JXB Advance Access originally published online on May 23, 2006
Journal of Experimental Botany 2006 57(8):1685-1696; doi:10.1093/jxb/erl001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Published by Oxford University Press [2006] on behalf of the Society for Experimental Biology.
RESEARCH PAPER |
Genome-wide analysis of plant glutaredoxin systems
Unité Mixte de Recherches 1136 Interaction arbres microorganismes, INRA, Université Henri Poincaré, IFR 110, Génomique Ecologie et Ecophysiologie Fonctionnelles, Faculté des Sciences, BP 239, F-54506 Vandoeuvre-lès-Nancy Cedex, France
*To whom correspondence should be addressed. E-mail: nrouhier{at}scbiol.uhp-nancy.fr
Received 16 March 2006; Accepted 27 March 2006
| Abstract |
|---|
|
|
|---|
The recent release of the first tree genome (Populus trichocarpa) has allowed a comparison to be made of the multigenic glutaredoxin (Grx) and glutathione reductase (GR) families of this tree with those of other sequenced organisms and especially of the two other fully sequenced plant species, Arabidopsis thaliana and Oryza sativa. Grxs are small proteins involved in disulphide bridge or proteinglutathione adduct reduction, and they are maintained in a reduced form using glutathione and an NADPH-dependent GR. While the P. trichocarpa and O. sativa genomes are nearly five times larger than that of A. thaliana, they contain
45 000 and 37 500 genes compared with the 25 500 genes of A. thaliana. On the one hand, the GR gene composition varies little between species and the gene structures are relatively conserved. On the other hand, the Grx gene family can be divided into three subgroups and the gene content is larger in P. trichocarpa (36 genes) compared with A. thaliana and O. sativa (31 and 27 genes, respectively). This could be partly explained by the occurrence of more duplication events, and this is especially true for one of the three identified Grx subgroups (subgroup III). The expression of most of these genes was confirmed by analysing expressed sequence tags present in various databases. In addition, the expression of Grx of subgroups I and II was examined by RTPCR in various poplar organs. A complete classification based essentially on gene structure and sequence identity is proposed. Key words: Genome, glutaredoxin, glutathione reductase, oxidative stress, poplar
| Introduction |
|---|
|
|
|---|
When submitted to adverse environmental conditions (biotic or abiotic stresses), plants very often react by generating oxidative bursts. To avoid biological damage, the concentration of the oxidizing species must be kept under control. One of the most documented functions of glutaredoxins (Grxs) in plants is their involvement in the oxidative stress response. They are implicated in many different ways, for example by directly reducing peroxides or dehydroascorbate (DHA), by reducing peroxiredoxins (Prx), and also by protecting thiol groups on other enzymes via gluathionylation/deglutathionylation mechanisms (for a review, see Rouhier et al., 2004). Grxs need to be reduced in order to function, the reducing system being composed of an NADPH-dependent pyridine nucleotide oxidoreductase called glutathione reductase (GR) and the small tripeptide, glutathione.
Populus has become a model organism in many laboratories to study the physiology, ecology, and genetics of forest trees for the following reasons. It has a relatively small nuclear genome,
550 Mbp, which is quite similar in size to that of rice and about four times larger than that of Arabidopsis. All species are diploid and can be easily crossed. In addition, poplars grow quickly, they can be multiplied by clonal propagation and methods for transformation and regeneration are available. Finally, extensive genetic maps, including the identification of quantitative trait loci (QTLs) are available. With the release of version 1.1 of the Populus trichocarpa genome (http://genome.jgi-psf.org/Poptr1/Poptr1.home.html) by the DOE JGI (US Department Of Energy, Joint Genome Institute), restricted to researchers involved in the annotation process, a process of manual curation and correction started. The initial task was to collect all the sequences of interest in the Joint Genome Institute Populus Genome Sequence Database, and to correct genes with false annotations. Additional searches, essentially using the tBLASTN search and annotated Arabidopsis thaliana sequences, were performed on the entire genome to ensure that no gene of interest was missing.
In this study, the Grx system, one of the two major systems [together with the thioredoxin (Trx) system] involved in dithioldisulphide exchanges was investigated. As GR is the key enzyme required for the reduction of Grx since it reduces glutathione using NADPH, and glutathione is the Grx reductant, a section describing the organization of the genes coding for those proteins is also included in this study. The Grx and GR gene distribution and organization in poplar were compared with the two other known plant genomes. Only two review articles have been devoted to the description of Grx in higher plants and more precisely in A. thaliana, but there is no information about the gene distribution in other higher plants (Lemaire, 2004; Rouhier et al., 2004). Additional information comes from other photosynthetic organisms such as Chlamydomonas reinhardtii or Synechocystis sp, which possess a smaller set of Grx genes than A. thaliana (Lemaire, 2004). This review will thus mostly emphasize the genome-wide distribution of GR and Grx in plants including poplar, rice and Arabidopsis (Arabidopsis Genome Initiative, 2000; International Rice Genome Sequencing Project, 2005) and focus on recent data showing the involvement of Grx in the oxidative stress response. Indeed, one of the challenges of the future is to understand why so many genes, with putative identical or similar functions, are present. One way to answer the question of gene redundancy is to study their spatial and temporal expression, the localization of their products, and their specificity towards target enzymes.
