JXB Advance Access originally published online on February 10, 2006
Journal of Experimental Botany 2006 57(4):865-875; doi:10.1093/jxb/erj071
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH PAPER |
SECRET AGENT and SPINDLY have overlapping roles in the development of Arabidopsis thaliana L. Heyn.
1Department of Plant Biology, University of Minnesota, 250 Biological Sciences Center, 1445 Gortner Ave., St Paul, MN 55108, USA
2Department of Plant Pathology, University of Wisconsin-Madison, 1630 Linden Drive, Madison, WI 53706, USA
* To whom correspondence should be addressed. E-mail: neil{at}cbs.umn.edu
Received 26 May 2005; Accepted 23 November 2005
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionSupplementary materialReferences |
|---|
O-GlcNAc transferase (OGT) catalyses transfer of GlcNAc (N-acetylglucosamine) to serine or threonine of proteins. The Arabidopsis OGTs, SECRET AGENT (SEC) and SPINDLY (SPY) have overlapping functions during gametogenesis and embryogenesis. SPY functions in a number of processes including circadian, light, and gibberellin (GA) responses. The role of SEC in plant development and GA signalling was investigated by determining the phenotypes of sec-1 and sec-2 plants and the expression pattern of SEC. Similar to SPY, SEC transcripts were ubiquitous. Although there is no evidence of transcript-level regulation by other factors, SEC mRNA levels are elevated in spy plants and SPY mRNA levels are elevated in sec plants. sec-1 and sec-2 plants exhibited few of the defects observed in spy plants and had wild-type GA responses. Compared with wild type, sec plants produced leaves at a reduced rate. Haplo-insufficiency at SEC in a spy ga1 double mutant background suppressed spy during germination and enhanced the production of ovaries with four carpels by spy. By contrast, SPY haplo-insufficiency in a sec ga1 double mutant background caused a novel phenotype, production of a proliferation of pin-like structures instead of a floral shoot. These results are consistent with SEC function overlapping with SPY for leaf production and reproductive development.
Key words: Flowering time, O-GlcNAc, O-glycosylation, shoot apical meristem
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary materialReferences |
|---|
The Arabidopsis SINDLY (SPY) gene was initially identified by its role as a negative regulator in the gibberellin (GA) signal transduction pathway (Jacobsen and Olszewski, 1993
). Gibberellins are tetracyclic diterpenoids that affect germination, hypocotyl growth, growth and greening of leaves, petiole length, trichome patterning, flowering time, apical dominance, petal and anther development (reviewed in (Olszewski et al., 2002; Sun and Gubler, 2004; Swain and Singh, 2005), pollen tube growth (Swain et al., 2004), and root growth (Fu and Harberd, 2003). Plants with mutations in GA1, the GA biosynthesis gene encoding copalyl diphosphate synthase, have severely reduced amounts of active GA and exhibit phenotypes for all GA-regulated functions (Koornneef and van der Veen, 1980; Sun and Kamiya, 1994; Wilson and Somerville, 1995; Silverstone et al., 1997a). Plants with mutations in SPY suppress the phenotypes of GA-deficiency (Jacobsen and Olszewski, 1993; Wilson and Somerville, 1995; Jacobsen et al., 1996; Silverstone et al., 1997b; Swain et al., 2001). SPY also has functions that are independent of GA responses (Swain et al., 2001, 2002; Tseng et al., 2004; Greenboim-Wainberg et al., 2005). Swain et al. (2002) have proposed that the SPY acts independently of GA responses in controlling cotyledon number, leaf serration, leaf growth, plant height, hypocotyl growth, and phyllotaxy. spy mutants have defects in the circadian rhythm of transpiration (Sothern et al., 2002) and cotyledon movement (Tseng et al., 2004).
There are two OGT genes in Arabidopsis, SPY and SECRET AGENT (SEC) (Thornton et al., 1999; Hartweck et al., 2002). OGTs catalyse the transfer of a single GlcNAc from UDP-GlcNAc to serine or threonine residues of substrate proteins (Haltiwanger et al., 1990). The known animal O-GlcNAcylated proteins include transcription factors, receptors, signalling effector proteins, sugar transport and synthesis proteins, cytoskeletal and associated proteins, heat shock proteins, RNA polymerase II, and a component of the 26S protein degradation complex (Buse et al., 2002; Wells and Hart, 2003; Wells et al., 2003; Zhang et al., 2003; Khidekel et al., 2004; Guinez et al., 2005). The addition of this modification to a protein can affect its activity, localization, stability, and interactions with other proteins. In some instances, a particular serine/threonine residue can be either O-GlcNAcylated or phosphorylated (Kelly et al., 1993; Chou et al., 1995; Arnold et al., 1996; Cheng and Hart, 2001; Comer et al., 2001). This suggests a situation where a single protein can be regulated though the actions of OGT, kinases, phosphatases, and O-GlcNAcase, the enzyme that removes O-GlcNAc modifications (Gao et al., 2001; Wells et al., 2004).
