JXB Advance Access originally published online on March 2, 2006
Journal of Experimental Botany 2006 57(5):1119-1128; doi:10.1093/jxb/erj093
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH PAPER |
Identification of plant stress-responsive determinants in arabidopsis by large-scale forward genetic screens
1Department of Horticultural Science and Vegetable and Fruit Improvement Center, 2133 Texas A&M University, College Station, TX 77843-2133, USA
2Center for Plant Environmental Stress Physiology, 625 Agriculture Mall Drive, Purdue University, West Lafayette, IN 47907-2010, USA
* To whom correspondence should be addressed. E-mail: koiwa{at}neo.tamu.edu
Received 3 August 2005; Accepted 9 December 2005
| Abstract |
|---|
|
|
|---|
All plants sense and adapt to adverse environmental conditions, however, crop plants exhibit less genetic diversity for abiotic stress tolerance than do wild relatives indicating that a genetic basis exists for stress adaptability. Model plant genetic systems and the plethora of molecular genetic resources that are currently available are greatly enhancing our ability to identify abiotic stress-responsive genetic determinants. Forward genetic screens of T-DNA mutagenized Arabidopsis thaliana populations in the genetic background of ecotypes C24RD29a-LUC and Col-0 gl1 sos3-1 were carried out to begin an exhaustive search for such determinants. The C24RD29a-LUC screens identified mutants with altered salt/osmotic stress sensitivity or mutants with altered expression of the salt/osmotic/cold/ABA-responsive RD29a gene. Also, mutations that alter the NaCl sensitivity of sos3-1 were screened for potential genetic suppressors or enhancers of salt-stress responses mediated by SOS3. In total, more than 250 000 independent insertion lines were screened and greater than 200 individual mutants that exhibited altered stress/ABA responses were recovered. Although several of these mutants have been reported, most have not yet been studied in detail. Notable examples include novel alleles of SOS1 and mutations to genes encoding the STT3a subunit of the oligosaccharyltransferase, syntaxin, RNA polymerase II CTD phosphatases, transcription factors, ABA biosynthetic enzyme, Na+ transporter HKT1, and SUMO E3 ligase. The stress-specific phenotypes of mutations to genes that are involved in many basic cellular functions provide indication of the wide range of control mechanisms in cellular homeostasis that are involved in stress adaptation.
Key words: CCD imaging, osmotic stress, RNA polymerase II, salinity, T-DNA tagging, transcription
| Introduction |
|---|
|
|
|---|
Severe climatic changes throughout millions of years have resulted in the evolution of flora that exhibit substantial genetic diversity for adaptation to environmental perturbations. However, domestication of plants over the millennia has narrowed the genetic diversity that exists in crop species (Buckler et al., 2001
Plants respond to water quantity and quality deficiencies and temperature extremes by initiating adaptive responses that are necessary to alleviate primary and secondary effects caused by these stresses in order to sustain their survival, growth and development (Thomashow, 1999
; Hasegawa et al., 2000
; Iba, 2002
; Zhu, 2002
; Bohnert et al., 2005
). The exact stress sensory mechanisms are yet to be resolved, but it is clear that perception leads to activation of signal transduction pathways that control adaptive responses (Stockinger et al., 1997
; Liu et al., 1998
; Xiong and Zhu, 2001
; Zhu, 2001
, 2002
). The signalling components and their target genes are the focus of intense research efforts. The task is daunting because responses to abiotic stresses have overlapping etiologies and therefore involve several signalling systems (Xiong and Zhu, 2001
; Seki et al., 2003
). It is clear that abiotic stress-responsive signal pathways are also modulated and amplified by hormonal and other signals, and connect to growth and development pathways. Signalling in these complex biological systems requires continuous modulation that necessitates precise positive and negative regulatory cues throughout the signal system. Because of this complexity, a robust molecular genetic model plant system like Arabidopsis thaliana is necessary for the functional dissection of the adaptive response system. Even though arabidopsis is not a particularly stress-tolerant plant, it does have the ability, like all plants, to sense and respond adaptively to abiotic stresses (Hasegawa et al., 2000
; Zhu, 2002
, 2003
) allowing its formidable molecular genetic attributes to be utilized to some degree.
Plant stress adaptation responses include dynamic transcriptome changes that are presumed to play an important role in the co-ordination of the many different molecular responses responsible for cellular and organismal homeostasis. In arabidopsis, RESPONSIVE TO DEHYDRATION (RD) and COLD-REGULATED (COR) genes are major members of the osmotically regulated transcriptome and both abscisic acid (ABA)-independent and -dependent pathways are involved in their control (Yamaguchi-Shinozaki and Shinozaki, 2005
). ABA mediates gene expression through a series of pathways that culminate in the interaction of basic leucine zipper transcription factors (ABF/AREBs) with ABREs (ABA-responsive elements) (Choi et al., 1999
; Uno et al., 2000
) that exist in the promoters of several RD and COR genes. RD or COR gene activation by low temperature or desiccation that is independent of ABA occurs through the interaction of other transcription factors called CBF/DREB DNA-binding proteins with the C-repeat/DRE type cis-elements (Stockinger et al., 1997
; Liu et al., 1998
). Overexpression of CBF/DREB proteins in transgenic arabidopsis plants induces ectopic expression of RD/COR genes and confers desiccation and cold tolerance (Jaglo-Ottosen et al., 1998
; Kasuga et al., 1999
). The arabidopsis RD29a promoter contains both DRE and ABRE cis elements and is thus a convergence point for these two pathways that link ABA and osmotic stress signalling (Narusaka et al., 2003
). The RD29a promoter and luciferase (LUC) reporter system has been used for extensive genetic analyses resulting in the identification of numerous genes that positively and negatively control osmotic stress signalling (Ishitani et al., 1997
, 1998
; Gong et al., 2002
; Guo et al., 2002
; Koiwa et al., 2002
; Lee et al., 1999
, 2001
, 2002
; Xiong et al., 1999b
, 2001a
, b
, c
, 2002a
, b
).
