Skip Navigation

Journal of Experimental Botany 2007 58(13):3609-3621; doi:10.1093/jxb/erm209
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Klinghammer, M.
Right arrow Articles by Tenhaken, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klinghammer, M.
Right arrow Articles by Tenhaken, R.
Agricola
Right arrow Articles by Klinghammer, M.
Right arrow Articles by Tenhaken, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2007 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. This paper is available online free of all access charges (see
http://jxb.oxfordjournals.org/open_access.html for further details)


RESEARCH PAPER

Genome-wide analysis of the UDP-glucose dehydrogenase gene family in Arabidopsis, a key enzyme for matrix polysaccharides in cell walls

Michaela Klinghammer1 and Raimund Tenhaken2,*

1University of Frankfurt, Plant Molecular Biology, Biocenter, D-60439 Frankfurt, Germany
2University of Salzburg, Plant Physiology, Hellbrunnerstr. 34, A-5020 Salzburg, Austria

* To whom correspondence should be addressed. E-mail: raimund.tenhaken{at}sbg.ac.at

Received 5 June 2007; Revised 5 August 2007 Accepted 8 August 2007


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Arabidopsis cell walls contain large amounts of pectins and hemicelluloses, which are predominantly synthesized via the common precursor UDP-glucuronic acid. The major enzyme for the formation of this nucleotide-sugar is UDP-glucose dehydrogenase, catalysing the irreversible oxidation of UDP-glucose into UDP-glucuronic acid. Four functional gene family members and one pseudogene are present in the Arabidopsis genome, and they show distinct tissue-specific expression patterns during plant development. The analyses of reporter gene lines indicate gene expression of UDP-glucose dehydrogenases in growing tissues. The biochemical characterization of the different isoforms shows equal affinities for the cofactor NAD+ (~40 µM) but variable affinities for the substrate UDP-glucose (120–335 µM) and different catalytic constants, suggesting a regulatory role for the different isoforms in carbon partitioning between cell wall formation and sucrose synthesis as the second major UDP-glucose-consuming pathway. UDP-glucose dehydrogenase is feedback inhibited by UDP-xylose. The relatively (compared with a soybean UDP-glucose dehydrogenase) low affinity of the enzymes for the substrate UDP-glucose is paralleled by the weak inhibition of the enzymes by UDP-xylose. The four Arabidopsis UDP-glucose dehydrogenase isoforms oxidize only UDP-glucose as a substrate. Nucleotide-sugars, which are converted by similar enzymes in bacteria, are not accepted as substrates for the Arabidopsis enzymes.

Key words: Cell wall precursor, gene expression, hemicellulose, nucleotide-sugar, UDP-glucose dehydrogenase


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Plant cells are surrounded by a rigid but often flexible cell wall to counterbalance the high osmotic pressure inside the cells. Therefore, plant growth requires extensive synthesis of cell wall material during development. The principal composition of Arabidopsis cell walls, analysed from leaves of 4–5-week-old plants, was determined previously (Zablackis et al., 1995). This study indicates a high amount of pectic polymers and hemicelluloses, together forming the matrix polysaccharides, in which cellulose fibrils are embedded along with cell wall structural proteins. Matrix polysaccharides are synthesized in the Golgi apparatus by polymer synthases, which require nucleotide-sugars as glycosyl donors. Excellent reviews of the complex nucleotide-sugar interconversion pathways have been published recently (Gibeaut, 2000; Reiter and Vanzin, 2001; Seifert, 2004). Based on the study by Zablackis et al. (1995), one can calculate that ~50% of the cell wall biomass is derived from the precursor UDP-glucuronic acid (UDP-GlcA). This nucleotide-sugar is the direct precursor of UDP-galacturonic acid after epimerization (Mølhøj et al., 2004; Usadel et al., 2004), UDP-xylose and UDP-apiose after decarboxylation (Kobayashi et al., 2002), and UDP-arabinose derived from UDP-xylose by an epimerase (Burget et al., 2003). Plants have evolved two independent pathways for the synthesis of UDP-GlcA; this fact underlines the importance of this nucleotide-sugar for plant growth. One pathway involves the direct oxidation of UDP-glucose (UDP-Glc) into UDP-GlcA by the enzyme UDP-glucose dehydrogenase (UDP-{alpha}-D-glucose:NAD+ oxidoreductase; EC 1.1.1.2 [EC] 2; UGD) (Tenhaken and Thulke, 1996). Alternatively, UDP-GlcA can be formed in a more complex reaction via ring cleavage of myo-inositol into glucuronic acid, followed by subsequent activation of the sugar to UDP-GlcA (Loewus et al., 1962; Seitz et al., 2000; Kanter et al., 2005). Because of the unique entry enzyme of the pathway, myo-inositol oxygenase (MIOX), this route is often referred to as the MIOX pathway for UDP-GlcA formation.