The initial characterization of sec mutants did not find any striking phenotypes, but did find that SEC and SPY were functionally redundant and required during gametogenesis and embryogenesis (Hartweck et al., 2002). These observations are consistent with those in animals where O-GlcNAc modification is also required for gamete and embryo development (Shafi et al., 2000; O'Donnell et al., 2004). More recently, SEC has been shown to have a unique role in the infection of Arabidopsis by Plum pox virus (Chen et al., 2005). In contrast to wild type and spy, the coat protein is not O-GlcNAc modified and virus replication and spread are reduced in sec plants. These results indicate that SEC and SPY have both unique and overlapping functions. The goal of this study was to learn more about the functional interrelationship of SEC and SPY in plant growth and development. It was found that SEC functions in germination, rosette leaf growth, in the height of the inflorescence stem, and the rate of production of rosette leaves. Unlike SPY, SEC has a limited role, if any, in GA signalling but it functions in a partially redundant manner with SPY to regulate reproductive development.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary materialReferences |
|---|
Plant growth and phenotypic characterization
Seeds were sown into germination soil mix (Gardener's Supply, Burlington, VT) in Arabicon pots (Lehle Seeds, Round Rock, TX) and stratified by cold treatment (4 °C) under constant illumination for 3 d. Plants were grown in a chamber under long-day (16/8 h light/dark) or short-day (8/16 h light/dark) conditions. In long-day conditions, light at 85 µmol photons m–2 s–1 was from Cool White fluorescent tubes and incandescent bulbs. In short-day conditions, light at 50 µmol photons m–2 s–1 was from Cool White fluorescent tubes only. The daytime temperature was 22 °C and the night-time temperature was 20 °C. When noted, plants were grown at 18 °C or 30 °C constant temperature. When the first flower opened, the maximum distance from leaf tip to leaf tip directly across the rosette (rosette diameter) and height to first flower (inflorescence height) were measured and the number of leaves were counted. Mean values represent at least 15 plants, and the standard error of the mean is listed. Experiments were independent and repeated at least three times. Analyses of variance, determination of means, and differences between means were conducted using standard methods and t-tests were conducted if there were significant differences indicated in the analysis of variance by a protected least significant difference test (Snedecor and Cochran, 1980
). In some experiments, each leaf was measured at flowering; the petiole, and lamina length and width were measured using a ruler and dissecting microscope. When plants growing under short-day conditions flower, older leaves have senesced. Therefore, in experiments to determine the total number of leaves present at flowering on plants growing under short days, prior to any leaf senescence fully expanded leaves were counted and marked with a blue permanent marker and at subsequent times newly expanded leaves were counted and marked. The number of leaves produced per day was determined as described by Telfer et al. (1997). For hypocotyl measurements, seeds were placed on top of three pieces of filter paper saturated with Murashige and Skoog (MS) salts (Fisher Scientific, Pittsburg, PA) in Petri dishes and placed at 4 °C for 3 d and given 1 h of white light. Dishes were then placed in the dark or under continuous red light (4.5 µmol photons m–2 s–1) for 1 week at room temperature, and the seedlings were removed, and taped onto plastic sheets. The images were scanned and measured using NIH image software. For root length determination, seeds were germinated on MS salts and moved to new plates and the root position was marked. The distance the roots had grown during four days after transfer was measured. ga1-2 and sec-1 ga1-2 and sec-2 ga1-2 seeds were imbibed overnight in 5.0 µM GA3 before sowing. It was hypothesized that seeds with the genotype sec-1 sec-1; SPY spy; ga1-2 ga1-2 would not germinate unless they had been treated with GA. To isolate this genotype, progeny seeds of a cross between sec-1 and spy-4 ga1-2 were sown onto MS plates after surface-sterilization with 50% bleach (Hartweck et al., 2002). Seeds that did not germinate after 5 d were treated with 5.0 µM GA3 (Sigma, St Louis, MO) overnight and sown onto soil.
Plant genotyping
Plants were genotyped for sec-1 and sec-2 alleles as previously described (Hartweck et al., 2002). The genotype of plants carrying spy-4 was determined similarly using the primers SPY-NS1 CTCCTAAATGGCTGGACATAATTCAGATG and SPY promoter-1 CTAAAATCTTGTTCACCTTCAAAGAAACA to amplify the wild-type locus and SPY-NS1 promoter and the spy-4-insertion-primer, TCACTAAAGGCGGTAATACGGGTA to amplify the spy-4 locus. For both alleles, the annealing and extension conditions were 50 °C for 15 s and 72 °C for 70 s, respectively, and all other conditions were as described by Hartweck et al. (2002).
Quantitation of RNA
The RNA from 100 mg of plant tissue was extracted with TRI Reagent (Molecular Research Center, Cincinnati, OH) according to manufacturer's directions. DNA was removed by treatment with DNase I (New England Biolabs, Beverly, MA), and the RNA was precipitated. Approximately 5 µg of RNA was reverse transcribed using Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA). A volume of cDNA corresponding to 0.01 µg of input RNA was used in amplifications with primers for ACTIN2 (ACT; At3g18780), SEC and SPY (ACT2F, GGCCGATGGTGAGGATATTCAGCCACTTG; ACT2R, CTTC ATGAGTGAGTCTGTGAGATCCCGAC; SECF, GGAATACTTACAAAGAGA TCGGGAGGG; SECR, CATGAGGTGTGACAACGGATGGTTA; SPYF, GCGAC CTATCACCATTGGA, SPYR AAAACAGTCCGGAGCCTAACC). PCR was performed using Takara Taq polymerase (Fisher Scientific) according to the manufacturer's directions. The cycling parameters were: 95 °C 15 s, 60 °C 15 s, 72 °C 40 s. For each RNA, the number of cycles required to reach the midpoint of log-phase amplification was determined and this number of cycles was then used in the quantification experiments. Twenty cycles were used for ACT mRNA and 25 cycles were used for SEC and SPY mRNA. One-fifth of the amplification reaction was electrophoresed on agarose gels and Southern blotted using standard methods (Sambrook et al., 1989). The blots were hybridized with radiolabelled PCR products and exposed to Molecular Dynamics (Sunnyvale, CA) phosphor screens. The amount of probe hybridized to the RT-PCR product in each sample was estimated with ImageQuant software (Amersham Biosciences, Piscataway, NJ). The levels of SEC and SPY in each sample were compared after standardizing to ACT2. Mean expression levels and standard errors were calculated from three fully replicated experiments.
To examine whether SEC was expressed in sec-2 mutants, cDNA from each was produced as described above and PCR was used to detect if any SEC RNA was present in the mutants. For PCR, SEC cDNA was amplified using primers for segment 1 (SEC34: TCGAGCCTCCTCCAGCAGTTC and SEC07: ACACATGATCGCTTCAGTA), segment 2 (SECNS2: GGAATACTTACAAAGAGATCGGGAGGG) and SECNS3: CATGAGGTGTGACAACGGATGGTTA) and segment 3 (SEC40: GAACATATCAGGCGAAGTGTCCT and SEC15: TCCTTGTTTATCTGTC). PCR conditions were as described but with a 50 °C annealing temperature and for 35 cycles. PCR products were then fractioned by size on a 1% agarose gel, stained with ethidium bromide and fragments were documented with an Ultra Violet Products (Upton, CA) system. Images were adjusted for only size, brightness and contrast using Adobe Photoshop (Adobe Systems Inc., Mountain View CA) and Canvas (ACD Systems, Miami, FL) software.
