JXB Advance Access originally published online on March 17, 2006
Journal of Experimental Botany 2006 57(6):1381-1390; doi:10.1093/jxb/erj117
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Published by Oxford University Press [2006] on behalf of the Society for Experimental Biology.
RESEARCH PAPER |
Characterization of tomato (Solanum lycopersicum L.) mutants affected in their flowering time and in the morphogenesis of their reproductive structure
1Unité de Biologie Végétale, Département de Biologie et Institut des Sciences de la Vie, Université catholique de Louvain, Croix du Sud 5, boîte 13, B-1348 Louvain-la-Neuve, Belgium
2Unité de Biochimie Physiologique et Institut des Sciences de la Vie, Université catholique de Louvain, Croix du Sud 5, boîte 15, B-1348 Louvain-la-Neuve, Belgium
* To whom correspondence should be addressed. E-mail: kinet{at}bota.ucl.ac.be
Received 17 August 2005; Accepted 10 January 2006
| Abstract |
|---|
|
|
|---|
The impact of the season on flowering time and the organization and morphogenesis of the reproductive structures are described in three tomato mutants: compound inflorescence (s), single flower truss (sft), and jointless (j), respectively, compared with their wild-type cultivars Ailsa Craig (AC), Platense (Pl), and Heinz (Hz). In all environmental conditions, the sft mutant flowered significantly later than its corresponding Pl cultivar while flowering time in j was only marginally, but consistently, delayed compared with Hz. The SFT gene and, to a lesser extent, the J gene thus appear to be constitutive flowering promoters. Flowering in s was delayed in winter but not in summer compared with the AC cultivar, suggesting the existence of an environmentally regulated pathway for the control of floral transition. The reproductive structure of tomato is a raceme-like inflorescence and genes regulating its morphogenesis may thus be divided into inflorescence and floral meristem identity genes as in Arabidopsis. The s mutant developed highly branched inflorescences bearing up to 200 flowers due to the conversion of floral meristems into inflorescence meristems. The S gene appears to be a floral meristem identity gene. Both sft and j mutants formed reproductive structures containing flowers and leaves and reverting to a vegetative sympodial growth. The SFT gene appears to regulate the identity of the inflorescence meristem of tomato and is also involved, along with the J gene, in the maintenance of this identity, preventing reversion to a vegetative identity. These results are discussed in relation to knowledge accumulated in Arabidopsis and to domestication processes.
Key words: compound inflorescence, floral transition, inflorescence structure, jointless, Lycopersicon esculentum Mill., meristem identity, mutant, season effect, single flower truss, Solanum lycopersicum L., tomato
| Introduction |
|---|
|
|
|---|
Molecular genetic studies on Arabidopsis thaliana have so far identified different pathways that co-ordinate flowering time with environmental conditions and developmental stage of the plant, and converge to integrator genes that ultimately regulate genes controlling inflorescence and floral meristem identity (Périlleux and Bernier, 2002
There is evidence to suggest that the genetic model of flowering in Arabidopsis might not completely fit other species. In Petunia hybrida, for instance, petunia flowering gene (pfg) mutants are unable to undergo the floral transition and remain vegetative indefinitely while mutations in APETALA1 (AP1) and FRUITFULL (FUL) genes, which are homologues of PFG, do not suppress flowering in Arabidopsis (Immink et al., 1999
). A study of LEAFY (LFY) homologues in Nicotiana tabacum also indicated that these genes are implicated in meristem identity regulation, but not always in the same way as in Arabidopsis (Ahearn et al., 2001
). Finally, molecular analyses of genes controlling flowering time in rice revealed that the integration of daylength and vernalization signals in cereals might rely on a mechanism analogous to that of Arabidopsis thaliana but functional similarity is not necessarily related to sequence identities (Andersen et al., 2004
).