The Salt-Overly-Sensitive (SOS) signalling pathway is a major regulatory cascade that controls Na+ homeostasis in response to high salinity. A forward genetic screen for mutations that cause NaCl hypersensitivity of arabidopsis seedlings led to the identification of the first major components of the pathway SOS1, SOS2, and SOS3 (Zhu, 2002
; Chinnusamy et al., 2005
). The plasma membrane SOS1 Na+/H+ antiporter is a principal target of the pathway (Shi et al., 2000
, 2003
). SOS1 is the primary transport system responsible for cellular Na+ efflux (Zhu, 2003
) and controls Na+ loading into the xylem of the root thereby restricting accumulation of the toxic ion in the shoot (Shi et al., 2002
). Furthermore, SOS1 is localized in the epidermis, particularly in the root tip where ion exclusion is a primary mechanism for the salinity tolerance of cells that are critical for growth and differentiation and have an underdeveloped vacuole where Na+ could otherwise be transported for detoxification (Shi et al., 2002
). Current models indicate that the EF hand Ca2+ binding protein, SOS3, is activated in a localized microdomain by a Ca2+ transient that is induced by NaCl stress. Ca2+ binding by SOS3 facilitates its interaction with the SNF-like kinase SOS2 resulting in its activation through the repression of autoinhibition (Guo et al., 2001
; Halfter et al., 2000
). Activated SOS2 is then recruited to the plasmamembrane and phosphorylates SOS1 leading to activation of its Na+/H+ antiporter activity (Quintero et al., 2002
). Furthermore, SOS1 has also been suggested to function as a Na+ sensor and is known to mediate control of target gene expression (Zhu, 2003
).
As a part of the plant stress genome project (National Science Foundation Plant Genome Award DBI-98-13360), T-DNA populations were generated in the genetic backgrounds of C24 RD29a::LUC and Col-0 sos3-1. A forward genetic screen of the C24 RD29a::LUC population identified mutations that alter the responsiveness to NaCl, cold, and ABA while a screen of the Col-0 gl1 sos3-1 population identified suppressor and enhancer mutations of sos3-1 NaCl hypersensitivity. Herein the results of these forward genetic screens for stress-tolerance determinants are summarized.
| Materials and methods |
|---|
|
|
|---|
Biological materials
Dr Jian-Kang Zhu and Dr Richard Walden kindly provided Arabidopsis thaliana Col-0 gl1 sos3-1 (Liu and Zhu, 1997
Plasmid materials
Dr Detlef Weigel kindly provided the T-DNA activation tagging plasmid pSK015, (Weigel and Ahn, 2000
). Plasmids p1933-apx encoding the arabidopsis ubiquitin promoter and pU
P
X containing the superpromoter were provided by Dr Phillip Mullineaux and Dr Stan Gelvin (Ni et al., 1995
), respectively. Dp620 containing the bar gene and the potato pinII terminator was provided by Pioneer Hybred. The pBIB-HYG plasmid (Becker, 1990
) was provided by Dr Xiaomu Niu. To construct pSuperTag2, a 0.25 kbp BamHI-HindIII fragment was excised from p1933-apx, blunted and cloned into pBC, which was digested with SpeI and then blunted to produce pBC-Ubi. A 0.88 kbp BamHI-EcoRI fragment containing the bar ORF-PinII terminator was cloned into the BamHI and EcoRI sites of pBluescript to produce pBS-bar. The ubiquitin promoter was excised from pBC-Ubi by NotI and BamHI restriction and ligated into the NotI and BamHI sites of pBS-bar that are upstream of the bar ORF to produce pBS-Ubi-bar. A 1.2 kbp HindIII-XbaI fragment containing the superpromoter was cloned into pBC to produce pBC-super. pBC-super was then digested with HindIII, blunted, and digested with XbaI to excise the superpromoter. pBS-Ubi-bar was digested by NotI, blunted, digested with XbaI, and ligated to the superpromoter fragment to produce pBSSP-Ubi-bar. pBS-Super-Ubi-bar was cleaved with XbaI and ligated with a 3.7 kbp XbaI fragment of pSKI015 containing the T-DNA border sequence and a replication origin for Agrobacterium to produce pSuperTag. Because an ATG codon existed in the ubiquitin promoter, pSuperTag was digested with EcoRI, blunted, digested with HindIII, and ligated with a 0.88 kbp fragment from pBS-bar, which was digested with BamHI, blunted with mung bean nuclease, and digested with HindIII, to produce pSuperTag2 (pSPT2, Fig. 1). pSPT2 and pSKI015 were introduced into Agrobacterium tumefaciens GV3101 pMP90RK by electroporation and used for transformation of arabidopsis by using a floral dip or spray method (Clough and Bent, 1998
; Chung et al., 2000
).
|
Arabidopsis transformation and herbicide selection of T1 plants
Seeds dried to a moisture content of
5% were stratified for 510 d at 4 °C in the dark and then sown onto the soil surface. Alternatively, seeds were sown onto moist soil surface and stratified at 4 °C in the dark for 310 d. Seeds were germinated in high humidity obtained by using a mist system or by covering the soil with a transparent plastic cover and subsequently grown in the greenhouse. After plants produced a primary inflorescence stalk, the stalk was removed to enhance development of secondary inflorescences. Plants with inflorescences at a stage just prior to anthesis were used for transformation (Clough and Bent, 1998Arabidopsis plants were transformed with Agrobacterium tumefaciens GV3101 pMP90RK that harboured the binary vector pSKI015 by immersion of inflorescences, or spraying with an Agrobacterium suspension. Sprayed or immersed plants were then kept in a closed environment to maintain a high humidity so that floral surfaces remained wet for 24 h. Plants were retransformed 2 weeks later and grown to maturity in the greenhouse. Phosphinothricin (Liberty/Finale) resistant T1 seedlings were identified after successive rounds of herbicide (50 µg ml1) spraying (usually for 3 consecutive days followed by a week without spraying. This cycle was usually repeated 23 times. Seeds were collected from surviving plants and maintained in pools of 1050 plants each.