| Materials and methods |
|---|
|
|
|---|
RTPCR
Total RNA isolation was performed with the RNeasy Plant Mini kit (Qiagen) from
100 mg of frozen tissue from various poplar organs [roots, young and mature leaves, stems, petioles, fruits, and flowers (more precisely stamens)]. To remove contaminating DNA, the samples were treated with DNase I (Qiagen). Except for the stem, for which 300 ng was used, 1 µg of total RNA was converted to cDNA using reverse transcriptase (Qiagen). PCR was performed at an annealing temperature of 54 °C, and 35 cycles were used except for Grx C1,2 for which 40 cycles were used. The Ptrc Trx h1 gene, which is expressed in all the tissues tested, was amplified simultaneously (35 cycles) and used as a control. The primers used for these RTPCR experiments were originally designed for cloning the full-length open reading frame of poplar Grx sequences into prokaryotic expression vectors, and thus they contain NcoI or BamHI restriction sites (underlined). In order to differentiate between Ptrc Grx C1,1 and 2, a common reverse primer was used (Grx C1 rev) but with a different forward primer (either Grx C1,1 for or Grx C1,2 for). The primer sequences are as follows: Grx C1,1 for, 5' CCCCCCATGGCTAGCAAGCAAGAACTTGAT 3'; Grx C1,2 for, 5' GAGATGAGCAAACAGGCTGC 3'; Grx C1 rev, 5' CCCCGGATCCTCAAAGCTGGGCAGAGGT 3'; Grx C2 for, 5' CCCCCCATGGCTATGAACAAGGCGAAGGAG 3'; Grx C2 rev, 5' CCCCGGATCCTTAAGCAGAAGCAGAGAC 3'; Grx C3 for, 5' CCCCCCATGGCTTTAGCAAATGAATTGAAA 3'; Grx C3 rev, 5' CCCCGGATCCCTACTCCGTGCCTAGAAG 3'; Grx C4 for, 5' TCTTCCATGGCGACGAGGATAAGATT 3'; Grx C4 rev, 5'; GGGGGGATCCTTAAAAGTCATCTTTCTGCTC 3'; Grx S12 for, 5' CCCCCCATGGCTTCCTTTGGGTCCAGGCTC 3'; Grx S12 rev, 5' CCCCGGATCCTTAGCCCTGTGACTTTTTAGC 3'; Grx S14 for, 5' CCCCCCATGGCTTTGACTCCTGCGCTGAAG 3'; Grx S14 rev, 5' CCCCGGATCCTCAAGAGCACATTGCCTT 3'; Grx S15 for, 5' CCCCCCATGGCTTCTACCAACATTCCCAAT 3'; Grx S15 rev, 5' CCCCGGATCCTTATTCGGACTCCTCTTT 3'; Grx S16 for, 5' CCCCCCATGGCTACCATCACCATC 3'; Grx S16 rev, 5' CCCCGGATCCTTATTTTTTGAAGTGACCGGCGAG 3'; Grx S17 for, 5' CCCCCCATGGCTGGTGGGTCAGTGAAGGAC 3'; Grx S17 rev, 5' CCCCGGATCCCTACTCGGATAGGGTAGA 3'; Trx h1 for, 5' GGGGCCATGGCCGAAGAAGGACAAGT 3', and Trx h1 rev, 5' GGGGGGATCCTTATGCAGTTGCGTGCTTTG 3'.
| The glutaredoxin family |
|---|
|
|
|---|
Identified Grx functions in plant cells
As explained above, the high number of genes coding for Grx suggests that these proteins should have many important biological functions. Figure 1 summarizes established roles for plant Grxs and putative functions based on available data in other organisms. A recent finding, not linked to oxidative stress, is that some Grxs of subgroup II (AtGrx S14 and AtGrx S16) interact with Ca2+ transporters and probably regulate their activity (Cheng and Hirschi, 2003). Indirectly, this suggests that Grxs could be involved in cell signalling by regulating the Ca2+ concentration. Plant Grxs could play additional roles, uncharacterized so far, in signalling, such as the regulation of phosphatases or transcription factors, two well-known reactions in other organisms. For example, a protein tyrosine phosphatase 1B from soybean was shown to be regulated via cysteine glutathiolation (Dixon et al., 2005).
|
Another important new result is the demonstration that a Grx of subgroup III (AtGrx C7; At3g02000) is implicated in petal development (Xing et al., 2005). This is not very surprising since a survey of poplar expressed sequence tags (ESTs) or the use of Genevestigator for A. thaliana Grx genes indicate that many A. thaliana or P. trichocarpa Grx genes are strongly expressed in flowers. Despite these emerging functions, most recent studies deal with the involvement of Grx in the oxidative stress response either directly or indirectly.