Comparative studies across structurally and phylogenetically diverse plant lineages are thus required to identify patterns of conservation and diversification in flowering control. It was with this idea in mind that a study was started of the mechanisms regulating flowering in tomato (Solanum lycopersicum L.), a species which differs from Arabidopsis in diverse ways. Arabidopsis is a facultative long-day plant characterized by monopodial growth while tomato is a day-neutral plant with a sympodial growth habit, i.e. after the production of a limited number of leaves, the tomato shoot apical meristem initiates a first inflorescence which is displaced from its terminal position by the active growth of the axillary bud in the axil of the last-initiated leaf. This bud continues the growth of the plant, producing some leaves and a second inflorescence and the process is repeated at the initiation of each subsequent inflorescence. The stem portion produced by the shoot apical meristem before the first inflorescence is called the initial segment and additional stem portions, between inflorescences, constitute the successive sympodial segments. Arabidopsis and tomato also differ in the inflorescence type they produce: Arabidopsis forms a true raceme while tomato produces a reproductive structure that has long been considered to be a cyme, but more recent work indicates that it is a raceme-like inflorescence (Allen and Sussex, 1996
). The genes regulating the morphogenesis of the tomato reproductive structure may thus be divided into inflorescence and floral meristem identity genes as in Arabidopsis.
In previous studies, the uniflora (uf) mutant (Dielen et al., 1998
, 2001
, 2004
) was characterized which is affected in a pivotal gene that has a dual role in tomato, regulating floral transition and the identity of the inflorescence meristem. In the present work, three additional tomato mutants were studied: compound inflorescence (s), jointless (j), and single flower truss (sft). The inflorescence structure of the s and j mutants was briefly described in the literature: the s mutant was just reported to produce highly branched inflorescences (http://tgrc.ucdavis.edu/) while the occurrence of inflorescences containing leaves and reverting to a vegetative growth has been observed in j mutants, first characterized for their lack of abscission zone on flower pedicels (Philouze, 1978
; Szymkowiak and Irish, 1999
; Mao et al., 2000
). According to Molinero-Rosales et al. (2004)
, the sft mutant is a late-flowering mutant which produces a terminal segment characterized by the repetition of one or two flowers and one to three leaves. The aim of this paper was to analyse more precisely the flowering phenotype of these mutants by investigating the impact of the season on the flowering time of their initial segment and describing the morphogenesis and organization of their reproductive structure.
| Materials and methods |
|---|
|
|
|---|
Plant material
Seeds of the Ailsa Craig (AC) and Platense (Pl) tomato cultivars, and of the s and sft mutants were obtained from the Tomato Genetics Resource Center (University of California, Davis, USA), and the seeds of the Heinz (Hz) cultivar and of the j mutant were provided by the INRA (Institut National de la Recherche Agronomique, Montfavet, France).
The seeds were bulked after several rounds of selfing in a glasshouse to constitute a stock for this study's experiments.
Growth conditions
Seeds were germinated at 25 °C in peat compost. When 2-weeks-old, seedlings were transplanted into 7 cmx7 cm pots filled with the same compost and, about 3 weeks later, plants were transferred to 15 cm pots, and fertilized weekly with a nutrient solution made of 15 g l1 of a 16-18-21 N-P-K fertilizer. All experiments were carried out in a greenhouse at Louvain-la-Neuve in different seasons. The greenhouse was heated and extra lighting was provided by PHILIPS HPLR 400 W bulbs to expose plants to a 16 h daylength at a minimum photon flux density (PAR) of 100 µmol m2 s1 at the top of the canopy, which is a rather low light level. Major seasonal effects reported in this paper were thus probably due to variations in the daily light energy integral that was higher in summer than in winter.
Recording methods
Flowering time of the initial segment was assessed by two different measurements: (i) the number of days from sowing to macroscopic appearance (MA) of the first inflorescence, and (ii) the number of leaves produced below the first reproductive structure. In addition, the percentage of plants initiating a solitary flower instead of an inflorescence was recorded for sft.
Statistical analysis
Normality tests were performed and no further transformation of the raw data was required. ANOVA II (SAS system for Windows V8) was performed to evaluate the effects of the genotype and the sowing date on the different parameters measured. Differences between means were scored for significance according to the Scheffe F-test.
Histological studies
At different time points after sowing, apices of normal and mutant plants were collected, fixed in FAA (70% ethanol:acetic acid:formaldehyde, 18:1:1 by vol.), dehydrated in a graded ethanol series, embedded in paraffin, and sectioned at 5 µm. Serial longitudinal sections were stained with haematoxylin-fast green and observed with a light microscope.