The UGD enzyme uses UDP-Glc, available from photosynthesis assimilates, as a substrate. The major competing alternative pathway for the consumption of UDP-Glc is the synthesis of sucrose-6-phosphate by the enzyme sucrose-6-phosphate synthase (SPS), which provides the precursor for the major phloem metabolite sucrose (Winter and Huber. 2000). In addition, UDP-Glc may also be used directly as a glycosyl donor for cellulose synthase or for the formation of callose at the plasma membrane.

UGD oxidizes the C6 carbon of glucose from an alcohol to a carbonic group in two subsequent oxidation reactions with no release of intermediates (Ge et al., 2004). The overall reaction is energetically irreversible, with the consequence that UDP-GlcA can be used exclusively for the synthesis of cell wall matrix polysaccharides, glucuronylation of secondary compounds, and post-translational modification of glycoproteins. The separation of the nucleotide-sugars into a pool of mostly cell wall-specific precursors (UDP-GlcA, UDP-GalA, UDP-Ara, UDP-Xyl, and UDP-apiose) and a pool used for the synthesis of storage compounds (sucrose) and cell walls (UDP-Glc and UDP-Gal) raises the question of which UDP-sugar(s) feed into the cell wall precursor pool (Seifert, 2004). Whereas UDP-Glc is undoubtedly the major substrate for UGDs, it is discussed controversially whether UDP-galactose could be a direct precursor of UDP-galacturonic acid for pectic polymers (Stewart and Copeland, 1998).

The first gene for a eukaryotic UGD was cloned from soybean (Tenhaken and Thulke, 1996). From measuring the enzymatic activity and analysing public DNA databases, it is evident that UGD genes are present in almost all organisms, with the exception of a few with a secondarily reduced genome like the yeast Saccharomyes cerevisiae. Often several isoforms of UGD are present in plants, a finding which has only been studied in maize so far (Karkonen et al., 2005). Most papers on plant UGDs have either ignored the existence of isoforms or performed a combined analysis of several isoforms simultaneously. Here the analysis of the UGD gene family of Arabidopsis is reported to give a comprehensive overview of the gene expression of different isoforms and their biochemical properties.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bioinformatics
To identify all UGD-like genes from Arabidopsis the public databases in GenBank were searched. All expressed sequence tag (EST) sequences with high similarity to UGD could be assigned to one of the four UGD genes present in the sequenced Arabidopsis genome.

A fifth UGD gene with a weaker similarity was detected at the top of chromosome 3. A detailed analysis suggested a partial sequence of an additional UGD gene (UGD5). To rule out any assembling error in the genome project, the genomic situation for this region was verified by PCR. The primers GCCGGAACAGGATTAGGCTT and CTAGAGGAGACGCCTGTAAC from the flanking neighbouring genes amplified a product of the predicted size (1381 bp) according to the data in the genome project.

Reporter gene analysis
The promotor sequences of UGD1, 2, 3, and 4 were amplified by PCR using the primer combinations given in Table 1. Genomic DNA from Arabidopsis thaliana was used as template. PCR products were cloned in front of the uidA gene of vector pBI101 (Clontech MountainView, CA, USA) (UGD1, 2, and 3) or pGreen (http://www.pgreen.ac.uk) (UGD4) via the relevant restriction cleavage sites.


View this table:
[in this window]
[in a new window]

 
Table 1. Primer sequences used for constructs and mRNA amplification

 
Cloning products were verified by DNA sequencing (Seqlab, Göttingen, Germany) and plasmids were transferred into Agrobacterium tumefaciens GV 3101. Subsequently, A. thaliana Col-0 plants were transformed by the floral dip method developed by Clough and Bent (1998). Several independent transformants were stained for β-glucuronidase (GUS) activity and a typical line was chosen for detailed analysis.

