, no data other than the cDNA sequence are available for the tomato cel8 (Català and Bennett, 1998), thus its function in the development and ripening of this model fruit remains to be clarified. In peach the expression data suggest that PpEG4 is involved in several cell separation processes and that, being the only EGase highly expressed during the early phases of ripening it might initiate the hydrolysis of key bonds necessary to prepare the cell wall for the degrading activity of enzymes to follow (Trainotti et al., 2003). It has been shown that endo-1,4-ß-glucanase activity does not seem to be responsible for matrix glycan depolymerization in either pepper or tomato (Harpster et al., 2002a, b). However, it has recently been demonstrated that an increased solubilization of matrix glycans can be correlated to an EGase activity (Brummell et al., 2004) whose expression matches that of the PpEG4 gene. Thus, by anchoring itself to the cellulose microfibrils through the CBD, the PpEG4 enzyme might cleave the cellulose-bound xyloglucans without significantly decreasing their polymerization degree. Therefore, the matrix glycans would become more soluble and thus the fruits softer.
Thus PpEG4 might be important for the quality of the ripe peaches too.
|
Acknowledgements |
|---|
Professor G Casadoro is thanked for encouragements and for critically reading the manuscript. This work has been financially supported by a grant from Ministry of Education, University and Research (MIUR), Italy.
|
Footnotes |
|---|
* The nucleotide sequence data reported in this paper will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession numbers AJ890497 (PpEG4 gene), AJ890498 (PpEG4 cDNA).
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Abeles FB, Morgan PW, Saltveit Jr ME. 1992. Ethylene in plant biology, 2nd edn. San Diego: Academic Press.
Atkinson RG, Bolitho KM, Wright MA, Iturriagagoitia-Bueno T, Reid SJ, Ross GS. 1998. Apple ACC-oxidase and polygalacturonase: ripening-specific gene expression and promoter analysis in transgenic tomato. Plant Molecular Biology 38, 449–60.[CrossRef][Web of Science][Medline]
Barry CS, Llop-Tous MI, Grierson D. 2000. The regulation of 1-aminocyclopropane-1-carboxylic acid synthase gene expression during the transition from system-1 to system-2 ethylene synthesis in tomato. Plant Physiology 123, 979–986.
Bonghi C, Ferrarese L, Ruperti B, Tonutti P, Ramina A. 1998. Endo-ß-1,4-glucanases are involved in peach fruit growth and ripening, and regulated by ethylene. Physiologia Plantarum 102, 346–352.
Bonghi C, Pagni S, Vidrih R, Ramina A, Tonutti P. 1996. Cell wall hydrolases and amylase in kiwifruit softening. Postharvest Biology and Technology 9, 19–29.
Brummell DA, Bird CR, Schuch W, Bennett AB. 1997a. An endo-1,4-ß-glucanase expressed at high levels in rapidly expanding tissues. Plant Molecular Biology 33, 87–95.[CrossRef][Web of Science][Medline]
Brummell DA, Catala C, Lashbrook CC, Bennett AB. 1997b. A membrane-anchored E-type endo-ß-1,4-glucanase is localized on Golgi and plasma membranes of higher plants. Proceeding of The National Academy of Sciences, USA 94, 4794–4799.
Brummell DA, Dal Cin V, Crisosto CH, Labavitch JM. 2004. Cell wall metabolism during maturation, ripening and senescence of peach fruit. Journal of Experimental Botany 55, 2029–2039.
Brummel DA, Harpster MH. 2001. Cell wall metabolism in fruit softening and quality and its manipulation in transgenic plants. Plant Molecular Biology 47, 311–340.[CrossRef][Web of Science][Medline]
Català C, Bennett AB. 1998. Cloning and sequence analysis of TomCel8; a new plant endo-ß-1,4-D-glucanase gene, encoding a protein with a putative carbohydrate binding domain (Accession No. AF098292) (PGR98-209). Plant Physiology 118, 1535.