Analysis of SELF PRUNING
Total RNA was prepared from shoot apices (containing young leaves, axillary meristem, and flower buds) of each cultivar and mutant plants using the Rneasy® Midi Kit (Quiagen, Westburg, The Netherlands). The RNA was subsequently used as the template for a first-strand cDNA synthesis using the Superscript III first strand synthesis for RT-PCR kit (Invitrogen Life Technologies, The Netherlands), according to the manufacturer's instructions. For specific amplification of SP, AccuPrime pfx DNA polymerase (Invitrogen Life Technologies, The Netherlands), ATGGCTTCCAAAATGTGTGA as the forward primer and CTGCCGCTAGAAGGCGTTGA as the reverse primer were used. The PCR conditions were: 2 min at 94 °C, 30 cycles consisting of 30 s at 94 °C, 30 s at 55 °C, and 1 min at 68 °C, and a final extension at 68 °C for 5 min. The PCR products were purified and cloned using the PCR-ScriptTMAmp cloning kit (Stratagene, The Netherlands) according to the manufacturer's instructions. The cDNA clones were sequenced using an automatic sequencer (ABI PrismTM, Automatic DNA Sequencer, mode 377). The resulting nucleotide sequences were aligned using ClustalX and checked for the presence of mutations.
| Results |
|---|
|
|
|---|
Sequencing of the SELF PRUNING cDNAs
The mutants investigated in this work were available in three different genetic backgrounds, the Ailsa Craig (AC), Heinz (Hz), and Platense (Pl) cultivars for s, j, and sft, respectively. It is well known that tomato cultivars are distributed within two main types: the determinate tomato which has a limited flowering period is cultivated for processed food and the indeterminate tomato which produces inflorescences throughout the plant's life is used for fresh fruit production in greenhouses and gardens. The difference between the two types is due to the SELF PRUNING (SP) gene which is mutated in the determinate tomatoes (Pnueli et al., 1998
After alignment, the SP sequences derived from AC and Pl cultivars and from the s and sft mutants were identical, whereas in Hz and j a cytosine was converted to a thymine resulting in the occurrence of a leucine instead of a proline at position 76 of the protein primary sequence. This punctual mutation in Hz and j is the same as the one described by Pnueli et al. (1998)
in M82 sp1 and VFNT Cherry sp2; both Hz and j are thus of the determinate tomato type, as suspected.
Effect of the season on flowering time
Sowings of the mutants and their corresponding wild type were carried out in a greenhouse at different times of the year to investigate plants growing and developing at different seasons.
The compound inflorescence mutant and AC:
All the s plants and their corresponding wild type AC flowered whatever the sowing date (Table 1). The AC cultivar plants formed their first inflorescence after the production of about 10 leaves, irrespective of the environmental conditions and even if the flowering date was slightly affected by the season, for instance, delayed during winter. By contrast, flowering of the s mutant was later in winter than in summer or in autumn. When sown in September and May, the s plants produced the same number of leaves under the first reproductive structure as the AC plants (F=0.78, P=0.3843, and F=0.10, P=0.7504, respectively). However, in winter, the s mutant initiated its first inflorescence after producing about two leaves more than the AC cultivar (F=13.80, P=0.0011, and F=17.33, P=0.0006 for sowing in October and January, respectively).
|
The single flower truss mutant and Pl:
As shown in Table 1, the sft mutant always flowered later than the Pl cultivar (F=336.78, P <0.0001) and produced 45 leaves more under the first reproductive structure (F=268.26, P <0.0001). For both genotypes, the number of days between sowing and flowering was higher when the plants were grown in winter (F=100.24, P <0.0001), but the number of leaves under the first inflorescence was not affected by the season (F=2.60, P=0.0552).
The jointless mutant and Hz:
The flowering time of the j mutant is slightly delayed compared with the Hz cultivar (Table 1). Although the difference was never statistically significant (F=0.54, P=0.4636 and F=2.78, P=0.0989 for the number of days and the number of leaves under the first inflorescence, respectively), it was recorded for all sowing dates. Both genotypes were affected similarly by the season, the number of days (F=20.52, P <0.0001) and the number of leaves initiated (F=6.40, P=0.0005) before flowering were higher when the plants were grown in winter.