For reporter gene analysis, seedlings were grown sterile on 0.5x MS medium (#M0245, Duchefa Biochemie, Haarlem, The Netherlands), pH 5.7 (KOH) with 0.5% (w/v) sucrose and 0.25% (w/v) PhytagelTM (Sigma-Aldrich, Munich, Germany) or on soil in growth chambers (23 °C, 50% relative humidity). Plants were cultured either with an 8 h light period (fluorescent bulbs ~100 µE m–2 s–1) or in the dark. Seedlings of different developmental stages and distinct plant tissues were collected and stained with X-Gluc for GUS activity for 5 min–16 h, using the protocol of Jefferson (1987). Plants were photographed with a Leica stereo microscope (Leica MZFL III, Solms, Germany), equipped with a digital camera (Canon PowerShot S40). Pictures were assembled in Adobe PhotoshopCS 8.0.1.

Total RNA isolation and real-time PCR
For total RNA isolation, seedlings were grown sterile on MS plates in growth chambers for 6 d with 8 h light periods or in the dark as described above. About 100 mg of plant material (light-grown seedlings, etiolated seedlings, roots, and cotyledons/hypocotyl of seedlings) were collected, frozen in liquid nitrogen, and homogenized by a ball mill (Retsch MM200, 3x30 s, frequency 30 Hz). Total RNA was isolated by the acid phenol/guanidinium thiocyanate method (Chomczynski and Sacchi, 1987). First-strand cDNA was synthesized by using a RevertAidTM M-MuLV Reverse Transcriptase Kit (Fermentas GmbH), according to the supplier's protocol, and 3 µg of total RNA.

Real-time PCR was performed using 1 µl of a 1/20 (v/v) dilution of first-strand cDNA reaction, 1x reaction buffer [10 mM TRIS-HCl pH 8.5, 50 mM KCl, 0.15% Triton X-100, 2.5 mM MgCl2 (Karsai et al., 2002)], 200 µM dNTPs, 200 nM of each primer, SYBR green (Roche, Mannheim, Germany) diluted to a 1:200 000 concentration, and 1.5 U of Taq (total reaction volume 30 µl) using a Stratagene Mx3000P QPCR system (Statagene, La Jolla, CA, USA). For primer oligonucleotide sequences, see Table 1. PCR was conducted using the following amplification conditions: 94 °C for 3 min, 40x [94 °C for 30 s, 65 °C (UGD1 and 3), 57 °C (UGD2), or 58 °C (UGD4) for 45 s, 72 °C for 1 min], 95 °C for 1 min, 65 °C for 30 s. Each primer pair amplified a single product, as indicated by the melting curve of the amplicons. The resulting CT values were normalized to the average of the Ct values of the transcript of the housekeeping gene ubiquitin-5 (At3g62250) (Karsai et al., 2002) amplified under the following conditions: 94 °C for 3 min, 40x (94 °C for 15 s, 56 °C for 20 s, 72 °C for 20 s), 95 °C for 1 min, 65 °C for 30 s.

Expression vector constructs
For cloning into expressions vectors, the open reading frame (ORF) of each UGD was amplified by PCR (Phusion High-Fidelity DNA Polymerase Kit, New England Biolabs) using the primer combinations listed in Table 1 and full-length EST clones as templates: UGD1, M77J01; UGD2, AV43959; UGD3, 43C9T7; and UGD4, 105N9T7 (Arabidopsis Stock Center). The PCR products were cloned into pQE31 (Qiagen, Hilden, Germany; UGD2–4) or into pET21a (UGD1) (Novagen, Darmstadt, Germany) via the relevant restriction cleavage sites. Each construct was confirmed by DNA sequencing (Seqlab, Göttingen, Germany).

The expression vector constructs were co-transformed with pGroESL (Amrein et al., 1995) into the Escherichia coli expression strain OrigamiTM (Novagen, Darmstadt, Germany).

Protein expression and purification
The E. coli expression strains were routinely grown in LB medium containing 100 µg ml–1 ampicillin, 34 µg ml–1 chloramphenicol, 20 µg ml–1 tetracyclin and 50 µg ml–1 kanamycin at 37 °C overnight, inoculated at 1/100 dilution in LB medium (antibiotics as above), and cultured to an OD600 of ~0.4 under vigorous shaking. After cooling the cultures for 15 min at room temperature, protein expression was induced by addition of 500 µM isopropyl-β-D-thiogalactopyranoside (IPTG). The cultures were grown at 23 °C for a further 20 h.