Root growth screening
Sensitivity of root growth was determined using a modified root-bending growth assay (Liu and Zhu, 1997
). Seed germination plates were prepared by placing hydrated cellophane membranes (Bio-Rad) that were autoclave sterilized onto solid medium containing 1x MS salt, B5 vitamins, 3% sucrose, 1.6% agar (germination medium). About 200 T2 seeds per 10-line pool were surface-sterilized in 70% ethanol for 20 s and then in 10% laundry bleach (Na+ hypochlorite) solution for 5 min, and rinsed three times with sterilized distilled water. Sterilized seeds were resuspended in 200 µl of a 0.1% agar (Sigma) solution. A drop of Agribrom solution (1500 ppm) was added to the seed suspension, and seeds were stratified at 4 °C in the dark for 4 d before plating. Individual seeds were sown along a level horizontal line onto the surface of the cellophane membrane. Plates were oriented vertically (180°) with the seed line parallel to the shelf surface in a growth room (25 °C, 16/8 h light/dark cycle). After 7 or 8 d (roots 710 mm in length), seedlings were transferred by placing the cellophane membrane directly onto fresh medium containing 160 mM NaCl. Plates were then placed upside-down in a vertical position in a growth room. After an additional 7 d, the seedlings were evaluated for root growth in the opposite direction (180° bend) from the growth that occurred prior to transfer to NaCl.
Luciferase imaging
Luminescence imaging was performed as described (Xiong et al., 1999a
) using a CCD system (RoperScientific, NJ). Seeds were surface-sterilized as above, inoculated onto medium containing 1x MS salt, 3% sucrose, and 0.6% agar, and kept under a 16/8 h light/dark cycle for 1 week. The optimum conditions to induce RD29a-LUC expression were established previously (Ishitani et al., 1997
). Briefly, seedlings were exposed to 0 °C in the dark for 2448 h, or sprayed with 100 µM (±)ABA and maintained under light for 3 or 4 h or placed onto filter paper moistened with solution containing 1x MS salts, 3% sucrose, and 300 mM NaCl and maintained in the laboratory for 4 h. For imaging, seedlings were sprayed with an aqueous solution of 1 mM luciferin and 0.1% Triton X100 and incubated for 5 min in the dark. A luminescence image was acquired by a 5 min exposure to the CCD system and analysed using WinView software.
sos3-1 suppressor and enhancer screening
Individual T2 seeds (200 seeds per 10-line pool) were sown onto cellophane membranes that were placed onto solid germination medium. For identification of suppressor and enhancer mutations of sos3-1 NaCl sensitivity, cellophane membranes with seedlings were transferred to medium with 120 mM NaCl. Pools were considered to contain salt-hypersensitive seedlings harbouring mutations if this NaCl treatment resulted in rapid bleaching and lethality. In order to rescue the seedlings, these pools were re-screened on medium containing 75 mM NaCl. Suppressor mutations were identified based on identification of seedlings that were NaCl-tolerant relative to sos3-1 seedlings. Salt sensitivity was determined based on root tip growth and anthocyanin production in leaves. Putative mutant seedlings were transferred to medium without NaCl.
Germination screening for salt tolerance
Seeds were sown onto medium containing 1x MS salt, 2% sucrose, 145 mM NaCl, and 1% agar (pH 5.7). After sowing, the seeds were stratified for 24 d at 4 °C. Germination was assessed visually after 14 d.
Thermal asymmetric interlaced PCR (TAIL-PCR)
Flanking sequence of inserted T-DNA from selected mutants was determined by TAIL-PCR analysis (Rus et al., 2001
; Koiwa et al., 2002
; Zhu et al., 2002
). Genomic DNA was extracted from leaves of 23-week-old plants (Edwards et al., 1991
). TAIL-PCR analysis with pSKI015 was performed using a set of nested left border primers (LB) and complementary strand degenerate primers (Rus et al., 2001
; Koiwa et al., 2002
; Zhu et al., 2002
). TAIL-PCR products were sequenced after gel purification or after cloning into pBluescript-T vector prepared as described (Marchuk et al., 1990
).
Genetic analysis and molecular characterization of T-DNA insertion alleles
Primary screens were conducted on T2 progeny (segregating population) and designed to ensure 95% probability of identifying phenotypes caused by recessive mutations, i.e. minimum of 20 seedlings per line. T3 progeny from individual T2 plants were obtained and phenotypes were re-evaluated to identify homozygous lines. Genetically confirmed homozygous mutant plants were evaluated for co-segregation of herbicide resistance, backcrossed to the wild type, genotypically characterized to identify the flanking sequence and evaluated for the expression of the T-DNA insertion allele. Cause and effect relationship between phenotype and the presence of an insertion allele was established by co-segregation analysis, multiple allele analysis, RNAi gene silencing, and/or genetic complementation.
Allelic homozygosity was confirmed by genotyping using a PCR-based detection analysis. PCR primers that specifically detected either the wild type or T-DNA insertion allele were designed for the analysis. To detect a SOS1 allele with a T-DNA insertion, PCR was performed with the LB3 primer and a gene-specific primer (SOS1F: GTGTCAGGTGTGCAAGCAAC) while the wild-type allele was detected using only gene-specific primers (SOS1F, SOS1R: TCGGAGAATCGATTCTCACAACGAT).
Co-segregation of the phenotype and the T-DNA allele was also evaluated using T2 segregating seedlings reconstituted from backcrosses to the wild type.
After identification of the T-DNA insertion flanking sequence, publicly available populations were monitored for potential additional mutant alleles. The SIGnAL T-DNA express database provided the most instances of a second allele. Plants were genotyped and those that were homozygous for the T-DNA allele were used for further phenotypic analysis.
Gene silencing of wild-type plants using RNAi was also used to phenocopy the mutants originally isolated by screening. The RNAi vector pFGC1008 was obtained from Dr R Jorgensen (University of Arizona). A 5001000 bp cDNA fragment was inserted into pFGC1008 according to the recommended protocol (http://www.chromdb.org/). The resulting RNAi construct was introduced into A. tumefaciens GV3101 and used for arabidopsis transformation as described above. T1 seeds were germinated on medium containing 20 µg ml1 hygromycin B and transformed seedlings were identified. Phenotypic analysis occurred in the T1 and/or T2 generation.