Phenotype and morphogenesis of the reproductive structures
The wild types:
The tomato AC and Hz cultivars produced usually 58 opened flowers per inflorescence (Fig. 1A) while more often, this number was limited to five in Pl. These observations are consistent with descriptions from the literature (Kinet and Peet, 1997
). At floral transition, the shoot apical meristem of the wild types swelled and was transformed into an inflorescence meristem which divided into two parts, giving rise to a first floral meristem and restoring the inflorescence meristem. The bipartition of the inflorescence meristem was repeated for the production of each new flower (Fig. 2A, B). The successive planes of bipartition of the inflorescence meristem were at right angles resulting in a kind of zigzag.
|
|
In some instances, however, Pl initiated inflorescences with a larger number of flowers and a first flower bearing supernumerary organs. In this case, at floral transition, the inflorescence meristem started to bifurcate and the two emerging meristematic domes remained partly fused when starting to divide in turn. As a result, a central flower with supernumerary floral organs bearing opposite inflorescence meristems on its flanks was produced. These two inflorescence meristems divided in two parts and continued the build-up of the inflorescence (Fig. 2D).
The compound inflorescence mutant:
The s mutant produced a highly branched inflorescence bearing up to 200 flowers (Fig. 1B). In s, when the inflorescence meristem divided into two parts for the first time, it generated two inflorescence meristems which divided again into two parts, producing either a floral meristem and an inflorescence meristem (Fig. 2C), or two inflorescence meristems. This resulted in extensive ramification of the inflorescence. Usually, the initiation of the inflorescence began at the same time in both AC and s, but rapidly the number of flowers in s exceeded that produced by AC to reach values up to 200.
The s mutation affected only the reproductive development of the plants: there was no difference between s and AC in germination time and percentages, in leaf rate initiation, and in leaf shape (results not shown).
The single flower truss mutant:
The sft reproductive structure varied markedly: it could consist of a solitary flower (Fig. 1E) or in an inflorescence (Fig. 1FH). When sft produced inflorescences, they usually reverted to vegetative growth after the production of a variable number of flowers. On solitary flowers, transformation of one of the sepals into a leaf-like structure could be observed (Fig. 1E).
The histological studies revealed that the swelled-meristem of the sft mutant could be directly transformed into a floral meristem or gave rise to an inflorescence meristem. When the shoot apical meristem was readily transformed into a floral meristem initiating a single flower, the meristem at the axil of the last formed leaf grew quickly (Fig. 2G). This meristem developed either into an axillary shoot or into an inflorescence. This inflorescence produced several flowers (Fig. 2I) or reverted to a vegetative meristem after formation of a single flower (Fig. 2H). When, at floral transition, the plant produced an inflorescence meristem, it divided into two parts producing a floral meristem and an inflorescence meristem (Fig. 2J) which, in turn, developed an inflorescence that ultimately reverted to vegetative growth.
The number of flowers per inflorescence was affected by the season during which the inflorescence was formed (Table 2). The reproductive structures initiated during winter usually harbour a single flower while those produced in summer contained more flowers.
|
The sft mutation also affected the vegetative development of the plant. The sft seeds germinated later than the Pl seeds. At the beginning, Pl plants initiated leaves faster than the sft plants, but after initiation of the first reproductive structure, the leaf production rate became slightly faster in sft than in Pl. After the macroscopic appearance of the fifth leaf, around 33 d after sowing, the 23 youngest leaves of the mutant turned temporarily yellow along the main vein (Fig. 1I). This transient change in colour lasted approximately 5 d and was accompanied by a decrease in the chlorophyll a, b and carotenoid contents in the leaf (results not shown).
The jointless mutant:
The j mutant was firstly characterized for its lack of pedicel abscission zone (Szymkoviak and Irish, 1999). The j inflorescence contained flowers and leaves (Fig. 1C, D) and showed a reversion to a sympodial growth.
The j inflorescence developed initially as the wild type, but most usually after the production of two or three flowers, the meristem initiated a leaf with an axillary meristem (Fig. 2E, F). The inflorescence continued then its build-up by the production of flowers and leaves until a complete reversion to a sympodial growth.
Numerous dissections allowed the Hz and j inflorescences to be classified into four morphological types depending on the position of the first four flowers and putative leaves within the inflorescence (Fig. 3AD). The A morphological type, in which leaves were absent, characterized the classical tomato inflorescence development: the flowers were produced by successive divisions, at right angles, of the inflorescence meristem so that the flower position formed a zigzag. In the B type, also devoid of leaves, the fourth flower developed in line with the second and third flowers and broke the zigzag. In the C type, a leaf was initiated after the third flower and occupied the position where the fourth flower should have been initiated such that this flower developed on the opposite side of the third flower and broke the zigzag. In the last type D, a leaf was also produced but it did not break the zigzag. Figure 3 shows the distribution of Hz and j inflorescences among the four morphological types described. The repartition of the inflorescences into the four types significantly differed in Hz and j (X2=209.64, P <0.0001). Most of the Heinz inflorescences were of the A type and when a leaf was produced in the inflorescence, it usually broke the zigzag (C type). The j inflorescences contained leaves and the first leaf most often broke the zigzag. j inflorescences seldom failed to produce a leaf before the fourth flower. Usually, j inflorescences produced more than one leaf but only the position of the first leaf allowed some simple rules to be obtained from the otherwise complex morphogenesis (Fig. 3E). Taking further leaves into account rapidly increased the complexity of the picture making the identification of reliable morphological types difficult.