Bacterial growth assays
For bacterial inoculation, sec-2 and Col plants were grown in a 9 h photoperiod at 22 °C, under 150 µmol photons m–2 s–1. Four-week-old plants were vacuum-infiltrated with bacterial suspensions of 4x105 cfu ml–1, with the surfactant Silwet L-77 (Lehle seeds) at a concentration of 0.005% (v/v). The strains used for inoculation were Pseudomonas syringae pv. tomato strain DC3000, containing either the empty pVSP61 vector, or the pV288 vector, from which AvrRpt2 is expressed. Leaf bacterial populations were sampled 3 d after inoculation by the method reported in Whalen et al. (1991), except that NYGA (Daniels et al., 1984) was used in place of King's B medium.
Microscopy
Light microscopy of plants was done on a stereoscope (model SMU-Z Nikon Corp, Tokyo, Japan). Images were captured digitally with a Nikon 990 camera mounted using a Spectronix MaxView Plus adaptor. Images were adjusted as described above.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary materialReferences |
|---|
Analysis of SEC and SPY expression
To determine the independence and/or overlap in function between SEC and SPY, the RNA expression pattern of SEC was examined. SPY is expressed throughout development in all tissues of Arabidopsis (Swain et al., 2001
), petunia (Izhaki et al., 2001), and barley (Robertson et al., 1998). SEC mRNA was present in similar amounts in all of the tissues examined (Fig. 1) and consistent with previous results, SPY mRNA was present in similar amounts in each of these tissues.
|
Northern analyses did not detect any differences in SEC mRNA levels following treatment of 1-week-old seedlings for 6 h with ABA, ACC, BA, GA, MJ, NAA (10 µM) or BR (1 µM) (not shown).
Surprisingly, SPY and SEC mRNA levels increased in response to mutations affecting the other gene (Fig. 2; Table 1). The sec-1 and sec-2 mutations result from T-DNA insertions within the gene (Hartweck et al., 2002), the spy-4 allele has a T-DNA insertion within the promoter of the gene (Jacobsen et al., 1996), and the spy-3 mutation results in a single amino acid change (Jacobsen et al., 1996). SPY mRNA was between 1.5±0.1 and 1.4±0.8-fold more abundant than wild type in sec-1 and sec-2, respectively. SEC mRNA was 2.2±1.3 and 1.5±0.3 more abundant in spy-3 and spy-4, respectively. Although these effects were small they were statistically significant (Table 1). Interestingly, SPY mRNA was significantly elevated in spy-3.
|
|
The effects of sec-1 and sec-2 on SEC mRNA levels were also determined. SEC mRNA is greatly reduced in sec-1 (Fig. 2), but because the T-DNA is inserted into an exon in the TPR domain, this mRNA is predicted to encode a protein that lacks the catalytic domain. Because the T-DNA insertion in sec-2 is within an intron, this allele could produce a wild-type mRNA. However, no RNA from the region downstream of the T-DNA was detected in sec-2 plants (Fig. 3).
|
Phenotypes of sec plants
SEC and SPY have overlapping functions in embryonic development as evidenced by the lethality of sec spy embryos (Hartweck et al., 2002
). Therefore sec single mutants were examined for a variety of developmental, growth, and response phenotypes previously reported to occur in spy plants (Filardo and Swain, 2003). sec-1 and sec-2 caused a reduction in the total number of leaves present at flowering of plants grown under long days (Table 2). This phenotype occurred in plants grown at 18, 22, or 30 °C. By contrast, the number of days to flowering was unaffected in both sec-1 and sec-2 suggesting that the rate of leaf production is lower in the mutants (Table 2). To learn when sec affects the rate of leaf production, the number of leaves visible under a dissecting microscope was scored every 2 d starting 10 d after stratification (Fig. 4; Table 3). The rate of leaf production by sec-1 was less than wild type at 12 d and 14 d post-stratification (Fig. 4). For sec-2, leaf production was reduced between days 10–12 and 16–20, but was similar to wild type between days 12–16 (Fig. 4). The difference in leaf production between days 10–12 results in a significant reduction in leaf number that persists (Table 3). At day 18, the difference in leaf number increases further due to the second decrease in the rate of production. The differences in the rates of leaf production could be caused by differences in the timing of the transition between juvenile and adult phases, which is known to be affected by GA and spy (Silverstone et al., 1997a; Telfer et al., 1997). It was found that the timing of this transition, as indicated by the appearance of abaxial trichomes, was unaffected in sec-1 and sec-2 (first leaf with abaxial trichomes: WS, 2.9±0.04; sec-1, 2.9±0.04; Col, 5.8±0.1; sec-2, 5.5±0.1). While sec-1 had no significant effect on days to flowering or total leaf number at flowering under short days, it did reduce the number of cauline leaves present when the first flower opened (Table 4). The length of the shoot at flowering was shorter in sec-1 under both long and short days (Tables 2, 4). By contrast, sec-2 did not have a significant effect on shoot length at flowering (Table 2).
|
|
|
|
sec-1 and sec-2 did not affect the colour, size, or shape of leaves or cotyledons (not shown). The hypocotyl length of sec seedlings growing in the dark, or red light was indistinguishable from that of wild type (Table 5). Seedling root length (Table 5) and inhibition of root elongation by auxin (for supplementary Fig. 1, see JXB online) were not affected by sec. Rosette diameter was also unaffected in sec plants, but the petiole lengths of leaves 6, 7, and 9 were significantly shorter in sec-2 as were the lengths of leaves 7 and 9 (Tables 2, 6). Interestingly, leaves 6 and 7 are forming at about the time that the rate of leaf production decreases in sec-2 (Table 3).