Binary vectors were used to express genomic fragments or cDNAs in order to assess genetic complementation. Transgene expression was driven either using the CaMV 35S or the innate endogenous promoter.
| Results |
|---|
|
|
|---|
Preparation of T-DNA tagged populations
Approximately 180 000 and 100 000 independent T-DNA insertion mutant lines of C24 RD29a::LUC lines and Col-0 gl1 sos3-1, respectively, were obtained using the activation tagging plasmid pSKI015. Several mutant phenotypes that were identified in the C24 RD29a::LUC T1 generation were not evident in the T2 generation. This may indicate silencing of the 35S enhancer (Weigel and Ahn, 2000
|
Root growth screening and mutant identification
A total of 93 840 independent T2 progeny in the C24RD29a-LUC background were screened on medium with 160 mM NaCl. This required phenotypic analysis of about 1.9 million seedlings (20 individuals of each line) in order to ensure a high probability of recovering recessive mutations from pools each with 10 independent lines. The previously established basal media for the screening includes 1x MS and 3% sucrose (Liu and Zhu, 1997
|
Among Group 1 mutants were two independent alleles of SOS1 (sos1-14, sos1-15) (Fig. 3, and not shown). Several NaCl-sensitive mutants were also sensitive to non-ionic osmotic stress imposed by the addition of mannitol to the medium. Root tip growth of mutants sensitive to both NaCl and mannitol was less inhibited by other stress than mutants that were sensitive only to NaCl stress. The IC50s for NaCl/mannitol stress-sensitive mutants were greater than 100 mM solute equivalents compared with IC50s of 5075 mM solute equivalents for the mutants that are sensitive to NaCl only. In addition, NaCl/mannitol stress-sensitive mutants usually hyper-responded to a high concentration of KCl, but their response to LiCl unlike most NaCl-sensitive mutants was similar to wild type. The NaCl/mannitol-sensitive mutants usually exhibited altered stomatal functions as well. Group 1 mutants were found to result from mutations in loci encoding proteins that are involved in a wide range of cellular functions including vesicular trafficking (syntaxin), protein glycosylation (oligosaccharyltransferase) and folding (tetratrico peptide repeat protein), signalling (kinase associated protein phosphatase, transcription factors, fatty acid elongase), and organic solute transport (Major Facilitator Superfamily) (Zhu, 2002
|
Group 2 mutants were not characterized extensively because they exhibit growth alterations that are not specific to osmotic stress.
Salt-tolerance screening
Approximately 11 000 C24RD29a-LUC T2 lines were screened for enhanced capacity for germination and growth on medium containing 145 mM NaCl, and two genetically stable salt-tolerant mutants were isolated. One, sto1, was characterized and its salt-tolerance phenotype was found to result from a T-DNA insertion in the NCED3 gene that encodes an isoform of 9-cis-epoxycarotenoid dioxygenase, an enzyme that catalyses a critical step in ABA biosynthesis in response to osmotic stress (Ruggiero et al., 2004
). Seedlings of sto1 are restricted in capacity for stomatal closing and were also susceptible to dehydration when grown outside the culture dishes where screening was performed.
Screening for suppressor or enhancer mutations of sos3-1 NaCl sensitivity
Seedlings of sos3-1 are NaCl hypersensitive and exhibit K+ deficiency when the external Ca2+ concentration is suboptimal (Liu and Zhu, 1997
). T2 progeny of 70 000 T-DNA tagged lines of Col-0 gl1 sos3-1 were screened for an increase or a further decrease in salt tolerance when grown in medium containing 120 mM NaCl. Putative mutants were identified based primarily on the criteria of shoot and root growth and shoot anthocyanin accumulation in response to NaCl. Eighty-nine lines were isolated that exhibited a genetically stable suppressed or enhanced sos3-1 phenotype. Of these, 16 mutations that suppressed the NaCl sensitive phenotype of sos3-1 were studied further. The strongest suppressor lines were determined to be allelic with mutations in AtHKT1, the gene encoding a transporter that mediates Na+ influx into cells and Na+ homeostasis in planta (Rus et al., 2001
).
Physiological analysis of the hkt1 phenotype revealed that, in addition, to HKT there is a Na+ uptake system(s) that is inhibited by mM levels of
but is operational at sub-mM concentrations of the ion (Rus et al., 2001
, 2004
). Most data reported implicate non-selective cation channels (NSCC)/voltage-insensitive channels (VIC) as the molecular entities responsible for this Ca2+-sensitive Na+-uptake system. There are 20 genes annotated in the arabidopsis database for NSCCs (Demidchik et al., 2002
). Although the NSCCs are categorized as non-selective, those that have been characterized do exhibit some transport specificity (Hua et al., 2003
). To identify any specific NSCCs that may be responsible for Na+ uptake in planta, 70 000 Col gl1 sos3-1 T-DNA insertion lines were screened on medium with 75 mM NaCl and no added Ca2+ ions. Interestingly, this screen did not result in the identification of mutations that can substantially suppress the NaCl-sensitive phenotype of sos3-1. Although three were found and confirmed that very modestly suppress the sos3-1 NaCl-sensitive phenotype. Mutations in a number of genes that encode NSCCs, including one that mediates Na+ conductance (Hua et al., 2003
) have been reported not to cause lethality, suggesting that NSCC family members have overlapping function. It is possible that regulatory genes control several NSCCs that mediate Na+ influx and this study's screen, that was insufficient to saturate the arabidopsis genome, failed to identify such a regulatory component.
Nine mutants exhibited a sos3-1 suppressed phenotype that was less dramatic than that caused by the hkt1 alleles and was only evident on medium containing lower concentrations of NaCl. One of these is a mutation at the AtSIZ1 locus, which encodes a SUMO E3 ligase (Miura et al., 2005
). Mutations of SIZ1 cause sos3-1 seedlings to exhibit not only suppression of NaCl sensitivity but also hyper-responsiveness to Pi starvation based on its modified root architecture and altered expression of target genes of Pi starvation. In addition, 30 flavonoid-deficient mutants were identified, eight with transparent testa and 22 that have normal coloured testa, but fail to accumulate anthocyanins in response to some but not all stresses that normally induce anthocyanin accumulation (M Van Oosten, unpublished data). One dominant mutation resulted in morphological differences that include substantially increased biomass, narrow leaves and large primary inflorescences relative to wild type (H Koiwa, unpublished results).