|
The vegetative growth of the plants was not affected by the j mutation.
| Discussion |
|---|
|
|
|---|
The regulation of flowering time in tomato
In Arabidopsis, many genes involved in regulating flowering time have been discovered through mutant analysis. These mutants are either early or late flowering, identifying genes that delay or promote floral transition and are disturbed either in sensing environmental signals or in the control of developmental processes (Boss et al., 2004
The three tomato mutants investigated in the present work indicate, however, that mechanisms controlling flowering time still exist in tomato. In s, flowering was only delayed in winter conditions while the flowering delay in sft and j was observed in all conditions, although in j, as compared to Hz, it was not statistically significant. Molinero-Rosales et al. (2004)
also reported that sft flowered later than the wild type in both short-day and long-day conditions and earlier observations by Emery and Munger (1970)
and Philouze (1978)
suggested a late-flowering phenotype for j mutant plants compared with the wild type. Thus, both SFT and, in a lesser extent, J could act as regulatory components of an autonomous pathway of flowering (Molinero-Rosales et al., 2004
).
uniflora (uf), blind (bl), and falsiflora (fa) have been described as other late-flowering tomato mutants (Dielen et al., 1998
; Molinero-Rosales et al., 1999
; Lozano et al., 2000
; Schmitz et al., 2002
; Dielen et al., 2004
). The uf mutation has the most marked effect on flowering time. To the best of our knowledge, the s and uf mutants are the only tomato mutants reported to date in which flowering time has been shown to be affected by environmental conditions more than in their background cultivars. Both mutants flower later in winter (Table 1; Dielen et al., 1998
) supporting the idea that environmentally regulated pathways for the control of floral transition exist in tomato. In the case of uf it has been shown that its flowering time is strongly dependent on the daily light energy integral (Dielen et al., 2004
) suggesting that an adequate supply of sugars to the meristem could constitute an essential signal and mediate the effect of the environment.
In tomato, all mutants that were found to be affected in their flowering time are late flowering, a few early-flowering mutants have been mentioned, but there is no precise description of these plants (http://zamir.sgn.cornell.edu/mutants). Once again, this situation could be due to the domestication process that frequently resulted in shortening life cycles (Evans, 1993
). In tomato, most cultivars undergo floral transition early when the third leaf is expanding, making easier the occurrence of late-flowering than early-flowering mutants.
Thus, there is no doubt that the search for genes implicated in the regulation of flowering time in tomato will not only contribute to a better understanding of the mechanisms regulating floral transition in this crop, but could also shed light on unconscious achievements of domestication. The strategy used by Ellul et al. (2004)
could be fruitful for such a task. Indeed, these authors reported that constitutive expression of the Arabidopsis APETALA1 (AP1) gene in tomato resulted in flowering after the production of six vegetative nodes compared with 11 nodes in the wild type, which may suggest that the tomato AP1 orthologue, if it exists, could also promote flowering.
The morphogenesis of the reproductive structures in tomato
Floral meristem identity genes:
The s mutant produced inflorescences bearing up to 200 flowers. In this mutant, the SAM was converted into an inflorescence meristem, as in the wild type, but when this meristem divided, it gave rise to two inflorescence meristems resulting in the branching of the reproductive structure, a process that was frequently, but not systematically, reiterated during the subsequent build-up of the inflorescence. A similar splitting of the inflorescence meristem into two inflorescence meristems was observed in fa and an mutants by Allen and Sussex (1996)
, but the reproductive structures of these two mutants markedly diverged from the inflorescence of s plants because they were unable to form flowers. The an inflorescence consisted only of proliferating inflorescence meristems and is reminiscent of the common cauliflower variant of Brassica where leaves are highly suppressed, while in the fa mutant, the inflorescence meristems ultimately reverted to vegetative meristems.