|
|
Response to gibberellins
Mutations in spy suppress the phenotypes of ga1 including non-germination, dwarfing, dark green colour of leaves, petal development, late induction of flowering in long days, and non-flowering in short days (Filardo and Swain, 2003
). To test whether SEC has any roles similar to SPY within the GA pathway it was examined whether sec mutations would suppress the phenotype of ga1. Analyses of sec-1 ga1 and sec-2 ga1 double mutants did not detect evidence that sec suppressed any of the aforementioned ga1 phenotypes (Table 7; data not shown). GA dose–response experiments examining germination did not detect any differences in GA sensitivity between ga1 and the sec ga1 double mutants (for supplementary Fig. 2, see JXB online). However, both sec alleles reduced rosette diameter in a ga1 background (Table 7).
|
SEC and SPY participate in carpel development and meristem function
Although the characterization of sec single mutants did not find evidence supporting a role of SEC in GA responses, the increased SPY protein present in these lines may obscure the role of SEC in this response. Ideally, the question of whether SEC and SPY both function in GA signalling would be addressed by determining the phenotype of a sec spy ga1 triple mutant, but this is not possible because loss of both sec and spy function causes embryo lethality (Hartweck et al., 2002
) even in a ga1 background (data not shown). Therefore, sec-1/sec-1 SPY /spy-4 ga1/ga1 plants were constructed to determine if heterozygosity at SPY allowed suppression of ga1 by sec. To construct sec-1/sec-1 SPY /spy-4 ga1/ga1 plants, sec-1 and spy-4 ga1 plants were crossed and F2 progeny that were homozygous for ga1 were identified by their failure to germinate. Germination of these non-germinating seeds was then promoted by treatment with GA3 and sec-1/sec-1 SPY /spy-4 ga1/ga1 plants were identified by PCR. SEC and SPY are 8 cm apart on chromosome III and ga1 is on chromosome IV thus 1/500 of the F2 seeds are expected to be sec-1/sec-1 SPY /spy-4 ga1/ga1. In three independent experiments, a total of 1500 F2 seeds were screened and, consistent with the expected frequency, five sec-1/sec-1 SPY /spy-4 ga1/ga1 plants were recovered indicating that this genotype requires GA to germinate. Moreover, before induction of flowering, these plants were indistinguishable from the sec-1 ga1 and SEC/sec-1 SPY/spy-4 ga1/ga1 plants present in the population indicating that even when SPY is heterozygous, loss of SEC function does not suppress ga1.
The sec-1/sec-1 SPY /spy-4 ga1/ga1 plants did, however, exhibit a novel phenotype that did not occur in sec-1/sec-1 SPY/SPY ga1/ga1 or SEC/sec-1 SPY/spy-4 plants. At the time when sec-1 ga1 and SEC/sec-1 SPY/spy-4 ga1/ga1 plants began to flower, all of the sec-1/sec-1 SPY /spy-4 ga1/ga1 plants developed a proliferation of pin-like structures at the apex (Fig. 5B, C). These structures had a dark red appearance not unlike tissues with high levels of anthocyanins. One pin each of two sec-1/sec-1 SPY/spy-4 ga1/ga1 plants produced a trichome (not shown). In addition to pins, one apex formed a flat structure with a few bumps but the nature of the bumps is unknown (Fig. 5D). There was an interaction between SEC, SPY, and GA in promoting this phenotype because when two sec-1/sec-1 SPY/spy-4 ga1/ga1 plants were identified early in development and treated weekly with 50 µM GA3, both plants produced flowers instead of pins.
|
Surprisingly, spy-4 did not suppress the germination phenotype of ga1 when in the SEC/sec-1 spy-4/spy-4 ga1/ga1 genotype. SEC/SEC spy-4/spy-4 ga1/ga1 seeds within the segregating population were able to germinate, indicating that this failure of spy-4 to suppress ga1 was not due to maternal effects. Since, the SEC/sec-1 spy-4/spy-4 ga1/ga1 genotype was present at the expected frequency in the non-germinating population, the lack of suppression of ga1 by spy-4 in a SEC/sec background is likely to be fully penetrant. In other respects, the phenotypes of SEC/sec-1 spy-4/spy-4 ga1/ga1 plants were similar to spy-4 ga1 plants except that the majority of the flowers on all of the nine plants identified had ovaries with one or two extra carpels (Fig. 5E, F).
Resistance to bacterial pathogens
Recently, SEC but not SPY was found to have a role in infection by Plum pox virus (Chen et al., 2005). sec mutations prevent O-GlcNAc modification of the virus coat protein and slow the accumulation and spread of the virus. To determine if SEC has a role in infection by other pathogens, wild-type and sec-2 plants were infiltrated with either a Pseudomonas syringae pv. tomato strain DC3000 that had the AvrRpt2 gene, or a control strain that lacked AvrRpt2. After 3 d, viable bacteria were recovered from inoculated leaves and titred. In the presence of AvrRpt2, which elicits a gene-for-gene resistance response, there were 103.9±0.4 colony-forming units cm–2 of leaf for Col versus 104.1±0.1 for sec-2, and virulent controls were also not different (Col, 105.9±0.2; sec-2, 105.9±0.3).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary materialReferences |
|---|
To learn more about the role of OGTs in plant development, SEC RNA expression was examined and a detailed analysis of the phenotypes of sec plants was performed. There are several lines of evidence that the T-DNA alleles used in this study produce little or no functional OGT. SEC mRNA is greatly reduced in sec-1 (Fig. 2) and because the T-DNA insert is within an exon upstream of the catalytic domain (Hartweck et al., 2002
) this mRNA is unlikely to encode a protein with OGT activity. Although the T-DNA in sec-2 is located in an intron, no mRNA from the region downstream of the T-DNA was detected (Fig. 3) and therefore a functional OGT is probably not encoded by this allele. In support of this, sec-1 and -2 prevent detectable O-GlcNAc modification of the coat protein of Plum pox virus (Chen et al., 2005). SEC mRNA was detected in all of the organs examined and therefore appears to be ubiquitously expressed (Fig. 1). No evidence was found for RNA level regulation of SEC expression by ABA, ACC, BA, BR, GA, MJ, or NAA (data not shown). However, SEC mRNA levels were elevated in spy seedlings and SPY mRNA levels were elevated in sec seedlings (Fig. 2; Table 1), indicating that SEC and SPY either directly or indirectly regulate the mRNA level of each other. Surprisingly, SPY mRNA was elevated in spy-3 plants suggesting that SPY negatively regulates its own mRNA or that the spy-3 mutation directly stabilizes the mRNA.