Catalá C, Rose JKC, Bennett AB. 1997. Auxin regulation and spatial localization of an endo-1,4-ß-D-glucanase and a xyloglucan endotransglycosylase in expanding tomato hypocotyls. The Plant Journal 12, 417–426.[CrossRef][Web of Science][Medline]
Christoffersen RE, Tucker ML, Laties GG. 1984. Cellulase gene expression in ripening avocado fruit: the accumulation of cellulase mRNA and protein as demonstrated by cDNA hybridization and immunodetection. Plant Molecular Biology 3, 385–391.[CrossRef]
Civello PM, Powell ALT, Sabehat A, Bennett AB. 1999. An expansin gene expressed in ripening strawberry fruit. Plant Physiology 121, 1273–1279.
Davies C, Robinson SP. 2000. Differential screening indicates a dramatic change in mRNA profiles during grape berry ripening. Cloning and characterization of cDNAs encoding putative cell wall and stress response proteins. Plant Physiology 122, 803–812.
del Campillo E, Bennett AB. 1996. Pedicel breakstrength and cellulase gene expression during tomato flower abscission. Plant Physiology 111, 813–820.[Abstract]
Ferrarese L, Trainotti L, Moretto P, Polverino de Laureto P, Rascio N, Casadoro G. 1995. Differential ethylene-inducible expression of cellulase in pepper plants. Plant Molecular Biology 29, 735–747.[CrossRef][Web of Science][Medline]
Fillati JJ, Kiser J, Rose R, Comai L. 1987. Efficient transfer of a glyphosate tolerance gene into tomato using a binary Agrobacterium tumefaciens vector. Biotechnology 5, 726–730.[CrossRef]
Fischer R, Bennett AB. 1991. Role of cell wall hydrolases in fruit ripening. Annual Review of Plant Physiology and Plant Molecular Biology 42, 675–703.[CrossRef][Web of Science]
Gelvin SB, Schilperoort RA. 1994. Plant molecular biology manual, 2nd edn. Dordrecht, The Netherlands: Kluwer Academic Publishers.
Gilkes NR, Henrissat B, Kilburn DG, Miller Jr RC, Warren RAJ. 1991. Domains in microbial ß-1,4-glycanases: sequence conservation, function, and enzyme families. Microbiological Reviews 55, 303–315.
Goellner M, Wang X, Davis EL. 2001. Endo-ß-1,4-glucanase expression in compatible plant–nematode interactions. The Plant Cell 13, 2241–2255.
Harpster MH, Brummell DA, Dunsmuir P. 1998. Expression analysis of a ripening-specific, auxin-repressed endo-1,4-ß-glucanase gene in strawberry. Plant Physiology 118, 1307–1316.
Harpster MH, Brummell DA, Dunsmuir P. 2002a. Suppression of a ripening-related endo-1,4-ß-glucanase in transgenic pepper fruit does not prevent depolymerization of cell wall polysaccharides during ripening. Plant Molecular Biology 50, 345–355.[CrossRef][Web of Science][Medline]
Harpster MH, Dawson DM, Nevins DJ, Dunsmuir P, Brummell DA. 2002b. Constitutive overexpression of a ripening-related pepper endo-1,4-ß-glucanase in transgenic tomato fruit does not increase xyloglucan depolymerization or fruit softening. Plant Molecular Biology 50, 357–369.[CrossRef][Web of Science][Medline]
Harpster MH, Lee KY, Dunsmuir P. 1997. Isolation and characterization of a gene encoding endo-ß-1,4-glucanase from pepper (Capsicum annuum L.). Plant Molecular Biology 33, 47–59.[CrossRef][Web of Science][Medline]
Hiwasa K, Kinugasa Y, Amano S, Hashimoto A, Nakano R, Inaba A, Kubo Y. 2003. Ethylene is required for both the initiation and progression of softening in pear (Pyrus communis L.) fruit. Journal of Experimental Botany 54, 771–779.