One of the first activities described for plant Grx is the reduction of DHA (Sha et al., 1997; Rouhier et al., 2003). This observation is important as it constitutes an alternative pathway to dehydroascorbate reductase (DHAR) to reduce DHA into ascorbate, one of the main antioxidant molecules. Nevertheless, the catalytic efficiency of poplar Grx C4 (kcat of 25 s1) is
20-fold lower than that of DHAR (kcat of 490 s1 for a recombinant spinach enzyme) (Shimaoka et al., 2003). Another well documented indirect role for plant Grx is the possibility to reduce specifically one Prx subgroup. Prxs are haem-free thiol-dependent peroxidases which reduce various peroxides using conserved catalytic cysteines. Plant Prxs are divided into five subgroups, depending essentially on the catalytic mechanism used and the position of these conserved catalytic cysteines (Dietz, 2003; Rouhier and Jacquot, 2005a). Among the five subgroups, Grxs are only able to reduce type II Prxs, whereas Prxs of other groups are reduced by Trxs but not by Grxs (Rouhier et al., 2001; Bréhelin et al., 2003; Finkemeier et al., 2005; N Rouhier, unpublished results). In poplar, as well as in A. thaliana and O. sativa, Prxs II are present in the cytosol (Prx IIBD), in the chloroplasts (Prx IIE), and in mitochondria (Prx IIF). Although the proteins are somewhat different, all the poplar type II Prxs are probably able to use Grx as a reductant (Rouhier et al., 2002; N Rouhier, unpublished results), which is apparently not the case in A. thaliana, for example where Prx IIE was not reduced by the Grx tested (Bréhelin et al., 2003). This observation is confirmed by the fact that Prxs IIB, IIE, and IIF were trapped on a monocysteinic Grx column (Rouhier et al., 2005b). As at least one Grx is putatively present in each compartment (see below), this in vitro specificity could be of physiological significance. Another function demonstrated for a Grx from O. sativa (OsGrx C2, Os04g42930) is its ability to reduce hydrogen peroxide directly (Lee et al., 2002). Nevertheless, its catalytic efficiency is rather low. In addition, this activity is probably not a general characteristic, since all poplar Grxs tested so far do not possess such an activity (Rouhier et al., 2003; N Rouhier, unpublished results). Recently, a cis-element, which responds to a methylviologen-generated oxidative stress, was identified in the promoter of the Grx from O. sativa, mentioned above, confirming that some Grx isoforms should play an important role in the antioxidative network (Tsukamoto et al., 2005). It was described earlier that one way to control the reactive oxygen species levels in cells is to oxidize methionine residues randomly on proteins. The methionine sulphoxide residues generated need to be converted back to methionine to restore the integrity of the damaged proteins, and this is performed by an enzyme called methionine sulphoxide reductase (Stadtman et al., 1996). This enzyme has a special catalytic mechanism which generally requires Trx as a regenerating system. In plants, some Grxs can replace Trx for this function (N Rouhier et al., unpublished results).
Among other functions identified for plant Grxs is the possibility of reducing a specific poplar Trx h isoform, called Ptrc Trxh4 (Gelhaye et al., 2003). This interaction between Grx and Trx systems in plants is probably not the only example, since a chloroplastic Trx f was shown to be regulated by glutathiolation (Michelet et al., 2005). Grxs are thus the prime candidates to catalyse both the glutathiolation and deglutathiolation processes.
Many other putative functions for plant Grxs arise from a proteomic study in which 94 putative target proteins were identified (Rouhier et al., 2005b). As most of these proteins were also identified as putative Trx partners, the physiological significance of this observation needs to be evaluated with caution. Nevertheless, it could be that most of these enzymes and especially those belonging to the Calvin or the Krebs cycle can be regulated by glutathiolation. It is already known that poplar Grx C4 is able to catalyse deglutathiolation in in vitro tests, and that several plant proteins, including type II Prx and aldolase, can be glutathiolated in vitro or in vivo (Ito et al., 2003; Rouhier et al., 2006). It is likely that in plants submitted to abiotic or biotic stresses, these phenomena occur on a large scale especially in the organelles where the majority of the reactive oxygen species are produced, and it will thus be of considerable interest to know which among the Grx isoforms are involved in those post-translational modifications.
The original discovery of Grx in Escherichia coli was related to its involvement in deoxyribonucleotide synthesis as a feeding system for the enzyme ribonucleotide reductase (Fernandes and Holmgren, 2004). This reaction is obviously also essential for DNA synthesis in plant cells and so it is clear that plant Grxs should be involved. This area of research remains largely unexplored, however, except that a plant ribonucleotide reductase has been identified in green algae (Feller et al., 1980), and that plant Grx was shown to be able to reduce bacterial ribonucleotide reductase (Rouhier et al., 2003).
In other organisms such as mammals, yeast or E. coli, Grxs have also been shown to participate in the haem or FeS assembly machinery, but no clear role has been defined (Rodriguez-Manzaneque et al., 2002; Mulhenhoff et al., 2003; Achebach et al., 2004; Wingert et al., 2005) and this has not been addressed in plants yet. Likewise, a poplar Grx which contains an ironsulphur centre has recently been identified (Feng et al., 2005, 2006; N Rouhier et al., unpublished results). Other ironsulphur-containing Grxs such as human mitochondrial Grx2 have also been identified (Lillig et al., 2005). As plant organelles possess their own electron transfer chains with ironsulphur-containing proteins, it is likely that some plant Grx isoforms will be involved in these processes. Likewise, the maturation of cytochrome c and haem attachment require the presence of thioredoxin-like molecules (Meyer et al., 2005).
Comparison of Grxs in higher plant genomes
Based on sequence alignments, active site sequences and construction of unrooted phylogenetic trees, three Grx subgroups can be distinguished. These subgroups are similar to those already described for A. thaliana Grx (Rouhier et al., 2004).