Previous studies have shown that SEC and SPY have overlapping functions in reproductive development (Hartweck et al., 2002) and that SEC also has a unique function, promoting the spread of Plum pox virus (Chen et al., 2005). To define the role of SEC further, an extensive phenotypic characterization of sec-1 and -2 both alone and in combination with ga1 and spy was performed.
SPY has two roles in flowering, it delays flowering both by inhibiting the induction of flowering by long days and acting as a negative regulator of the GA pathway (Jacobsen and Olszewski, 1993, 1996; Silverstone et al., 1997b; Swain et al., 2001; Tseng et al., 2004). In contrast to SPY, SEC may not have a direct role in flowering. sec-1 and sec-2 did not affect the number of days to flowering under long days, but did reduce the number of leaves present at flowering. The mutants had fewer leaves at flowering because the rate of rosette leaf production declined prior to flowering (Fig. 4). An analysis of the data in Tseng (2001), indicated that spy mutants also produce leaves at a slower rate than wild type (spy-4, 0.37 and Col, 0.47 leaves d–1). The simplest explanation for these results is that SEC and SPY both have roles in rate of leaf production that are not directly related to flowering time. This difference in leaf production rate suggests the possibility that the overall growth rate of the mutants is reduced. Arguing against this possibility is the fact that hypocotyl length under several growth conditions, and root length were not affected in sec (Table 6). Consistent with this possibility, are the observations that the shoots of both sec (this study) and spy (Swain et al., 2001) plants are shorter at flowering and as discussed below leaf growth is affected by sec.
SEC is a promoter of leaf growth (Table 6). sec-2 causes a reduction in the length of specific leaves (Table 6). This reduction is primarily due to an effect on petiole length. Interestingly, the leaves that are most affected by sec-2 are forming at the time when the effect of sec-2 on the rate of leaf production is greatest (not shown). Consistent with the effect on leaf growth, sec-1 and sec-2 in both wild type and ga1 backgrounds reduced rosette diameter although this difference was only significant in the ga1 background (Tables 2, 7). SPY has a complex role in leaf growth (Swain et al., 2001). In addition to inhibiting leaf growth by acting as a negative regulator of GA responses, SPY also promotes leaf growth by an unknown mechanism. In a ga1 background, spy increases rosette diameter presumably because the increased growth due to activation of GA signalling more than compensates for loss of growth promotion from the other pathway. In a wild-type background, spy has little effect on GA signalling because it is already high and thus the major phenotype is a reduction in growth due to effects on the other pathway. Since in a ga1 background sec reduces rosette diameter, SEC must have either no role or a smaller role than SPY in GA signalling.
To determine if SEC has any role in GA responses, the phenotypes of ga1 plants were compared to sec ga1 double mutants. For every phenotype examined, sec ga1 double mutants were indistinguishable from ga1 plants. GA dose–response curves for germination (Supplemental Fig. 2, see JXB online) and growth (not shown) were similar for the double mutant and ga1 indicating that both genotypes had a similar sensitivity to GA. While these data suggest that SEC does not have a role in GA responses, there is a reluctance to rule this out because it has recently been found that RGA, a negative regulator of GA signalling (Silverstone et al., 1997a; Sun and Gubler, 2004), can be O-GlcNAc modified by Escherichia coli-expressed SEC (LM Hartweck and NE Olszewski, unpublished results). Moreover, since SPY RNA is elevated in sec plants, it is possible that the increased amounts of SPY in these plants compensates for the loss of SEC. Although the observation that SEC RNA levels are elevated in spy could suggest that SEC does not have a role in GA responses, it is possible that SPY has a greater role in the process and that the elevation of SEC in spy mutants is not sufficient to compensate for the loss of SPY.
To address the role of SEC in GA responses further, SEC/sec-1 spy-4/spy-4 ga1/ga1 and sec-1/sec-1 SPY /spy-4 ga1/ga1 plants were created. Surprisingly, SEC/sec-1 spy-4/spy-4 ga1/ga1 did not germinate without GA treatment. This observation could suggest that SEC has a positive role in GA responses, but this is not supported because sec ga1 seeds respond normally to GA (for supplementary Fig. 2, see JXB online). Furthermore, suppression of other ga1 phenotypes is similar in both SEC/sec-1 spy-4/spy-4 ga1/ga1 and spy-4 ga1 plants. Therefore, it is more likely that SEC has a GA-independent role in promoting germination. Under this model, normal function of the GA pathway or ‘SEC pathway’ is required for germination. In SEC/sec-1 spy-4/spy-4 ga1/ga1 seeds loss of spy function does not sufficiently activate the GA pathway and haplo-insufficiency for SEC reduces the activity of the ‘SEC pathway.’ The responses of these genotypes to treatment with GA have not been characterized in detail because, as discussed above, they are present at a low frequency in segregating populations. The authors are in the process of constructing genetic stocks to produce these genotypes more easily for further characterization.
The analysis of the sec-1/sec-1 SPY /spy-4 ga1/ga1 plants indicates that GA, SEC, and SPY interact during reproductive development but suppression of ga1 did not occur. At the time of flowering, sec-1/sec-1 SPY /spy-4 ga1/ga1 plants produced proliferations of pin-like structures instead of a floral shoot and flowers (Fig. 5). The pins did not elongate and never developed into flowers or any other identifiable organs. However, treatment of this genotype with GA3 prior to the initiation of pins prevented pin formation and allowed the production of fertile flowers (not shown). The origin of pin-like structures of sec-1/sec-1 SPY /spy-4 ga1/ga1 plants is unclear, but the proliferation of multiple pin-like structures of equal length suggests that multiple primordia at the meristem develop into these structures. The meristem could be a novel meristem that is an incompletely converted vegetative meristem or an inflorescence meristem in which each floral primordium gives rise to a pin-like structure and that a bolting stem either does not form or does not elongate.