Thus, a common feature of the three mutants was that the meristems of their reproductive structure were not determined straightaway to give a flower, but might turn into an inflorescence meristem. This supports the view that the tomato inflorescence is a raceme, as already stressed by Allen and Sussex (1996)
and Dielen et al. (1998)
and that the S, AN, and FA genes control the floral identity of the meristem in tomato.
The existence of multiple genes specifying floral meristem identity has also been reported in Arabidopsis thaliana including LEAFY (LFY), APETALA1 (AP1), CAULIFLOWER (CAL), FRUITFULL (FUL), UNUSUAL FLORAL ORGANS (UFO) and APETALA2 (AP2) (Jack, 2004
). The FA tomato gene is the orthologue of the Arabidopsis LFY gene (Molinero-Rosales et al., 1999
), one of the most important floral meristem identity genes in this species. The S and AN tomato genes have not been cloned yet.
Inflorescence meristem identity genes
Both sft and j mutants formed reproductive structures containing flowers and leaves and resuming vegetative growth. The morphology of the reproductive structure of the sft mutant was highly variable and strongly affected by environmental conditions. Solitary flowers were more frequent in winter when light conditions were poor, while simple or branched inflorescences, with variable numbers of leaves and reverting to sympodial growth, occurred in summer. These altered developmental patterns indicate that an inflorescence meristem was not functioning when isolated flowers were produced, or stopped functioning when reverting inflorescences were formed. By contrast, Molinero-Rosales et al. (2004)
reported that the sft mutant produced a terminal segment characterized by a reiteration of one or two individual flowers and one to three leaves.
In the j mutant, a first leaf was initiated in the inflorescence usually after the production of two flowers, and then the inflorescence produced some flowers and leaves alternately until the reversion to a sympodial growth. Axillary meristems were always found at the axil of the leaves and the leaf-axillary meristem complex frequently developed in the place occupied by a flower in the wild-type zigzag inflorescence conformation (Fig. 3). Apparently, the inflorescence meristem of the j mutant progressively returned to a vegetative functioning, acquiring a vegetative identity by sectors until its total conversion into a vegetative meristem.
Molinero-Rosales et al. (2004)
, considering that the tomato inflorescence is a cyme, suggested that the SFT gene confers floral meristem identity in tomato and that SFT activity was not an absolute requirement during early inflorescence development since, after floral transition, the sft mutant first produced flowers. They also postulated that the J gene may be implicated in the maintenance of the floral meristem identity (Lozano et al., 2000
). By contrast, viewing the tomato reproductive structure as a raceme-like inflorescence, it was considered that the SFT gene regulates the identity of the inflorescence meristem of tomato and is also involved, along with the J gene, in the maintenance of this identity preventing reversion to a vegetative identity. SFT and J are not allelic since they have been located on different chromosomes (Kerr, 1982
; Mao et al., 2000
). The J gene has been cloned and was shown to belong to the extensive family of MADS box genes (Mao et al., 2000
). J is in the same clade as the Arabidopsis SHORT VEGETATIVE PHASE (SVP) gene which is a floral transition repressor (Brill and Watson, 2004
; Hartmann et al., 2000
).
Other tomato mutants affected in their inflorescence structure are uf, and blind (bl). The uf mutant, which produces solitary flowers, is affected in a gene that regulates flowering time and inflorescence meristem identity (Dielen et al., 1998
, 2004
). The product of the UF gene has not yet been identified. The bl mutant forms inflorescences with a reduced number of flowers (Schmitz et al., 2002
) suggesting that the BL gene is implicated in the maintenance of the inflorescence meristem. BL has been cloned and is a member of the R2R3 class of MYB transcription factors. To date, none of the R2R3 MYB transcription factors is known to play a role in Arabidopsis flowering regulation.
In Arabidopsis, three inflorescence meristem identity genes have been described: TERMINAL FLOWER1 (TFL1), TERMINAL FLOWER2 (TFL2), and AGAMOUS-LIKE24 (AGL24) (Larsson et al., 1998
; Yu et al., 2004
). The tfl1 and tfl2 mutants produce a small inflorescence because of the early production of a terminal flower (Larsson et al., 1998
; Takada and Goto, 2003
). The tomato TFL1 orthologue is the SP gene (Pnueli et al., 1998
). To date, TFL2 and AGL24 do not have known orthologues in tomato.