Subgroup I contains classical Grxs with CPYC, CGYC, CPFC, and CSY[C/S] active sites. This group comprises five different classes of Grx (Grx C1C4 and S12) which differ in their active site sequences. The nomenclature used (C or S) is based on the presence of a cysteine or a serine in the fourth position of the active site (CxxC or CxxS). The situation is different for the three plants analysed (Table 1; Fig. 2). For example, there is no CGYC-containing Grx (Grx C1) in O. sativa but two in P. trichocarpa. On the other hand, O. sativa contains two CPFC isoforms (Grx C2) whereas only one is present in P. trichocarpa and none in A. thaliana. Finally, instead of two CPYC Grxs as in P. trichocarpa or A. thaliana, the rice genome possesses only one CPYC isoform, but it also displays one CPYS isoform which is not present in the two other genomes. Using a BLAST search, this CPYS sequence was only found in other plants belonging to the Poaceae or in some fungi (data not shown and Table 2). This could constitute a specificity of Grxs from cereal as already observed for the Trx h gene family (Gelhaye et al., 2005). Finally, two isoforms with WCSYC or WCSYS active sites are present in A. thaliana, but only one, with a WCSYS active site, is present in P. trichocarpa and O. sativa. These proteins display an N-terminal transit peptide, which is predicted to convey the protein into plastids (Table 1).
|
|
|
The proteins of subgroup II possess CGFS active sites, but they differ in the number of repeated modules (one in Grx S14, S15 and S16, and three in Grx S17) and thus in their size, ranging from 170 to 492 amino acids. In addition to the Grx domain, Grx S16 possesses an additional module in the N-terminal part, which is related to a Trx domain, as it presents a WCDAS sequence, close to some atypical Trx active sites. Subgroup II is thus made up of four different classes, as also shown in Fig. 2. These Grxs were previously identified as a PICOT HD domain (for protein kinase C-interacting cousin of thioredoxin homology domain) (Isakov et al., 2000), but some characteristics other than the active site sequences and especially a conserved motif [K\G] GE[L\F][I/V]GG[C/S], specific to Grx and present in the C-terminus part of these proteins, allow them to be identified as Grxs. At least one gene from the three species analysed is present in each class, but the situation is also different among plants (Table 1; Fig. 2). There are two Grx S15 in O. sativa but only one in P. trichocarpa and A. thaliana. In contrast, there are two Grx S17 in P. trichocarpa but one in A. thaliana and O. sativa. Again, the presence of two closely related genes in some species probably arises from duplication events. This observation is reinforced by the very high identity between these sequences (92% between PtrcGrx S17,1, and 2, and 88% between OsGrx S15,1 and 2).
In A. thaliana, all the proteins of subgroup III possess active sites of the CC[M/L][C/S] form, except one with a CCLG active site (At1g03850) (Rouhier et al., 2004). The situation is almost similar in P. trichocarpa; only one sequence is divergent, with a CYMS active site. In O. sativa, the active site sequences vary greatly compared with A. thaliana or P. trichocarpa. Indeed, some atypical active sites, differing in the second or fourth position or both, such as CFMC or CPMC, CGMC, CGMS, CCMA, CCLI, and CYMA, are found in O. sativa [respective accession numbers Os01g70990, Os12g35340, Os11g43520, Os05g05730, Os01g13950, Os01g47760, and Os01g09830 of The Institute of Genome Research (TIGR)]. Again, these sequences are not restricted to O. sativa, since a BLAST search against plant ESTs indicates that similar active site sequences are mostly present in Poaceae such as Hordeum vulgare, Triticum aestivum or Zea mays (data not shown).
In addition to cytosolic isoforms, prediction softwares indicate that N-terminal extensions may target Grx to several plant compartments, i.e. mitochondria, plastids, and endoplasmic reticulum (ER). Since no protein displays a KDEL retention signal in the ER, they will probably be excreted. Among the poplar Grxs of subgroups I and II, three proteins (Grx S12, S14, and S16) are predicted to be localized in plastids, one (Grx S15) in mitochondria, two or three (Grx C2, C3, and C4) in the ER, and four or five (Grx C1,1 and 2, Grx C2, and Grx S17,1 or 2) in the cytosol (Table 1). Most of the proteins of subgroup III are extremely small, as they possess only 99102 amino acids. This suggests that they should be essentially located in the cytosol, unless they can be imported into organelles without an N-terminal extension. Indeed, one of these Grxs (At3g15660), devoid of an N-terminal extension, was found in a mitochondrial proteomic study devoted to the identification of proteins able to bind divalent cations (Herald et al., 2003).
Gene structure
Among the three sequenced plant genomes, the Grx gene organization is almost conserved (Fig. 3A and data not shown). As already proposed for A. thaliana Trxs, one of the criteria to classify genes into families is to consider the position of introns in the genomic sequences (Meyer et al., 2002). In the three genomes, all genes of subgroup III are encoded by a unique exon, indicating that they belong to a unique class (not shown in Fig. 3). All the genes of subgroup I are made up of four exons and three introns except the closely related genes Grx C5 or S12 (with CSYC/S active sites), which are composed of five exons (Fig. 3A and data not shown). In subgroup II, the situation is a bit more complex; the Grx S15, S16, and S17 genes contain six exons, two exons, and three exons, respectively, whatever the organism considered (Fig. 3A and data not shown). This further confirms that these Grxs constitute independent classes. Interestingly, the Grx S14 gene is composed of three exons in P. trichocarpa, two in O. sativa, and one in A. thaliana. For unknown reasons, this gene is the only one which differs between the three organisms. When present, the N-terminal extension, which is supposed to direct the proteins into the organelles, is included in the first exon (Ptrc Grx C3, C4, S12, S14 and S16), except for Ptrc Grx S15, for which this extension is also present in the second exon.
|
Comparison with other sequenced organisms
Among plants, the number of Grx genes is larger in P. trichocarpa (36), compared with A. thaliana (31) and O. sativa (27) (Table 2). This difference mainly arises from a larger subgroup III. In other photosynthetic organisms (C. reinhardtii and Synechocystis sp), the number of genes is lower (six and three, respectively), although C. reinhardtii possesses the four different CGFS-containing Grxs. This strongly suggests that some functions, specific to higher plants, are regulated via specific Grxs. On the other hand, all other genomes analysed in this study, including viruses, contain at least one Grx gene, suggesting that Grx is an essential protein (Table 2 and data not shown). Surprisingly, there are only three Grx genes in mammals and up to five or six genes in some bacteria, yeast, or fungi.