As far as is known, production of a proliferation of pin-like structures at the time of reproduction has not been observed previously. However, single pin-like structures at flowering have been observed in plants with mutations in genes involved in auxin response: PIN1, PINIOD, MONOPTEROS, and PINHEAD/ARGONAUT (Bennett et al., 1995; Przemeck et al., 1996; Galweiler et al., 1998; Hardtke and Berleth, 1998; Lynn et al., 1999; Christensen et al., 2000; Vernoux et al., 2000). Pins can also be induced by application of auxin transport inhibitors and they can be suppressed by local application of auxin (Reinhardt et al., 2000). Because floral organs form on pins after application of auxin, it has been proposed that auxin affects radial position and size but not the identity of organs (Reinhardt et al., 2000). The DORNRÖSCHEN/ENHANCER OF SHOOT REGENERATION1 mutant also forms pins during development, but it is not known what pathways are affected by the mutation (Kirch et al., 2003).
Since the pin-like structures of sec-1/sec-1 SPY /spy-4 ga1/ga1 plants are suppressed by treatment with GA, GA is either involved directly with SEC and SPY in this process or acts in a pathway that is parallel to SEC and SPY. It is known that GA and SPY have roles in meristems (Hay et al., 2002). The biosynthesis and action of GA within the meristem is subject to regulation by a number of factors. Auxin regulates GA biosynthesis in pea and tobacco (Yang et al., 1996; Tanaka-Ueguchi et al., 1998; Sakamoto et al., 2001; Wolbang and Ross, 2001; O'Neill and Ross, 2002). Transcription factors, FUS and KNOX produced during meristem development also affect GA biosynthesis at the meristem (Hay et al., 2002; Gazzarrini et al., 2004). Furthermore, auxin regulates GA response in Arabidopsis (Fu and Harberd, 2003). Because SPY acts in the GA pathway, it can affect the meristem in a GA-dependent manner. However, SPY can also act at the meristem in a GA-independent manner, because although phyllotaxy is altered in spy mutant plants, it is not affected by manipulation of GA levels in Arabidopsis (Swain et al., 2001). Therefore the pin-like phenotypes might result from imbalances between auxin-, GA-, SEC-, and/or SPY-mediated processes.
SEC/sec-1 spy-4/spy-4 ga1/ga1 plants flowered normally, but some flowers from every plant had extra carpels. This phenotype is observed in spy-2 plants (Jacobsen and Olszewski, 1993), but is not observed in sec-1 and spy-4 plants and occurs infrequently in spy-4 ga1 mutants (data not shown). This suggests that heterozygosity at the SEC locus is enhancing a spy phenotype, and therefore the two genes have partially overlapping functions in carpel development.
Since SEC/sec-1 spy-4/spy-4 ga1/ga1 plants flowered instead of producing pins, SEC and SPY are not functionally equivalent during early reproductive development. There are a number of possible mechanisms to explain this lack of equivalence. There could be differences in the enzyme abundance, regulation of the enzymes or differences in activity toward specific substrates. SEC and SPY could also act at different points in a pathway or pathways controlling flowering. Determining the substrates of SEC and SPY will address these possibilities.
|
Supplementary material |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary materialReferences |
|---|
Two supplementary figures are available at JXB online.
|
Acknowledgements |
|---|
We are grateful for the help of Patricia Gordon, Saba Zafari, and Dr David Marks for assistance with experiments. This work was supported by the National Science Foundation grant (MCB-0112826) to NEO and by the US Department of Energy grant (DE-FG01-04ER04) to NEO and LMH.
|
Footnotes |
|---|
Abbreviations: ABA, abscisic acid; ACC, 1-aminocyclopropane carboxylic acid; BA, N6-benzyladenine; BR, brassinolide; Col, Columbia; GA, gibberellin; O-GlcNAc, O-linked N-acetylglucosamine; MJ, methyl jasmonate; MS, Murashige and Skoog; NAA,
-naphthalene acetic acid; OGT, O-linked GlcNAc transferase; PAC, Paclobutrazol; PCR, polymerase chain reaction; WS, Wassilewskija. |
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionSupplementary materialReferences |
|---|
Arnold CS, Johnson GV, Cole RN, Dong DL, Lee M, Hart GW. 1996. The microtubule-associated protein tau is extensively modified with O-linked N-acetylglucosamine. Journal of Biological Chemistry 271, 28741–28744.
Bennett SRM, Alvarez J, Bossinger G, Smyth DR. 1995. Morphogenesis in pinoid mutants of Arabidopsis thaliana. The Plant Journal 8, 505–520.
Buse MG, Robinson KA, Marshall BA, Hresko RC, Mueckler MM. 2002. Enhanced O-GlcNAc protein modification is associated with insulin resistance in GLUT1-overexpressing muscles. American Journal of Physiology, Endocrinology and Metabolism 283, E241–250.
Chen D, Juárez S, Hartweck L, Alamillo JM, Simón-Mateo C, Pérez JJ, Fernández-Fernández MR, Olszewski NE, García JA. 2005. Identification of SECRET AGENT as the O-GlcNAc TRANSFERASE that participates in plum pox virus infection. Journal of Virology 79, 9381–9387.
Cheng X, Hart GW. 2001. Alternative O-glycosylation/O-phosphorylation of serine-16 in murine estrogen receptor beta: post-translational regulation of turnover and transactivation activity. Journal of Biological Chemistry 276, 10570–10575.
Chou TY, Hart GW, Dang CV. 1995. c-Myc is glycosylated at threonine 58, a known phosphorylation site and a mutational hot spot in lymphomas. Journal of Biological Chemistry 270, 18961–18965.
Christensen SK, Dagenais N, Chory J, Weigel D. 2000. Regulation of auxin response by the protein kinase PINOID. Cell 100, 469–478.[CrossRef][Web of Science][Medline]
Comer FI, Vosseller K, Wells L, Accavitti MA, Hart GW. 2001. Characterization of a mouse monoclonal antibody specific for O-linked N-acetylglucosamine. Analytical Biochemistry 293, 169–177.[CrossRef][Web of Science][Medline]
Daniels MB, Turner PC, Clearly WG, Sawczyc MK. 1984. Isolation of mutants of Xanthomonas campestris pv. campestris showing altered pathogenicity. Journal of General Microbiology 130, 2447–2455.
Filardo FF, Swain SM. 2003. SPYing on GA signaling and plant development. Journal of Plant Growth Regulation 22, 163–175.