Jefferson RA, Kavanagh TA, Bevan MW. 1987. GUS fusion: ß-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. The EMBO Journal 6, 3901–3907.[Web of Science][Medline]
Kalaitzis P, Hong S-B, Solomos T, Tucker ML. 1999. Molecular characterization of a tomato endo-ß-1,4-glucanase gene expressed in mature pistils, abscission zones and fruit. Plant Cell Physiology 40, 905–908.
Kalaitzis P, Koehler SM, Tucker ML. 1995. Cloning of a tomato polygalacturonase expressed in abscission. Plant Molecular Biology 28, 647–656.[CrossRef][Web of Science][Medline]
Kyte J, Doolittle RF. 1982. A simple method for displaying the hydropathic character of protein. Journal of Molecular Biology 157, 105–132.[CrossRef][Web of Science][Medline]
Lashbrook CC, Gonzales-Bosh C, Bennett AB. 1994. Two divergent endo-ß-1,4-glucanase genes exhibit overlapping expression in ripening fruits and abscission flowers. The Plant Cell 6, 1485–1493.[Abstract]
Lester DR, Speirs J, Orr G, Brady CJ. 1994. Peach (Prunus persica) endopolygalacturonase cDNA isolation and mRNA analysis in melting and nonmelting peach cultivars. Plant Physiology 105, 225–231.[Abstract]
Medina-Escobar N, Càrdenas J, Moyano E, Caballero JL, Munoz-Blanco J. 1997. Cloning, molecular characterization and expression pattern of a strawberry ripening-specific cDNA with sequence homology to pectate lyase from higher plants. Plant Molecular Biology 34, 867–877.[CrossRef][Web of Science][Medline]
Miller AN, Walsh CS, Cohen JD. 1987. Measurement of indole-3-acetic acid in peach fruits (Prunus persica L. Batsch cv. Redhaven) during development. Plant Physiology 84, 491–494.
Montgomery J, Goldman S, Deikman J, Margossian L, Fischer RL. 1993. Identification of an ethylene-responsive region in the promoter of a fruit ripening gene. Proceeding of The National Academy of Sciences, USA 90, 5939–5943.
Nicol F, His I, Jauneau A, Vernhettes S, Canut H, Hofte H. 1998. A plasma membrane–bound putative endo-1,4-ß-D-glucanase is required for normal wall assembly and cell elongation in Arabidopsis. The EMBO Journal 17, 5563–5576.[CrossRef][Web of Science][Medline]
Pérez-Clemente RM, Pérez-Sanjuán A, García-Férriz L, Beltrán JP, Cañas LA. 2004. Transgenic peach plants (Prunus persica L.) produced by genetic transformation of embryo sections using the green fluorescent protein (GFP) as an in vivo marker. Molecular Breeding 14, 419–427.[CrossRef]
Ruperti B, Bonghi C, Rasori A, Ramina A, Tonutti P. 2001. Characterization and expression of two members of the peach 1-aminocyclopropane-1-carboxylate oxidase gene family. Physiologia Plantarum 111, 336–344.[CrossRef][Medline]
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Schneiderbauer A, Sandermann Jr H, Ernst D. 1991. Isolation of functional RNA from plant tissues rich in phenolic compounds. Analytical Biochemistry 197, 91–95.[CrossRef][Web of Science][Medline]
Shani Z, Dekel M, Tsabary G, Shoseyov O. 1997. Cloning and characterization of elongation specific endo-1,4-ß-glucanase (cel1) from Arabidopsis thaliana. Plant Molecular Biology 34, 837–842.[CrossRef][Web of Science][Medline]
Spolaore S, Trainotti L, Pavanello A, Casadoro G. 2003. Isolation and promoter analysis of two genes encoding different endo-ß-1,4-glucanases in the non-climacteric strawberry. Journal of Experimental Botany 54, 271–277.