In addition to the plant-specific subgroup III, one way to explain the difference between plant and non-plant genomes or within plant genomes is to look for gene duplication. Identification of whole-genome duplication events was performed using the double-affine SmithWaterman algorithm (Tuskan et al., 2006 in preparation). This analysis indicates that 13 Grx genes, which belong essentially to subgroup III (nine genes), were duplicated in P. trichocarpa. Nevertheless, the four other genes, which encode Grx C1,1 or 2 and Grx S17,1 or 2, were only duplicated in poplar but not in A. thaliana or O. sativa. However, it seems that Grx S15 was duplicated only in rice.
Grx expression in P. trichocarpa, O. sativa, and A. thaliana
The expression of Grxs of subgroups I and II was first analysed by identifying among the 375 000 poplar ESTs available in the GenBank database those representing Grxs. All these Grxs are expressed, but two isoforms, Grx C2 and Grx C4, are highly represented with 71 and 58 ESTs, respectively (Table 1). Other genes are expressed at lower levels, from one EST for Grx C1,2 to 29 ESTs for Grx S14 (Table 1).
These data were completed by following in planta Grx transcript levels in various plant organs using reverse transcriptionpolymerase chain reaction (RTPCR) (Fig. 4). A saturating number of cycles (generally 35 cycles) was used to make sure that the gene products could be detected, preventing quantification and comparison of expression levels between plant organs. Of course, it cannot be excluded that some genes, which were not detected under the experimental conditions used, can be expressed in other growth conditions or can be temporally regulated. This could be addressed, for example, by generating reporter lines using promoter sequences. All the Grxs tested are expressed in mature leaves, flowers, stems, petioles, and fruits, except for Grx S17 (1 or 2) which is only expressed at detectable levels in flowers and petioles, and Grx C4 which is not present in flowers, taking into account the sensitivity of the detection technique employed. On the other hand, only a few genes are expressed in roots (Grx C4 and Grx S12) and in young leaves (Grx C1,2, and Grx S14 and S15). Finally, as a sequence specific enough to discriminate between the two isoforms of Grx S17,1 or 2 could not be found in the cDNA and as ESTs representing these two genes were found, the signal obtained is probably the sum of the expression of the two genes. While all the genes of subgroups I and II are expressed in at least one tissue, the situation is not so clear in subgroup III. Indeed, for some genes, either ESTs could not be found in the GenBank databases or it was not possible to discriminate between two very close isoforms (data not shown). It is likely that after some duplication events, some genes are no longer expressed.
|
The expression of rice Grx was investigated using available ESTs present in the TIGR database. The conclusion is that all the Grxs of subgroups I and II are expressed since at least one EST was found for each of them. A high representation was found for Os04g42930, suggesting that this isoform could be constitutively expressed in most organs. Concerning proteins of subgroup III, as in poplar, the number of ESTs is generally low and there is sometimes no expression at all.
Recently, a very good analysis tool, called Genevestigator (https://www.genevestigator.ethz.ch/), was developed from data obtained from A. thaliana microarray experiments (Zimmerman et al., 2004). This software allows, among other things, access to the variations in expression of many genes in various plant organs, growth stages, or stress conditions. These results were combined with those described by Mittler et al. (2004). Of interest for this special issue is the involvement of A. thaliana Grx in stress responses. The principal gene whose transcription is significantly modified upon stress exposure is At1g03850. Using Genevestigator, it was found that the expression of genes annotated as At4g15690, At1g28480, and At3g62950 is also modified by various treatments such as salt, salicylic acid, or ozone applications. They also respond to the application of many chemicals, especially acrylate ester or cycloheximide. Finally, programmed cell death or biotic infections by Pseudomonas syringae or Botrytis cinerea are also a source of major modifications. In addition, the data described by Mittler and colleagues indicate that the expression of four other genes (At1g06830, At4g15660, At4G15700, and At5g18600) is modified and almost exclusively repressed following heat, drought, salt, or high light treatments (Mittler et al., 2004). The products of all those genes, which belong to subgroup III, have not been characterized yet. All other genes and especially the most characterized Grxs of subgroups I and II seem to be poorly regulated at the transcript level in stress situations. This behaviour is slightly surprising as classical Grxs were shown to be involved in stress responses in many ways.