In conclusion, this study has extended current knowledge of the genetic control of flowering in tomato by the characterization of the compound inflorescence mutant that had not previously been described and by revisiting the phenotypes of the jointless and single flower truss mutants. The functions of the altered genes are still to be ascertained and their potential interactions remain to be elucidated. The search for additional genes implicated in the flowering control of tomato will also contribute to a better understanding of the mechanisms governing this critical physiological step.
| Acknowledgements |
|---|
This work was supported by the Fonds National de la Recherche Scientifique (FNRS) of Belgium (Fonds de la Recherche Fondamentale et Collective, 2001-4). MQ is grateful to the FNRS for the award of a research fellowship. HB is a Research associate of the FNRS.
| Footnotes |
|---|
Abbreviations: AC, Ailsa Craig; AP1, APETALA1; bl, blind; Hz, Heinz; fa, falsiflora; FUL, FRUITFULL; id1, indeterminate 1; j, jointless; LFY, LEAFY; pfg, petunia flowering gene; Pl, Platense; s, compound inflorescence; sft, single flower truss; SP, SELF PRUNING; uf, uniflora.
| References |
|---|
|
|
|---|
Ahearn KP, Johnson HA, Weigel D, Wagner DR. 2001. NFL1, a Nicotiana tabacum LEAFY-like gene, controls meristem initiation and floral structure. Plant Cell Physiology 42, 11301139.
Allen KD, Sussex IM. 1996. Falsiflora and anantha control early stages of floral meristem development in tomato (Lycopersicon esculentum Mill.). Planta 200, 254264.
Andersen CH, Jensen CS, Petersen K. 2004. Similar genetic switch systems might integrate the floral inductive pathways in dicots and monocots. Trends in Plant Science 9, 105107.[CrossRef][Web of Science][Medline]
Bernier G, Périlleux C. 2005. A physiological overview of the genetics of flowering time control. Plant Biotechnology Journal 3, 316.
Boss PK, Bastow RM, Mylne JS, Dean C. 2004. Multiple pathways in the decision to flower: enabling, promoting, and resetting. The Plant Cell 16, S18S31.
Brill EM, Watson JM. 2004. Ectopic expression of a Eucalyptus grandis SVP orthologue alters the flowering time of Arabidopsis thaliana. Functional Plant Biology 31, 217224.[CrossRef]
Colasanti J, Yuan Z, Sundaresan V. 1998. The indeterminate gene encodes a zinc finger protein and regulates a leaf-generated signal required for the transition to flowering in maize. Cell 93, 593603.[CrossRef][Web of Science][Medline]
Corbesier L, Coupland G. 2005. Photoperiodic flowering of Arabidopsis: integrating genetic and physiological approaches to characterization of the floral stimulus. Plant, Cell and Environment 28, 5466.[CrossRef]
Dielen V, Marc D, Kinet J-M. 1998. Flowering in the uniflora mutant of tomato (Lycopersicon esculentum Mill.): description of the reproductive structure and manipulation of flowering time. Plant Growth Regulation 25, 149157.
Dielen V, Lecouvet V, Dupont S, Kinet J-M. 2001. In vitro control of floral transition in tomato (Lycopersicon esculentum Mill.), the model for autonomously flowering plants, using the late flowering uniflora mutant. Journal of Experimental Botany 52, 715723.
Dielen V, Quinet M, Chao J, Batoko H, Havelange A, Kinet J-M. 2004. UNIFLORA, a pivotal gene that regulates floral transition and meristem identity in tomato (Lycopersicon esculentum). New Phytologist 161, 393400.[CrossRef]
Ellul P, Angosto T, Garcia-Sorgo B, Garcia-Hurtado N, Martin-Trillo M, Salinas M, Moreno V, Lozano R, Martinez-Zapater JM. 2004. Expression of Arabidopsis APETALA1 in tomato reduces its vegetative cycle without affecting plant production. Molecular Breeding 13, 155163.
Emery GC, Munger HM. 1970. Alteration of growth and flowering in tomatoes by the Jointless genotype. The Journal of Heredity 61, 5153.
Evans LT. 1993. Crop evolution, adaptation and yield. Cambridge: Cambridge University Press.