After cooling the cultures by shaking for 15 min on ice, cells were harvested by centrifugation (10 min at 4500 g and 4 °C) and frozen in liquid nitrogen after discarding the supernatant. Subsequently, cells were thawed in 10 ml g–1 FW chilled disruption buffer [50 mM sodium phosphate, 10 mM TRIS-HCl pH 8.0, 10% (v/v) glycerol, 2 mM MgCl2, 2 mM 2-mercaptoethanol, 1 mM NAD+, 0.2 mM phenylmethylsulphonyl fluoride (PMSF, disolved in isopropanol)] by vigorous vortexing. Lysozyme at 200 µg ml–1 and 1% (v/v) Nonidet P-40 were added and shaken slowly on ice for 45 min to disrupt bacterial cells gently. Bacterial debris was removed by centrifugation for 10 min at 14 500 g and 4 °C. The supernatant was transfered into a new tube; 2.4 U ml–1 benzonase nuclease HC (Novagen, Darmstadt, Germany) was added and incubated for 15 min by shaking slowly on ice. The clear supernatant was applied to a Ni-NTA-agarose column (Qiagen, Hilden, Germany) equilibrated with NTA-1 buffer [50 mM sodium phosphate, 10 mM TRIS-HCl pH 8.0, 250 mM NaCl, 10% (v/v) glycerol, 0.5 mM NAD+], after addition of 250 mM NaCl. The column was washed with 5 vols of NTA-1 buffer and 5 vols of NTA-2 buffer (NTA-1 buffer with 20 mM imidazole) to remove all weakly bound proteins. UGD proteins were eluted by addition of 2.5 vols of NTA-3 buffer (NTA-1 buffer with 250 mM imidazole). The enzymes were immediately transfered into storage buffer [20 mM TRIS-HCl pH 8.7, 50 mM KCl, 10% (v/v) glycerol, 0.5 mM NAD+] by gel filtration on a PD10 column (Amersham Bioscience, Freiburg, Germany). The enzymes could be stored at –80 °C (>6 months) after being frozen in liquid nitrogen without any reduction in activity. UGD protein purification was verified by SDS–PAGE.

The yeast strain Toy4, expressing a His-tagged version of Arabidopsis UGD1, was a kind gift of Dr Y Jigami. UGD1 was expressed and purified from a yeast extract according to Oka and Jigami (2006).

Enzyme assays and kinetic analysis
The enzyme activity of UGD was determined photometrically at 340 nm (Beckmann photometer DU640) by the increase of NADH. The assays were performed for 1–10 min at room temperature in assay buffer [40 mM TRIS-HCl pH 8.7, 0.8 mM EDTA, 16% (v/v) glycerol, 0.8 mM NaN3]. For the determination of kinetic parameters, (i) saturated concentrations of NAD+ (500 µM) and various concentrations of UDP-glucose (0.01–1.5 mM) were used; or (ii) various NAD+ concentrations (0.01–1.5 mM) and a constant UDP-glucose concentration (2 mM) were used. The amount of the UGD added was based on enzymatic activity and was set to 0.03 OD340 units change per minute. The final reaction volumn was set to 1 ml. Triplicate values were obtained for each measurement, and data were plotted with Microcal Origin 6.0G Professional. The Km values were calculated from the hyperbolic curve using the least-square algorithm of the Origin-software.