Fu X, Harberd NP. 2003. Auxin promotes Arabidopsis root growth by modulating gibberellin response. Nature 421, 740–743.[CrossRef][Medline]
Galweiler L, Guan C, Muller A, Wisman E, Mendgen K, Yephremov A, Palme K. 1998. Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science 282, 2226–2230.
Gao Y, Wells L, Comer FI, Parker GJ, Hart GW. 2001. Dynamic O-glycosylation of nuclear and cytosolic proteins: cloning and characterization of a neutral, cytosolic ß-N-acetylglucosaminidase from human brain. Journal of Biological Chemistry 276, 9838–9845.
Gazzarrini S, Tsuchiya Y, Lumba S, Okamoto M, McCourt P. 2004. The transcription factor FUSCA3 controls developmental timing in Arabidopsis through the hormones gibberellin and abscisic acid. Developmental Cell 7, 373–385.[CrossRef][Web of Science][Medline]
Greenboim-Wainberg Y, Maymon I, Borochov R, Alvarez J, Olszewski N, Ori N, Eshed Y, Weiss D. 2005. Cross talk between gibberellin and cytokinin: the Arabidopsis GA response inhibitor SPINDLY plays a positive role in cytokinin signaling. The Plant Cell 17, 92–102.
Guinez C, Morelle W, Michalski JC, Lefebvre T. 2005. O-GlcNAc glycosylation: a signal for the nuclear transport of cytosolic proteins? International Journal of Biochemistry and Cell Biology 37, 765–774.[CrossRef][Web of Science][Medline]
Haltiwanger RS, Holt GD, Hart GW. 1990. Enzymatic addition of O-GlcNAc to nuclear and cytoplasmic proteins. Identification of a uridine diphospho-N-acetylglucosamine:peptide ß-N-acetylglucosaminyltransferase. Journal of Biological Chemistry 265, 2563–2568.
Hardtke CS, Berleth T. 1998. The Arabidopsis gene MONOPTEROS encodes a transcription factor mediating embryo axis formation and vascular development. European Molecular Biology Organization Journal 17, 1405–1411.
Hartweck LM, Scott CL, Olszewski NE. 2002. Two O-linked N-acetylglucosamine transferase genes of Arabidopsis thaliana L. Heynh. have overlapping functions necessary for gamete and seed development. Genetics 161, 1279–1291.
Hay A, Kaur H, Phillips A, Hedden P, Hake S, Tsiantis M. 2002. The gibberellin pathway mediates KNOTTED1-type homeobox function in plants with different body plans. Current Biology 12, 1557–1565.[CrossRef][Web of Science][Medline]
Izhaki A, Swain SM, Tseng T-S, Borochov A, Olszewski NE, Weiss D. 2001. The role of SPY and its TPR domain in the regulation of gibberellin action throughout the life cycle of Petunia hybrida plants. The Plant Journal 28, 1–11.[CrossRef][Web of Science][Medline]
Jacobsen SE, Binkowski KA, Olszewski NE. 1996. SPINDLY, a tetratricopeptide repeat protein involved in gibberellin signal transduction in Arabidopsis. Proceedings of the National Academy of Sciences, USA 93, 9292–9296.
Jacobsen SE, Olszewski NE. 1993. Mutations at the SPINDLY locus of Arabidopsis alter gibberellin signal transduction. The Plant Cell 5, 887–896.
Jacobsen SE, Olszewski NE. 1996. Gibberellins regulate the abundance of RNAs with sequence similarity to proteinase inhibitors, dioxygenases and dehydrogenases. Planta 198, 78–86.[Web of Science][Medline]
Kelly WG, Dahmus ME, Hart GW. 1993. RNA polymerase II is a glycoprotein. Modification of the COOH-terminal domain by O-GlcNAc. Journal of Biological Chemistry 268, 10416–10424.
Khidekel N, Ficarro SB, Peters EC, Hsieh-Wilson LC. 2004. Exploring the O-GlcNAc proteome: direct identification of O-GlcNAc-modified proteins from the brain. Proceedings of the National Academy of Sciences, USA 101, 13132–13137.
Kirch T, Simon R, Grunewald M, Werr W. 2003. The DORNRÖSCHEN/ENHANCER OF SHOOT REGENERATION1 gene of Arabidopsis acts in the control of meristem cell fate and lateral organ development. The Plant Cell 15, 694–705.
Koornneef M, van der Veen JH. 1980. Induction and analysis of gibberellin-sensitive mutants in Arabidopsis thaliana (L.) Heynh. Theoretical and Applied Genetics 58, 257–263.[CrossRef][Web of Science]
Lynn K, Fernandez A, Aida M, Sedbrook J, Tasaka M, Masson P, Barton MK. 1999. The PINHEAD/ZWILLE gene acts pleiotropically in Arabidopsis development and has overlapping functions with the ARGONAUTE1 gene. Development 126, 469–481.[Abstract]
O'Donnell N, Zachara NE, Hart GW, Marth JD. 2004. Ogt-dependent X-chromosome-linked protein glycosylation is a requisite modification in somatic cell function and embryo viability. Molecular and Cellular Biology 24, 1680–1690.
O'Neill DP, Ross JJ. 2002. Auxin regulation of the gibberellin pathway in pea. Plant Physiology 130, 1974–1982.
Olszewski N, Sun T-P, Gubler F. 2002. Gibberellin signaling: biosynthesis, catabolism, and response pathways. The Plant Cell 14, S61–S80.
Przemeck GK, Mattsson J, Hardtke CS, Sung ZR, Berleth T. 1996. Studies on the role of the Arabidopsis gene MONOPTEROS in vascular development and plant cell axialization. Planta 200, 229–237.[Web of Science][Medline]
Reinhardt D, Mandel T, Kuhlemeier C. 2000. Auxin regulates the initiation and radial position of plant lateral organs. The Plant Cell 12, 507–518.
Robertson M, Swain SM, Chandler PM, Olszewski NE. 1998. Identification of a negative regulator of gibberellin action, HvSPY, in barley. The Plant Cell 10, 995–1007.