Thirty-eight mutations enhanced the NaCl sensitivity of sos3-1 seedlings, which is indicative of a function in a NaCl-response pathway or a tolerance mechanism that is at least partly independent of sos3-1. Characterization of two of the mutants has implicated them in the control of cellular redox and adenylate balance (PM Hasegawa, unpublished results).
Luciferase imaging analysis
The C24RD29a-LUC population was also screened for mutations that alter the expression of the RD29a-LUC transgene in response to cold, ABA, and NaCl treatments. T2 progeny of 54 200 T-DNA tagged C24RD29a-LUC lines were evaluated. Thirty-one mutant lines with altered luciferase expression were identified. Included were two individual lines harbouring independent mutations in two of the four members of a gene family that encodes isoforms of C-terminal domain (CTD) phosphatases (CPLs) (Koiwa et al., 2002
). AtCPLs dephosphorylate conserved heptad repeats (YSPTSPS) in the C-terminal domain of the RNA polymerase II largest subunit (Koiwa et al., 2004
). Mutations in cpl1 sensitize RD29a expression in response to cold and NaCl stresses and ABA treatment, whereas the cpl3 mutation confers only an ABA-dependent RD29a hyper-responsiveness to plants. This indicates that CTD-phosphorylation and dephosphorylation specifically control different aspects of stress signal outputs. Mutation of hos9-1 (for high expression of osmotically responsive genes) results in the hyperactivation of the RD29a promoter under low temperature, but not in response to ABA or salinity stress treatments (Zhu et al., 2004
). The HOS9 gene encodes a nuclear-localized homeodomain transcription factor that facilitates freezing tolerance. Microarray analysis of hos9-1 indicated that HOS9 regulates a freezing tolerance transcriptome that functions independently of CBF (Zhu et al., 2004
). HOS10/MYB8 also hyperactivates the RD29a promoter and is required for cold acclimation. The HOS10 gene may also control an ABA biosynthetic pathway that is necessary for gene expression under cold- and osmotic-stress conditions (Zhu et al., 2005
).
| Discussion |
|---|
|
|
|---|
Over the last decade, vast insight about plant growth and development and other plant processes has been gained because of the molecular genetic approaches and resources that are available for the study of Arabidopsis thaliana biology. Genes involved in numerous cellular and whole-plant phenotypes have been identified and characterized through the analysis of mutants that were generated using physicochemical or biological mutagens, such as EMS, fast-neutron, T-DNA, and transposons. Analysis of gene function has been expedited by the completion of the arabidopsis genome sequencing project and the subsequent creation of databases with annotations of gene products (Somerville and Somerville, 1999
A T-DNA tagging strategy using arabidopsis was used to evaluate plant responses to cold, osmotic, and salinity stresses by generating mutations in several different genetic backgrounds (Table l). RD29a reporter gene system-based screening was used to identify many mutants that lack an obvious visual phenotype under normal growth conditions. However, several of these exhibited impaired survival and growth capabilities (reduced in most lines) under various stress treatments (Koiwa et al., 2003
, 2004
; Zhu et al., 2002
, 2005
).
This study's screens included a total of 250 000 independent insertion lines. Given the c. 125 Mbp genome size of arabidopsis (Borevitz and Ecker, 2004
) and an average of 1.5 T-DNA insertions/transformant (Feldmann, 1991
), theoretically the lines screened represented a population of T-DNA insertions at every 0.61.7 kbp in the genome. The selection for herbicide (bialaphos) resistance carried by the mutagenic T-DNA and used to identify T1 lines was extremely efficient as any mutants that failed to carry a copy of the marker gene were not identified, although, in a few instances, its function was lost in the T2 generation. The cellophane membrane transfer and CCD imaging systems were highly robust and contributed to a streamlined high throughput screening for mutant phenotypes. It is intriguing to note that very few dominant gain-of-function mutations have been identified that alter responses to abiotic stresses. In some instances, this may have been due to the very specific nature of the screens, such as for suppressors of sos3. However, in the RD29a::LUC screens, no lines were identified that exhibited a phenotype that was the result of activated expression of CBF/DREB or ABF/ABREB transcription factors which are known to activate the RD29a gene (Narusaka et al., 2003
). The frequency of apparent dominant morphological mutants in the T1 generation was also not very high, averaging about one in 400. Since most of the screening was conducted with the C24 ecotype, perhaps it possesses greater capability to silence 35S enhancer repeats that were used for most of the activation T-DNA tagging. Indeed, recent studies indicate that a large proportion of T-DNA and 35S enhancer insertions are silenced in transgenic plants due to its chromosomal location and multiple T-DNA insertions (Chalfun-Junior et al., 2003
; Francis and Spiker, 2005
). These obstacles may be overcome in the future by using mutant backgrounds that lack a transcriptional and post-transcriptional gene silencing capacity (Sung et al., 2003
; Baulcombe, 2004
; Matzke et al., 2004
).
Dysfunctional alleles were generated by insertions in the 5' or 3' UTR as well as insertions as far upstream as 600 bp from the transcription start. Mutated alleles that caused phenotype changes sometimes resulted from knockout and knockdown expression as well as production of modified transcripts or proteins. Further, a number of the mutations that substantially affect plant responses to abiotic stresses occurred in individual members of gene families. Such cases indicated that functional redundancy often could not be predicted from DNA sequences (Bioinformatics). Double mutant analysis confirmed that, in some instances, gene families did have essential functions, i.e. mutations in both members of a family caused lethality (Koiwa et al., 2004
).
These studies have shown that T-DNA-tagging followed by phenotypic screens (forward genetics) allows the expeditious identification of genes involved in cold, osmotic, and salinity stress and ABA-mediated gene expression. Confirmation of the linkage between the T-DNA insertion locus and a mutant phenotype can be confirmed by a comparative analysis with insertion mutants available from indexed collections such as the SALK collection. Furthermore, these genomic scale resources greatly facilitate the functional analysis of gene family members by reverse genetics.