Product analysis
The substrates and products of UGD enzyme assays were analysed by high-performance liquid chromatography (HPLC; Dionex U3000 system) using ion-pair chromatography on an RP18-column (Prontosil 120 C18 AQ-Plus 150x3 mm). Separation was performed in buffer A (25 mM tetraethylammonium acetate; pH 6) for 8 min, followed by a linear gradient to 25% buffer B (buffer A plus 20% acetonitrile) for 10 min using a flow rate of 0.5 ml min–1. UV spectra were recorded from 240 nm to 300 nm and plotted for the wavelength 260 nm. The reference compounds UDP-Glc was from MP-Biomedical; UDP-Gal, UDP-glucuronic acid, and UMP were purchased from Sigma.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Identification of the UGD genes in Arabidopsis
In Arabidopsis, the UGD gene family is represented by four transcribed members (UGD1–4) and one pseudogene (UGD1, At1g26570; UGD2, AT3g29360; UGD3, At5g15490; and UGD4, At5g39320). The Arabidopsis UGD described earlier (Seitz et al. 2000) is termed UGD2 herein. The four UGDs encode very similar proteins of 480–481 amino acids. The difference (including conserved exchanges) in the amino acid sequence is <10% between the four isoforms (Fig. 1). The schematic structure of the (pre)-mRNA is shown in Fig. 1. All of the four UGDs contain a single intron of variable length in the 5’ untranslated region whereas the full ORF is not disrupted by further introns. The amino acid sequence variations between the four isoforms are not uniformly distributed along the whole sequence and between all isoforms. Clustering of amino acid exchanges occurs between different pairs of UGDs, indicating that a simple recent gene duplication event does not account for the four UGD isoforms in Arabidopsis.


Figure 1
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Schematic structure of primary RNA transcript protein sequences for UGD genes. (A) All four UGD genes contain a single intron in the 5’ untranslated region, represented by small boxes. The larger boxes represent the ORFs of UGD14. Each single amino acid change from the consensus sequence is represented by a black line in the ORF. The double-headed arrow above the sequences shows the NAD+-binding site. The downward pointing arrows above the sequences indicate the cysteine residue essential for catalyis in all UGDs. The upward pointing arrows below the bars indicate the position of all amino acids involved in glucose binding of UDP-Glc, which are positionally conserved between the UGDs from Arabidopsis and the UGD from Streptococcus pyogenes, for which a crystal structure is available (Campbell et al., 2000). (B) The table shows the percentage amino acid identity (left lower triangle) or similarity (right upper triangle) between the four different UGD isoforms. The sequences of UGD2, 3, and 4 are highly similar, but UGD1 differs significantly from the other sequences. (C) Aligment of some plant UGD sequences with ClustalX. The UGD1 from Arabidopsis clusters together with the two poplar sequences, distinct from the other Arabidopsis branch [At-UGD1-4 (this paper); Co-UGD1, Cinnamomum osmophleum gi|40317278; Glycine max Gm-UGD1, gi|6136119; Nicotiana tabaccum Nt-UGD1, gi|48093457, Nicotiana tabaccum Nt-UGD2, gi|48093459; Ps-UGD1, Pinus taeda Unigene Pta.24139; Ps-UGD2, Pinus taeda Unigene Pta.8150; Oryza sativa Os-UGD1, Os03g31210; Oryza sativa Os-UGD2, Os03g40720; Oryza sativa Os-UGD3, Os03g55070; Oryza sativa Os-UGD4, Os12g25690; Oryza sativa Os-UGD5, Os12g25700; Pt-UGD1, Populus trichocarpa eugene3.00041110; Populus trichocarpa Pt-UGD2, eugene3.00101501).

 
Based on the crystal structure of a UGD from Streptococcus pyogenes (Campbell et al., 2000), all of the amino acid residues involved in substrate binding and catalysis are absolutely conserved between the enzyme from bacteria and plants. The residues involved in binding the UDP-glucose are highlighted schematically in Fig. 1. Several plant UGD sequences were aligned using ClustalX to generate a bootstrapped Neighbor–Joining tree (Fig. 1C). The tree indicates a close proximity of Arabidopsis UGD2, 3, and 4, which cluster together with a UGD from soybean, but puts Arabidopsis UGD1 on a different branch. UGDs from rice cluster into groups of the same branch. Similarly, the two sequences from tobacco, Pinus tadea, and Populus each group together, suggesting gene duplication events after speciation. Further UGD sequences of EST libraries were not included because in many cases the algorithm for generating UNIGENE sequences in GenBank puts sequences from different isoforms into a single data set (e.g. tested for soybean; data not shown).

The pseudogene is lacking about two-thirds of the coding sequence including the NAD+-binding site, which is essential for catalytic activity. The chromosomal location at the very beginning of chromosome 3 suggests a segmental gene duplication during evolution, as indicated by the doubling of 37 recognized ORFs (At3g01010–At3g02020) matching a highly similar region on chromosome 5 (At5g15510–At5g14060).