| The glutathione reductase family |
|---|
|
|
|---|
GRs are flavoproteins in which electrons and protons are transferred from NADPH to a FAD prosthetic group and finally to a reactive disulphide bridge. The size of these proteins ranges from 497 to 565 amino acids, depending on the presence of an N-terminal extension, which should direct the protein into different subcellular compartments (Fig. 5; Table 1). This N-terminal extension is predicted to be a signal for protein import into plastids. Two classes of proteins can thus be distinguished: GR1 are the shorter cytosolic enzymes, and GR2 are the elongated organellar proteins. The size of the mature proteins is thus
500 amino acids. As shown in the amino acid sequence alignment presented in Fig. 5, the two cysteines of the GR redox centre are separated by four amino acid residues in the highly conserved motif GGTCV[I/L]RGCVPKK[I/L]LVY. The amino acid sequence identity of GR1 of the three model plants ranges from 71% to 91%, whereas the identity of GR2 oscillates between 64% and 77%. When the two subgroups are compared, identities are lower, comprised between 43% and 51%. Other characteristics are presented in Table 1.
|
The GR gene structure is well conserved among higher plants, since they are composed either of 10 exons (GR2) or of 16 exons (GR1) (Fig. 3B). Both the exon sizes and the intron positions of homologous genes are well conserved within a single species (for example between GR1.1 and 1.2 from P. trichocarpa) but also between plant species (GR1 from P. trichocarpa, A. thaliana, and O. sativa, or GR2 from P. trichocarpa, A. thaliana, and O. sativa). More surprising is the presence of only two genes coding for GR in Arabidopsis, belonging to the two categories described above, whereas three genes were found in O. sativa and P. trichocarpa. This difference probably arises from a duplication event in these two species. In poplar, the gene probaby duplicated is composed of 16 exons, whereas that of O. sativa is the 10 exon variant. Examination of the various databases [Munich Information Center for Protein Sequences (MIPS), TIGR or Genbank at NCBI] confirmed that all these isoforms are expressed.
A maximum of three GR genes were identified, and only one of them contains a transit sequence. Thus, if it is confirmed experimentally that Grxs are present in nearly all plant compartments, the corresponding reducing system should be expressed in these compartments. One possible explanation is that the transit sequence of GR contains signals for a bipartite localization (chloroplast and mitochondria) as demonstrated in pea (Chew et al., 2003a). This feature is not unusual as other enzymes involved in the ascorbate/glutathione cycle possess similar properties (Chew et al., 2003b). Another possibility is that one sequence devoid of transit peptide could be destined for the organelles. This needs to be proven experimentally, by green fluorescent protein (GFP) fusion experiments for example, but proteomics could also provide an answer to this puzzling question.
| Concluding remarks |
|---|
|
|
|---|
This study highlights the great diversity of genes coding for Grxs in higher plants by providing evidence that a model tree, poplar, is even more complex than the known herbaceous species. Surprisingly, the key enzyme (GR) for the reduction of Grx is coded by a very restricted number of genes in all model species studied. As plant Grxs are predicted to be localized in multiple subcellular compartments including the cytosol, chloroplasts, and mitochondria, it seems logical that its reducing system should also be present in these compartments. To date, most of the roles identified for Grx are linked to oxidative stress responses, but considering the growing number of proteins or processes regulated by Grx in other organisms, exciting new developments concerning the functions of Grxs and similar proteins in plants can certainly be expected to occur very quickly, following the present efforts of genomic analyses.
| Acknowledgements |
|---|
The authors would like to thank Francis Martin, Jerry Tuskan, Uffe Hellsten, and Stephen DiFazio for helpful discussions and help in duplication event analysis.
| Abbreviations |
|---|
DHA, dehydroascorbate; DHAR, dehydroascorbate reductase; ER, endoplasmic reticulum; EST, expressed sequence tag; GR, glutathione reductase; Grx, glutaredoxin; Prx, peroxiredoxin; Trx, thioredoxin.
| References |
|---|
|
|
|---|
Achebach S, Tran QH, Vlamis-Gardikas A, Mullner M, Holmgren A, Unden G. (2004) Stimulation of FeS cluster insertion into apoFNR by Escherichia coli glutaredoxins 1, 2 and 3 in vitro. FEBS Letters 565:203206.[CrossRef][Web of Science][Medline]
Arabidopsis Genome Initiative. (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408:796815.[CrossRef][Medline]
Bréhelin C, Meyer EH, de Souris JP, Bonnard G, Meyer Y. (2003) Resemblance and dissemblance of Arabidopsis type II peroxiredoxins: similar sequences for divergent gene expression, protein localization, and activity. Plant Physiology 132:20452057.
Cheng NH and Hirschi KD. (2003) Cloning and characterization of CXIP1, a novel PICOT domain-containing Arabidopsis protein that associates with CAX1. Journal of Biological Chemistry 278:65036509.
Chew O, Rudhe C, Glaser E, Whelan J. (2003a) Characterization of the targeting signal of dual-targeted pea glutathione reductase. Plant Molecular Biology 53:341356.[CrossRef][Web of Science][Medline]
Chew O, Whelan J, Millar AH. (2003a) Molecular definition of the ascorbateglutathione cycle in Arabidopsis mitochondria reveals dual targeting of antioxidant defenses in plants. Journal of Biological Chemistry 278:4686946877.