Szabados L, Charrier B, Kondorosi A, de Bruijn F, Ratet P. 1995. New plant promoter and enhancer testing vectors. Plant Molecular Biology 1, 419–423.[CrossRef]
Tonutti P, Bonghi C, Ramina A. 1996. Fruit firmness and ethylene biosynthesis in three cultivars of peach (Prunus persica L. Batsch). Journal of Horticultural Science 71, 141–147.
Tonutti P, Bonghi C, Ruperti B, Tornielli GB, Ramina A. 1997. Ethylene evolution and 1-aminocyclopropane-1-carboxylate oxidase gene expression during early development and ripening of peach fruit. Journal of the American Society for Horticultural Science 122, 642–647.
Trainotti L, Ferrarese L, Casadoro G. 1997a. Different endo-ß-1,4-glucanases are expressed during abscission and fruit ripening in pepper and peach plants. In: Kanellis AK, Chang C, Kende H, Grierson D, eds. Biology and biotechnology of the plant hormone ethylene. Dordrecht, The Netherlands: Kluwer Academic Publishers, 191–196.
Trainotti L, Spolaore S, Ferrarese L, Casadoro G. 1997b. Characterization of ppEG1, a member of a multigene family which encodes endo-ß-1,4-glucanase in peach. Plant Molecular Biology 34, 791–802.[CrossRef][Web of Science][Medline]
Trainotti L, Spolaore S, Pavanello A, Baldan B, Casadoro G. 1999. A novel E-type endo-ß-1,4-glucanase with a putative cellulose-binding domain is highly expressed in ripening strawberry fruits. Plant Molecular Biology 40, 323–332.[CrossRef][Web of Science][Medline]
Trainotti L, Zanin D, Casadoro G. 2003. A cell wall-oriented genomic approach reveals a new and unexpected complexity of the softening in peaches. Journal of Experimental Botany 54, 1821–1832.
Tucker ML, Sexton R, del Campillo E, Lewis LN. 1988. Bean abscission cellulase: characterization of a cDNA clone and regulation of gene expression by ethylene and auxin. Plant Physiology 88, 1257–1262.
Vancanneyt G, Schmidt R, O'Connor-Sanchez A, Willmitzer L, Rocha-Sosa M. 1990. Construction of an intron-containig marker gene: splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Molecular and General Genetics 220, 245–250.
Wu SC, Blumer JM, Darvill AG, Albersheim P. 1996. Characterization of an endo-ß-1,4-glucanase gene induced by auxin in elongating pea epicotyls. Plant Physiology 110, 163–170.[Abstract]
Zanchin A, Bonghi C, Casadoro G, Ramina A, Rascio N. 1994. Cell enlargement and cell separation during peach fruit development. International Journal of Plant Sciences 155, 49–56.
Zanchin A, Marcato C, Trainotti L, Casadoro G, Rascio N. 1995. Characterization of abscission zones in the flowers and fruits of peach [Prunus persica (L.) Batsch]. New Phytologist 129, 345–354.[CrossRef]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  B. R. Urbanowicz, C. Catala, D. Irwin, D. B. Wilson, D. R. Ripoll, and J. K. C. Rose A Tomato Endo-beta-1,4-glucanase, SlCel9C1, Represents a Distinct Subclass with a New Family of Carbohydrate Binding Modules (CBM49) J. Biol. Chem., April 20, 2007; 282(16): 12066 - 12074. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Hayama, T. Shimada, H. Fujii, A. Ito, and Y. Kashimura Ethylene-regulation of fruit softening and softening-related genes in peach J. Exp. Bot., December 1, 2006; 57(15): 4071 - 4077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yoshida, N. Imaizumi, S. Kaneko, Y. Kawagoe, A. Tagiri, H. Tanaka, K. Nishitani, and K. Komae Carbohydrate-Binding Module of a Rice Endo-{beta}-1,4-glycanase, OsCel9A, Expressed in Auxin-Induced Lateral Root Primordia, is Post-Translationally Truncated Plant Cell Physiol., November 1, 2006; 47(11): 1555 - 1571. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||