Hartmann U, Hohmann S, Nettesheim K, Wisman E, Saedler H, Huijser P. 2000. Molecular cloning of SVP: a negative regulator of the floral transition in Arabidopsis. The Plant Journal 21, 351360.[CrossRef][Web of Science][Medline]
Immink RGH, Hannapel DJ, Ferrario S, Busscher M, Franken J, Lookeren Campagne MM, Angenent GC. 1999. A petunia MADS box gene involved in the transition from vegetative to reproductive development. Development 126, 51175126.[Abstract]
Jack T. 2004. Molecular and genetic mechanisms of floral control. The Plant Cell 16, S1S17.
Kerr EA. 1982. Single flower truss sft appears to be on chromosome 3. Tomato Genetics Cooperative Reports 32, 31.
Kinet J-M, Peet MM. 1997. Tomato. In: Wien HC, ed. The physiology of vegetable crops. Wallingford, UK: CAB International, 207258.
Larsson AS, Landberg K, Meeks-Wagner DR. 1998. The TERMINAL FLOWER2 (TFL2) gene controls the reproductive transition and meristem identity in Arabidopsis thaliana. Genetics 149, 597605.
Lozano R, Angosto T, Capel J, Gomez P, Molinero-Rosales N, Zurita S, Jamilena M. 2000. Floral transition and flower development in tomato: functional homology with Arabidopsis. Flowering Newsletter 30, 2633.
Mao L, Begum D, Chuang H-W, Budiman MA, Symkowiak EJ, Irish EE, Wing RA. 2000. JOINTLESS is a MADS-box gene controlling tomato flower abscission zone development. Nature 206, 910913.
Molinero-Rosales N, Jamilena M, Zurita S, Gomez P, Capel J, Lozano R. 1999. FALSIFLORA, the tomato orthologue of FLORICAULA and LEAFY, controls flowering time and floral meristem identity. The Plant Journal 20, 685693.[CrossRef][Web of Science][Medline]
Molinero-Rosales N, Latorre A, Jamilena M, Lozano R. 2004. SINGLE FLOWER TRUSS regulates the transition and maintenance of flowering in tomato. Planta 218, 427434.[CrossRef][Web of Science][Medline]
Périlleux C, Bernier G. 2002. The control of flowering: do genetical and physiological approaches converge? In: O'Neill SD, Roberts JA, eds. Plant reproduction: annual plant reviews, Vol. VI. Sheffield, UK: Sheffield Academic Press, 132.
Philouze J. 1978. Comparaison des effets des gènes J et J-2 conditionnant le caractère jointless chez la tomate et les relations d'épistasie entre j et j-2 dans les lignées de même type variétal. Annales d'Amélioration des Plantes 28, 431445.
Pnueli L, Carmel-Goren L, Hareven D, Gutfinger T, Alvarez J, Ganal M, Zamir D, Lifschitz E. 1998. The SELF-PRUNING gene of tomato regulates vegetative to reproductive switching of sympodial meristems and is the orthologue of CEN and TFL1. Development 125, 19791989.[Abstract]
Schmitz G, Tillmann E, Carriero F, Fiore C, Cellini F, Theres K. 2002. The tomato Blind gene encodes a MYB transcription factor that controls the formation of lateral meristems. Proceedings of the National Academy of Sciences, USA 99, 10641069.
Szymkowiak EJ, Irish EE. 1999. Interactions between jointless and wild-type tomato tissues during development of the pedicel abscission zone and the inflorescence meristem. The Plant Cell 11, 159175.
Takada S, Goto K. 2003. TERMINAL FLOWER2, an Arabidopsis homologue of HETEROCHROMATIN PROTEIN1, counteracts the activation of FLOWERING LOCUS T by CONSTANS in the vascular tissues of leaves to regulate flowering time. The Plant Cell 15, 28562865.
van Nocker S, Muszynski M, Briggs K, Amasino RM. 2000. Characterization of a gene from Zea mays related to the Arabidopsis flowering-time gene LUMINIDEPENDENS. Plant Molecular Biology 44, 107122.[CrossRef][Medline]
Yu H, Ito T, Zhao Y, Peng J, Kumar P, Meyerowitz EM. 2004. Floral homeotic genes are targets of gibberellin signalling in flower development. Proceedings of the National Academy of Sciences, USA 101, 78277832.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. Thouet, M. Quinet, S. Ormenese, J.-M. Kinet, and C. Perilleux Revisiting the Involvement of SELF-PRUNING in the Sympodial Growth of Tomato Plant Physiology, September 1, 2008; 148(1): 61 - 64. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