Dietz KJ. (2003) Plant peroxiredoxins. Annual Review of Plant Biology 54:93107.[CrossRef][Medline]
Dixon DP, Fordham-Skelton AP, Edwards R. (2005) Redox regulation of a soybean tyrosine-specific protein phosphatase. Biochemistry 44:76967703.[Medline]
Feller W, Schimpff-Weiland G, Follmann H. (1980) Deoxyribonucleotide biosynthesis in synchronous algae cells. European Journal of Biochemistry 110:8592.[Medline]
Feng Y, Rouhier N, Jacquot JP, Xia B. (2005) Letter to the Editor: (1)H, (15)N, and (13)C resonance assignments of reduced glutaredoxin C1 from Populus tremulaxtremuloides. Journal of Biomolecular NMR 31:263264.[Medline]
Feng Y, Zhong N, Rouhier N, Hase T, Kusunoki K, Jacquot JP, Jin C, Xia B. (2006) Structural insight into poplar glutaredoxin C1 with a bridging iron sulfur cluster at the active site. Biochemistry (in press).
Fernandes AP and Holmgren A. (2004) Glutaredoxins: glutathione-dependent redox enzymes with functions far beyond a simple thioredoxin backup system. Antioxidants and Redox Signalling 6:6374.[CrossRef][Web of Science][Medline]
Finkemeier I, Goodman M, Lamkemeyer P, Kandlbinder A, Sweetlove LJ, Dietz KJ. (2005) The mitochondrial type II peroxiredoxin F is essential for redox homeostasis and root growth of Arabidopsis thaliana under stress. Journal of Biological Chemistry 280:1216812180.
Gelhaye E, Rouhier N, Jacquot JP. (2003) Evidence for a subgroup of thioredoxin h that requires GSH/Grx for its reduction. FEBS Letters 555:443448.[Medline]
Gelhaye E, Rouhier N, Navrot N, Jacquot JP. (2005) The plant thioredoxin systems. Cellular and Molecular Life Sciences 62:2435.[CrossRef][Web of Science][Medline]
Herald VL, Heazlewood JL, Day DA, Millar AH. (2003) Proteomic identification of divalent metal cation binding proteins in plant mitochondria. FEBS Letters 537:96100.[CrossRef][Web of Science][Medline]
International Rice Genome Sequencing Project. (2005) The map-based sequence of the rice genome. Nature 436:793800.[CrossRef][Medline]
Isakov N, Witte S, Altman A. (2000) PICOT-HD: a highly conserved protein domain that is often associated with thioredoxin and glutaredoxin modules. Trends in Biochemical Sciences 25:537539.[CrossRef][Medline]
Ito H, Iwabuchi M, Ogawa K. (2003) The sugar-metabolic enzymes aldolase and triose-phosphate isomerase are targets of glutathionylation in Arabidopsis thaliana: detection using biotinylated glutathione. Plant and Cell Physiology 44:655660.
Lee KO, Lee JR, Yoo JY, et al. (2002) GSH-dependent peroxidase activity of the rice (Oryza sativa) glutaredoxin, a thioltransferase. Biochemical and Biophysical Research Communications 296:11521156.[CrossRef][Medline]
Lemaire SD. (2004) The glutaredoxin family in oxygenic photosynthetic organisms. Photosynthesis Research 79:305318.[CrossRef][Web of Science][Medline]
Lillig CH, Berndt C, Vergnolle O, Lonn ME, Hudemann C, Bill E, Holmgren A. (2005) Characterization of human glutaredoxin 2 as ironsulfur protein: a possible role as redox sensor. Proceedings of the National Academy of Sciences, USA 102:81688173.
Meyer EH, Giege P, Gelhaye E, Rayapuram N, Ahuja U, Thony-Meyer L, Grienenberger JM, Bonnard G. (2005) AtCCMH, an essential component of the c-type cytochrome maturation pathway in Arabidopsis mitochondria, interacts with apocytochrome c. Proceedings of the National Academy of Sciences, USA 102:1611316118.
Meyer Y, Vignols F, Reichheld JP. (2002) Classification of plant thioredoxins by sequence similarity and intron position. Methods in Enzymology 347:394402.[Web of Science][Medline]
Michelet L, Zaffagnini M, Marchand C, et al. (2005) Glutathionylation of chloroplast thioredoxin f is a redox signaling mechanism in plants. Proceedings of the National Academy of Sciences, USA 102:1647816483.
Mittler R, Vanderauwera S, Gollery M, Van Breusegem F. (2004) Reactive oxygen gene network of plants. Trends in Plant Sciences 9:490498.
Mulenhoff U, Gerber J, Richhardt N, Lill R. (2003) Components involved in assembly and dislocation of ironsulfur clusters on the scaffold protein Isu1p. EMBO Journal 22:48154825.[CrossRef][Web of Science][Medline]
Rodriguez-Manzaneque MT, Tamarit J, Belli G, Ros J, Herrero E. (2002) Grx5 is a mitochondrial glutaredoxin required for the activity of iron/sulfur enzymes. Molecular Biology of the Cell 13:11091121.
Rouhier N, Gama F, Wingsle G, Gelhaye E, Gans P, Jacquot JP. (2006) Engineering functional artificial hybrid proteins between poplar peroxiredoxin II and glutaredoxin or thioredoxin. Biochemical and Biophysical Research Communication 341:13001308.
Rouhier N, Gelhaye E, Sautiere PE, Brun A, Laurent P, Tagu D, Gerard J, de Fay E, Meyer Y, Jacquot JP. (2001) Isolation and characterization of a new peroxiredoxin from poplar sieve tubes that uses either glutaredoxin or thioredoxin as a proton donor. Plant Physiology 127:12991309.
Rouhier N, Gelhaye E, Jacquot JP. (2002) Glutaredoxin-dependent peroxiredoxin from poplar: proteinprotein interaction and catalytic mechanism. Journal of Biological Chemistry 277:1360913614.