Large-scale screening has revealed some interesting characteristics of stress-tolerance mutants. For example, mutants impaired in stress and ABA responses were found to be the result of altered loci encoding proteins involved in very global control systems such as glycosylation, vesicular transport, sumoylation, and RNA synthesis and processing which has also been observed by others (CPL, SAD, etc.) and these cellular systems were previously considered to be associated with general cellular function and not with specific phenotypes.
As previously mentioned, mutants with reduced tolerance to both ionic and non-ionic stress often exhibited altered stomatal function. The high through-put forward genetic approach should eventually allow larger screens capable of almost saturating the genome for one or more mutant alleles at nearly every locus. It is, therefore, within present technical capabilities to identify, with reasonable effort, all of the loci contributing to any particular phenotype. From such a comprehensive collection of phenotype altering loci, particular key loci that impact different physiological mechanisms involved in a trait of interest may then be recognized. For example, the loci most required and/or with the highest sufficiency for osmotic adjustment and for stomatal control during adaptation to limited water availability could be identified by genome saturating loss of function screens. After identifying such key loci, the challenge will be to locate superior (gain of function) alleles of these loci. The most promising sources of these superior alleles would be trait-specific (e.g. NaCl-stress tolerant) Arabidopsis Relative Model Systems (ARMS) (Inan et al., 2004
) and germplasm sources (probably secondary and even tertiary gene pools) of specific crop species that exhibit the precise trait of interest. Eventually, effective alleles of the most important loci for a trait, such as salt tolerance, could be pyramided into crops by either genetic transformation or zero distance marker-assisted breeding using the identified important loci as zero distance markers.
| Acknowledgements |
|---|
This work was supported by National Science Foundation grant DBI-9813360 and MCBO421889 and USDA-CSREES grant No. 2005-34402-16401 Designing food for health.
| References |
|---|
|
|
|---|
Baulcombe D. 2004. RNA silencing in plants. Nature 431, 356363.[CrossRef][Medline]
Becker D. 1990. Binary vectors which allow the exchange of plant selectable marker and reporter gene. Nucleic Acids Research 18, 203.
Bohnert HJ, Bressan RA, Hasegawa PM. 2005. Ion homeostasis and water deficit. In: Ribaut J-M, ed. Drought tolerance in cereals. New York: Haworth's Food Products Press.
Borevitz JO, Ecker JR. 2004. Plant genomics: the third wave. Annual Review of Genomics and Human Genetics 5, 443477.[CrossRef][Web of Science][Medline]
Boyer JS. 1982. Plant productivity and environment. Science 218, 443448.
Buckler ESt, Thornsberry JM, Kresovich S. 2001. Molecular diversity, structure and domestication of grasses. Genetic Research 77, 213218.
Chung MH, Chen MK, Pan SM. 2000. Floral spray transformation can efficiently generate Arabidopsis transgenic plants. Transgenic Research 9, 471476.[CrossRef][Web of Science][Medline]
Chalfun-Junior A, Mes JJ, Mlynarova L, Aarts MG, Angenent GC. 2003. Low frequency of T-DNA based activation tagging in Arabidopsis is correlated with methylation of CaMV 35S enhancer sequences. FEBS Letters 555, 459463.[CrossRef][Web of Science][Medline]
Chinnusamy V, Jagendorf A, Zhu J-K. 2005. Understanding and improving salt tolerance in plants. Crop Science 45, 437448.
Choi H, Hong J, Ha J, Kang J, Kim SY. 1999. ABFs, a family of ABA-responsive element binding factors. Journal of Biological Chemistry 275, 17231730.
Clough SJ, Bent AF. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant Journal 16, 735743.[CrossRef][Web of Science][Medline]
Demidchik V, Davenport RJ, Tester M. 2002. Non-selective cation channels in plants. Annual Review of Plant Biology 53, 67107.[CrossRef][Medline]
Edwards K, Johnstone C, Thompson C. 1991. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Research 19, 1349.
Feldmann KA. 1991. T-DNA insertion mutagenesis in Arabidopsis: mutational spectrum. The Plant Journal 1, 7182.[CrossRef][Web of Science]
Flowers TJ. 2004. Improving crop salt tolerance. Journal of Experimental Botany 55, 307319.
Francis KE, Spiker S. 2005. Identification of Arabidopsis thaliana transformants without selection reveals a high occurrence of silenced T-DNA integrations. The Plant Journal 41, 464477.[Web of Science][Medline]
Gong Z, Lee H, Xiong L, Jagendorf A, Stevenson B, Zhu J-K. 2002. RNA helicase-like protein as an early regulator of transcription factors for plant chilling and freezing tolerance. Proceedings of the National Academy of Sciences, USA 99, 1150711512.
Guo Y, Haftner U, Ishitani M, Zhu J-K. 2001. Molecular characterization of functional domains in the protein kinase SOS2 that is required for plant salt tolerance. The Plant Cell 13, 13831399.
Guo Y, Xiong L, Ishitani M, Zhu J-K. 2002. An Arabidopsis mutation in translation elongation factor 2 causes superinduction of CBF/DREB1 transcription factor genes but blocks the induction of their downstream targets under low temperatures. Proceedings of the National Academy of Sciences, USA 99, 77867791.
Halfter U, Ishitani M, Zhu J-K. 2000. The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3. Proceedings of the National Academy of Sciences, USA 97, 37353740.
Hasegawa PM, Bressan RA, Zhu J-K, Bohnert HJ. 2000. Plant cellular and molecular responses to high salinity. Annual Review of Plant Physiology and Plant Molecular Biology 51, 463499.[CrossRef][Web of Science][Medline]
Hayashi H, Czaja I, Lubenow H, Schell J, Walden R. 1992. Activation of a plant gene by T-DNA tagging: auxin-independent growth in vitro. Science 258, 13501353.
Hua B-G, Mercier RW, Leng Q, Berkowitz GA. 2003. Plants do it differently. A new basis for potassium/sodium selectivity in the pore of an ion channel. Plant Physiology 132, 13531361.
Iba K. 2002. Acclimative response to temperature stress in higher plants: approaches of gene engineering for temperature tolerance. Annual Review of Plant Biology 53, 225245.[CrossRef][Medline]
Inan G, Zhang Q, Li P, et al. 2004. Salt cress. A halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiology 135, 17181737.