Sakamoto T, Miura K, Itoh H, et al. 2004. An overview of gibberellin metabolism enzyme genes and their related mutants in rice. Plant Physiology 134, 1642–1653.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Shafi R, Iyer SP, Ellies LG, O'Donnell N, Marek KW, Chui D, Hart GW, Marth JD. 2000. The O-GlcNAc transferase gene resides on the X chromosome and is essential for embryonic stem cell viability and mouse ontogeny. Proceedings of the National Academy of Sciences, USA 97, 5735–5739.
Silverstone AL, Chang C-W, Krol E, Sun T-P. 1997a. Developmental regulation of the gibberellin biosynthetic gene GA1 in Arabidopsis thaliana. The Plant Journal 12, 9–19.[CrossRef][Web of Science][Medline]
Silverstone AL, Mak PYA, Casamitjana Martínez E, Sun T-P. 1997b. The new RGA locus encodes a negative regulator of gibberellin response in Arabidopsis thaliana. Genetics 146, 1087–1099.[Abstract]
Snedecor GW, Cochran WG. 1980. Statistical methods, 7th edn. Ames, Iowa: Iowa State University Press.
Sothern RB, Tseng TS, Orcutt SL, Olszewski NE, Koukkari WL. 2002. GIGANTEA and SPINDLY genes linked to the clock pathway that controls circadian characteristics of transpiration in Arabidopsis. Chronobiology International 19, 1005–1022.[CrossRef][Web of Science][Medline]
Sun T-P, Kamiya Y. 1994. The Arabidopsis GA1 locus encodes the cyclase ent-kaurene synthetase A of gibberellin biosynthesis. The Plant Cell 6, 1509–1518.[Abstract]
Sun TP, Gubler F. 2004. Molecular mechanism of gibberellin signaling in plants. Annual Review of Plant Biology 55, 197–223.[CrossRef][Medline]
Swain SM, Muller AJ, Singh DP. 2004. The gar2 and rga alleles increase the growth of gibberellin-deficient pollen tubes in Arabidopsis. Plant Physiology 134, 694–705.
Swain SM, Singh DP. 2005. Tall tales from sly dwarves: novel functions of gibberellins in plant development. Trends in Plant Science 10, 123–129.[Web of Science][Medline]
Swain SM, Tseng T-S, Thornton TM, Gopalraj M, Olszewski NE. 2002. SPINDLY is a nuclear-localized repressor of gibberellin signal transduction expressed throughout the plant. Plant Physiology 129, 605–615.
Swain SM, Tseng TS, Olszewski NE. 2001. Altered expression of SPINDLY affects gibberellin response and plant development. Plant Physiology 126, 1174–1185.
Tanaka-Ueguchi M, Itoh H, Oyama N, Koshioka M, Matsuoka M. 1998. Over-expression of a tobacco homeobox gene, NTH15, decreases the expression of a gibberellin biosynthetic gene encoding GA 20-oxidase. The Plant Journal 15, 391–400.[CrossRef][Web of Science][Medline]
Telfer A, Bollman KM, Poethig RS. 1997. Phase change and the regulation of trichome distribution in Arabidopsis thaliana. Development 124, 645–654.[Abstract]
Thornton TM, Swain SM, Olszewski NE. 1999. Gibberellin signal transduction presents ... the SPY who O-GlcNAc'd me. Trends in Plant Science 4, 424–428.[CrossRef][Web of Science][Medline]
Tseng TS. 2001. Functional analyses of the tetratricopeptide repeat domain of SPINDLY. IV. Arabidopsis SPINDLY interacts with GIGANTEA: implication for the interrelationship of gibberellin and light signaling pathways. PhD thesis, University of Minnesota, USA, 78–106.
Tseng TS, Salome PA, McClung CR, Olszewski NE. 2004. SPINDLY and GIGANTEA interact and act in Arabidopsis thaliana pathways involved in light responses, flowering, and rhythms in cotyledon movements. The Plant Cell 16, 1550–1563.
Vernoux T, Kronenberger J, Grandjean O, Laufs P, Traas J. 2000. PIN-FORMED 1 regulates cell fate at the periphery of the shoot apical meristem. Development 127, 5157–5165.[Abstract]
Wells L, Hart GW. 2003. O-GlcNAc turns twenty: functional implications for post-translational modification of nuclear and cytosolic proteins with a sugar. Federation of European Biochemical Societies Letters 546, 154–158.[CrossRef][Web of Science][Medline]
Wells L, Kreppel LK, Comer FI, Wadzinski BE, Hart GW. 2004. O-GlcNAc transferase is in a functional complex with protein phosphatase 1 catalytic subunits. Journal of Biological Chemistry 279, 38466–38470.
Wells L, Vosseller K, Hart GW. 2003. A role for N-acetylglucosamine as a nutrient sensor and mediator of insulin resistance. Cellular and Molecular Life Sciences 60, 222–228.[CrossRef][Web of Science][Medline]
Whalen MC, Innes RW, Bent AF, Staskawicz BJ. 1991. Identification of Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean. The Plant Cell 3, 49–59.
Wilson RN, Somerville CR. 1995. Phenotypic suppression of the gibberellin-insensitive mutant (gai) of Arabidopsis. Plant Physiology 108, 495–502.[Abstract]
Wolbang CM, Ross JJ. 2001. Auxin promotes gibberellin biosynthesis in decapitated tobacco plants. Planta 214, 153–157.[Web of Science][Medline]
Yang T, Davies PJ, Reid JB. 1996. Genetic dissection of the relative roles of auxin and gibberellin in the regulation of stem elongation in intact light-grown peas. Plant Physiology 110, 1029–1034.[Abstract]
Zhang F, Su K, Yang X, Bowe DB, Paterson AJ, Kudlow JE. 2003. O-GlcNAc modification is an endogenous inhibitor of the proteasome. Cell 115, 715–725.[CrossRef][Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  J. A. Simon Sweet Silencing Science, July 3, 2009; 325(5936): 45 - 46. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Molesini, T. Pandolfini, G. L. Rotino, V. Dani, and A. Spena Aucsia Gene Silencing Causes Parthenocarpic Fruit Development in Tomato Plant Physiology, January 1, 2009; 149(1): 534 - 548. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||