Rouhier N, Gelhaye E, Jacquot JP. (2004) Plant glutaredoxins: still mysterious reducing systems. Cellular and Molecular Life Sciences 61:12661277.[CrossRef][Web of Science][Medline]
Rouhier N and Jacquot JP. (2005a) The plant multigenic family of thiol peroxidases. Free Radicals in Biology and Medicine 38:14131421.
Rouhier N, Villarejo A, Srivastava M, et al. (2005b) Identification of plant glutaredoxin targets. Antioxidants and Redox Signaling 7:919929.[CrossRef][Web of Science][Medline]
Rouhier N, Vlamis-Gardikas A, Lillig CH, Berndt C, Schwenn JD, Holmgren A, Jacquot JP. (2003) Characterization of the redox properties of poplar glutaredoxin. Antioxidants and Redox Signaling 5:1522.[CrossRef][Medline]
Sha S, Minakuchi K, Higaki N, et al. (1997) Purification and characterization of glutaredoxin (thioltransferase) from rice (Oryza sativa L.). Journal of Biochemistry 121:842848.
Shimaoka T, Miyake C, Yokota A. (2003) Mechanism of the reaction catalyzed by dehydroascorbate reductase from spinach chloroplasts. European Journal of Biochemistry 270:921928.[Web of Science][Medline]
Stadtman ER, Moskovitz J, Berlett BS, Levine RL. (2002) Cyclic oxidation and reduction of protein methionine residues is an important antioxidant mechanism. Molecular and Cellular Biochemistry 234235:39.
Tsukamoto S, Morita S, Hirano E, Yokoi H, Masumura T, Tanaka K. (2005) A novel cis-element that is responsive to oxidative stress regulates three antioxidant defense genes in rice. Plant Physiology 137:317327.
Wingert RA, Galloway JL, Barut B, et al. Tubingen 2000 Screen Consortium. (2005) Deficiency of glutaredoxin 5 reveals FeS clusters are required for vertebrate haem synthesis. Nature 436:10351039.[CrossRef][Medline]
Xing S, Rosso MG, Zachgo S. (2005) ROXY1, a member of the plant glutaredoxin family, is required for petal development in Arabidopsis thaliana. Development 132:15551565.
Zimmermann P, Hennig L, Gruissem W. (2005) Gene-expression analysis and network discovery using Genevestigator. Trends in Plant Sciences 10:407409.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. M. Perez-Ruiz, M. Gonzalez, M. C. Spinola, L. M. Sandalio, and F. J. Cejudo The Quaternary Structure of NADPH Thioredoxin Reductase C Is Redox-Sensitive Mol Plant, May 1, 2009; 2(3): 457 - 467. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Couturier, C. S. Koh, M. Zaffagnini, A. M. Winger, J. M. Gualberto, C. Corbier, P. Decottignies, J.-P. Jacquot, S. D. Lemaire, C. Didierjean, et al. Structure-Function Relationship of the Chloroplastic Glutaredoxin S12 with an Atypical WCSYS Active Site J. Biol. Chem., April 3, 2009; 284(14): 9299 - 9310. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-H. Gao, M. Bedhomme, D. Veyel, M. Zaffagnini, and S. D. Lemaire Methods for Analysis of Protein Glutathionylation and their Application to Photosynthetic Organisms Mol Plant, March 1, 2009; 2(2): 218 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kirchsteiger, P. Pulido, M. Gonzalez, and F. J. Cejudo NADPH Thioredoxin Reductase C Controls the Redox Status of Chloroplast 2-Cys Peroxiredoxins in Arabidopsis thaliana Mol Plant, March 1, 2009; 2(2): 298 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Chibani, G. Wingsle, J.-P. Jacquot, E. Gelhaye, and N. Rouhier Comparative Genomic Study of the Thioredoxin Family in Photosynthetic Organisms with Emphasis on Populus trichocarpa Mol Plant, March 1, 2009; 2(2): 308 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Li, A. Lauri, M. Ziemann, A. Busch, M. Bhave, and S. Zachgo Nuclear Activity of ROXY1, a Glutaredoxin Interacting with TGA Factors, Is Required for Petal Development in Arabidopsis thaliana PLANT CELL, February 1, 2009; 21(2): 429 - 441. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Izquierdo, C. Casas, U. Muhlenhoff, C. H. Lillig, and E. Herrero Saccharomyces cerevisiae Grx6 and Grx7 Are Monothiol Glutaredoxins Associated with the Early Secretory Pathway Eukaryot. Cell, August 1, 2008; 7(8): 1415 - 1426. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sundaram, B. Rathinasabapathi, L. Q. Ma, and B. P. Rosen An Arsenate-activated Glutaredoxin from the Arsenic Hyperaccumulator Fern Pteris vittata L. Regulates Intracellular Arsenite J. Biol. Chem., March 7, 2008; 283(10): 6095 - 6101. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Navrot, V. Collin, J. Gualberto, E. Gelhaye, M. Hirasawa, P. Rey, D. B. Knaff, E. Issakidis, J.-P. Jacquot, and N. Rouhier Plant Glutathione Peroxidases Are Functional Peroxiredoxins Distributed in Several Subcellular Compartments and Regulated during Biotic and Abiotic Stresses Plant Physiology, December 1, 2006; 142(4): 1364 - 1379. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