Ishitani M, Xiong L, Lee H, Stevenson B, Zhu J-K. 1998. HOS1, a genetic locus involved in cold-responsive gene expression in Arabidopsis. The Plant Cell 10, 11511161.
Ishitani M, Xiong L, Stevenson B, Zhu J-K. 1997. Genetic analysis of osmotic and cold stress signal transduction in Arabidopsis: interactions and convergence of abscisic acid-dependent and abscisic acid-independent pathways. The Plant Cell 9, 19351949.[Abstract]
Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Schabenberger O, Thomashow MF. 1998. Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 280, 104106.
Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. 1999. Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nature Biotechnology 17, 287291.[CrossRef][Web of Science][Medline]
Koiwa H, Barb AW, Xiong L, et al. 2002. C-terminal domain phosphatase-like family members (AtCPLs) differentially regulate Arabidopsis thaliana abiotic stress signaling, growth, and development. Proceedings of the National Academy of Sciences, USA 99, 1089310898.
Koiwa H, Hausmann S, Bang WY, et al. 2004. Arabidopsis C-terminal domain phosphatase-like 1 and 2 are essential Ser-5-specific C-terminal domain phosphatases. Proceedings of the National Academy of Sciences, USA 101, 1453914544.
Koiwa H, Li F, McCully MG, et al. 2003. The STT3a subunit isoform of the Arabidopsis thaliana oligosaccharyltransferase controls adaptive responses to salt/osmotic stress. The Plant Cell 15, 22732284.
Lee H, Guo Y, Ohta M, Xiong L, Stevenson B, Zhu J-K. 2002. LOS2, a genetic locus required for cold-responsive gene transcription encodes a bi-functional enolase. EMBO Journal 21, 26922702.[CrossRef][Web of Science][Medline]
Lee H, Xiong L, Gong Z, Ishitani M, Stevenson B, Zhu J-K. 2001. The Arabidopsis HOS1 gene negatively regulates cold signal transduction and encodes a RING finger protein that displays cold-regulated nucleo-cytoplasmic partitioning. Genes and Development 15, 912924.
Lee H, Xiong L, Ishitani M, Stevenson B, Zhu J-K. 1999. Cold-regulated gene expression and freezing tolerance in an Arabidopsis thaliana mutant. The Plant Journal 17, 301308.[CrossRef][Web of Science][Medline]
Liu J, Zhu J-K. 1997. An Arabidopsis mutant that requires increased calcium for pottasium nutrition and salt tolerance. Proceedings of the National Academy of Sciences, USA 94, 1496014964.
Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. 1998. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature gene expression, respectively, in Arabidopsis. The Plant Cell 10, 13911406.
Marchuk D, Drumm M, Collins FS. 1990. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Research 19, 1154.
Matzke M, Aufsatz W, Kanno T, Daxinger L, Papp I, Mette MF, Matzke AJ. 2004. Genetic analysis of RNA-mediated transcriptional gene silencing. Biochimica et Biophysica Acta 1677, 129141.[Medline]
Miura K, Rus A, Sharkhuu A, et al. 2005. The Arabidopsis SUMO E3 ligase SIZ1 controls phosphate deficiency responses. Proceedings of the National Academy of Sciences, USA 102, 77607765.
Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, Narusaka M, Shinozaki K, Yamaguchi-Shinozaki K. 2003. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. The Plant Journal 34, 137148.[CrossRef][Web of Science][Medline]
Ni M, Cui D, Einstein J, Narasimhulu S, Vergara CE, Gelvin SB. 1995. Strength and tissue specificity of chimeric promoters derived from the octopine and mannopine synthase genes. The Plant Journal 7, 661676.[CrossRef]
Quintero FJ, Ohta M, Shi H, Zhu J-K, Pardo JM. 2002. Reconstitution in yeast of the Arabidopsis SOS signaling pathway for Na+ homeostasis. Proceedings of the National Academy of Sciences, USA 99, 90619066.
Ruggiero B, Koiwa H, Manabe Y, Quist TM, Inan G, Saccardo F, Joly RJ, Hasegawa PM, Bressan RA, Maggio A. 2004. Uncoupling the effects of abscisic acid on plant growth and water relations. Analysis of sto1/nced3, an abscisic acid-deficient but salt stress-tolerant mutant in Arabidopsis. Plant Physiology 136, 31343147.
Rus A, Lee BH, Munoz-Mayor A, Sharkhuu A, Miura K, Zhu J-K, Bressan RA, Hasegawa PM. 2004. AtHKT1 facilitates Na+ homeostasis and K+ nutrition in planta. Plant Physiology 136, 25002511.
Rus A, Yokoi S, Sharkhuu A, Reddy M, Lee B-H, Matsumoto TK, Koiwa H, Zhu J-K, Bressan RA, Hasegawa PM. 2001. AtHKT1 is a salt tolerance determinant that controls Na+ entry into plant roots. Proceedings of the National Academy of Sciences, USA 98, 1415014155.
Seki M, Kamei A, Yamaguchi-Shinozaki K, Shinozaki K. 2003. Molecular responses to drought, salinity and frost: common and different paths for plant protection. Current Opinion in Biotechnology 14, 194199.[CrossRef][Web of Science][Medline]
Shi H, Ishitani M, Zhu J-K. 2000. The Arabidopsis thaliana salt-tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proceedings of the National Academy of Sciences, USA 97, 68966901.
Shi H, Lee BH, Wu SJ, Zhu J-K. 2003. Overexpression of a plasma membrane Na+/H+ antiporter gene improves salt tolerance in Arabidopsis thaliana. Nature Biotechnology 21, 8185.[CrossRef][Web of Science][Medline]
Shi H, Quintero FJ, Pardo JM, Zhu J-K. 2002. The putative plasma membrane Na+/H+ antiporter SOS1 controls long-distance Na+ transport in plants. The Plant Cell 14, 465477.
Somerville C, Somerville S. 1999. Plant functional genomics. Science 285, 380383.
Stockinger E, Gilmour SJ, Thomashow MF. 1997. Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription response to low temperature and water deficit. Proceedings of the National Academy of Sciences, USA 94, 10351040.
Sung ZR, Chen L, Moon YH, Lertpiriyapong K. 2003. Mechanisms of floral repression in Arabidopsis. Current Opinion in Plant Biology 6, 2935.[CrossRef][Web of Science][Medline]
Thomashow MF. 1999. PLANT COLD ACCLIMATION: freezing tolerance genes and regulatory mechanisms. Annual Review of Plant Physiology and Plant Molecular Biology 50, 571599.[CrossRef][Web of Science][Medline]
Uno Y, Furihara T, Abe H, Yoshida R, Shinozaki K, Yamaguchi-Shinozaki K. 2000. Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proceedings of the National Academy of Sciences, USA 97, 1163211637.
Weigel D, Ahn J-H. 2000. Activation tagging in Arabidopsis. Plant Physiology 122, 10031013.
Wright SI, Bi IV, Schroeder SG, Yamasaki M, Doebley JF, McMullen MD, Gaut BS. 2005. The effects of artificial selection on the maize genome. Science 308, 13101314.
Xiong L, David L, Stevenson B, Zhu J-K. 1999a. High throughput screening of signal transduction mutants with luciferase imaging. Plant Molecular Biology Reporter 17, 159170.[CrossRef][Web of Science]
Xiong L, Gong Z, Rock CD, Subramanian S, Guo Y, Xu W, Galbraith D, Zhu J-K. 2001a. Modulation of abscisic acid signal transduction and biosynthesis by an Sm-like protein in Arabidopsis. Developmental Cell 1, 771781.[CrossRef][Web of Science][Medline]
Xiong L, Ishitani M, Lee H, Zhu J-K. 1999b. HOS5: a negative regulator of osmotic stress-induced gene expression in Arabidopsis thaliana. The Plant Journal 19, 569578.[CrossRef][Web of Science][Medline]
Xiong L, Ishitani M, lee H, Zhu J-K. 2001b. The Arabidopsis LOS5/ABA3 locus encodes molybdenum cofactor sulfurase and modulates cold stress- and osmotic stress-responsive gene expression. The Plant Cell 13, 20632083.
Xiong L, Lee B-H, Ishitani M, Lee H, Zhang C, Zhu J-K. 2001c. FIERY1 encoding an inositol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress signaling in Arabidopsis. Genes and Development 15, 19711984.
Xiong L, Lee H, Ishitani M, Tanaka Y, Stevenson B, Koiwa H, Bressan RA, Hasegawa PM, Zhu J-K. 2002a. Repression of stress-responsive genes by FIERY2, a novel transcriptional regulator in Arabidopsis. Proceedings of the National Academy of Sciences, USA 99, 1089910904.
Xiong L, Lee H, Ishitani M, Zhu J-K. 2002b. Regulation of osmotic stress-responsive gene expression by the LOS6/ABA1 locus in Arabidopsis. Journal of Biological Chemistry 277, 85888596.
Xiong L, Zhu J-K. 2001. Abiotic stress signal transduction in plants: molecular and genetic perspectives. Physiologia Plantarum 112, 152166.[CrossRef][Medline]
Yamaguchi-Shinozaki K, Shinozaki K. 2005. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters. Trends in Plant Science 10, 8894.[CrossRef][Web of Science][Medline]
Zhu J, Gong Z, Zhang C, Song C-P, Damsz B, Inan G, Koiwa H, Zhu J-K, Hasegawa PM, Bressan RA. 2002. OSM1/SYP61: a syntaxin protein in Arabidopsis controls abscisic acid-mediated and non-abscisic acid-mediated responses to abiotic stress. The Plant Cell 14, 30093028.
Zhu J, Shi H, Lee B-H, Damsz B, Cheng S, Stirm V, Zhu J-K, Hasegawa PM, Bressan RA. 2004. An Arabidopsis homeodomain transcription factor gene, HOS9, mediates cold tolerance through a CBF-independent pathway. Proceedings of the National Academy of Sciences, USA 101, 98739878.
Zhu J-H, Verslues PE, Zheng X, et al. 2005. HOS10 encodes a novel R2R3-type MYB transcription factor essential for cold acclimation in plants. Proceedings of the National Academy of Sciences, USA 102, 99669971.
Zhu J-K. 2001. Cell signaling under salt, water and cold stresses. Current Opinion in Plant Biology 4, 401406.[CrossRef][Web of Science][Medline]
Zhu J-K. 2002. Salt and drought stress signal transduction in plants. Annual Review of Plant Biology 53, 247273.[CrossRef][Medline]
Zhu J-K. 2003. Regulation of ion homeostasis under salt stress. Current Opinion in Plant Biology 6, 441445.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. L. Schapire, B. Voigt, J. Jasik, A. Rosado, R. Lopez-Cobollo, D. Menzel, J. Salinas, S. Mancuso, V. Valpuesta, F. Baluska, et al. Arabidopsis Synaptotagmin 1 Is Required for the Maintenance of Plasma Membrane Integrity and Cell Viability PLANT CELL, December 1, 2008; 20(12): 3374 - 3388. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Papdi, E. Abraham, M. P. Joseph, C. Popescu, C. Koncz, and L. Szabados Functional Identification of Arabidopsis Stress Regulatory Genes Using the Controlled cDNA Overexpression System Plant Physiology, June 1, 2008; 147(2): 528 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. V. Sun, K. Jin, Y. Liu, W. Yang, X. Xie, L. Ye, L. Wang, L. Zhu, S. Ding, Y. Su, et al. PBmice: an integrated database system of piggyBac (PB) insertional mutations and their characterizations in mice Nucleic Acids Res., January 11, 2008; 36(suppl_1): D729 - D734. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Reyes-Reyes and M. Hampsey Role for the Ssu72 C-Terminal Domain Phosphatase in RNA Polymerase II Transcription Elongation Mol. Cell. Biol., February 1, 2007; 27(3): 926 - 936. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rosado, A. L. Schapire, R. A. Bressan, A. L. Harfouche, P. M. Hasegawa, V. Valpuesta, and M. A. Botella The Arabidopsis Tetratricopeptide Repeat-Containing Protein TTL1 Is Required for Osmotic Stress Responses and Abscisic Acid Sensitivity Plant Physiology, November 1, 2006; 142(3): 1113 - 1126. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