Expression pattern of UGD genes in Arabidopsis
Promoter::GUS fusion constructs were used in stably transformed Arabidopsis plants to compare gene expression patterns of UGD1–4. The homozygous transgenic lines were analysed for each construct and a typical line was selected for a detailed analysis of the reporter gene activity. The pattern of the most abundantly active reporter UGD2::GUS is shown in Fig. 2 (compare also Fig. 4). UGD2::GUS activity is seen first during the germination process in 1-d-old seedlings, when the radicle breaks through the seed coat (Fig. 2a). In seedlings up to 5 d old, the activity of UGD2::GUS is restricted to the primary root (Fig. 2b). In particular, UGD2::GUS activity can be detected in roots tips, in young root hairs, and in the calyptra. In further growth phases, cotyledons show an even but low activity of the UGD2::GUS reporter gene, which is still highest in the roots (Fig. 2c, d). This pattern remains similar for the vegetative phase of the life cycle (Fig. 2e). Growth of seedlings in the dark leads to etiolated and elongated hypocotyls showing a strong UGD2::GUS activity in the hypocotyl (Fig. 2f). This reporter gene activity is absent in light-grown seedlings (Fig. 2b). In roots of etiolated seedlings a similar expression pattern to that of light-grown seedlings can be detected. During germination and the vegetative phase of the life cycle, a close correlation between growth, requiring UDP sugars for the synthesis of matrix polysaccharides, and the activity of the UGD2::GUS reporter is generally seen. The more complex pattern of UGD2::GUS activity in flowers and siliques is shown in Fig. 2g–k. In young flowers, UGD2::GUS activity can only be detected in the pistil. At later development stages, sepals and petals also show reporter gene activity (Fig. 2g). Also, UGD2::GUS activity is found in staminiferous and mature pollen (Fig. 2h). Siliques show UGD2::GUS activity in the abscission zone at the base and close to the top (Fig. 2k). No UGD2::GUS activity was observed in developing embryos or seeds.


Figure 2
View larger version (56K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Reporter gene expression of UGD2::GUS in transgenic Arabidopsis thaliana plants. Different tissues and development stages are shown. Seedlings were grown in light (a–e, g–k) or dark conditions (f): (a) 1-d-old seedlings; (b) 3-d-old seedling; (c) cotyledons of a 7-d-old seedling; (d) root tip; (e) 2-week-old Arabidopsis plant; (f) etiolated 4-d-old seedling; (g) buds and young flowers; (h) pollen sacs containing mature pollen; (i) older flower; (j) pollinated flower with developing silique; (k) different silique stages.

 

Figure 4
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. Quantitative expression analysis (real-time PCR) of UGD transcripts in 6-d-old seedlings of Arabidosis thaliana. Upper panel: seedlings were grown under two conditions (light or dark) on half-strength MS medium with 0.5% sucrose. Data are presented as relative expression values normalized to the average of ubiquitin-5 mRNA, which was set to 1. Values represent the mean ±SD of three measurements. Lower panel: data from AtGenexpress microarrays were analysed for UGD expression. The sum of all UGD transcripts was set as 1 and the fraction for each isoform is shown in the bars. RNA from 7-d-old hypocotyls and 17-d-old roots was used in the experiments.

 
In general, the expression patterns of UGD2, 3, and 4 are very similar. However, UGD1 shows an expression pattern which is distinct from that of the other isoforms. A comparison of the activity of the different UGD reporter gene constructs is shown in Fig. 3. In seedlings up to 4 d post-germination, UGD2, 3, and 4::GUS activity can only be detected in roots (Fig. 3a). This is in contrast to an almost inverse organ-specific pattern seen for UGD1::GUS (Fig, 3a). At 5 d post-germination this effect disappears. Furthermore, in young leaves, UGD1 and UGD4::GUS show a cell type-specific activity in guard cells and in basal cells surrounding each trichome (Fig. 3e, f). All isoforms exhibit reporter gene activity in 3–4-week-old leaves at a low level, and differences in the activity pattern become visible again in the reproductive phase. Activity of all UGD::GUS reporter genes is seen in the stigma, the filaments, and the mature pollen (Fig. 3b, c). However, the activity of UGD1::GUS is limited to these tissues. UGD3 and 4::GUS reporter are also active in the flower bases. Only UGD2::GUS shows a strong activity in sepals and petals, and in pollen sacks (Fig. 3b, c). In developing siliques, the vascular system shows UGD1, 2, and 3::GUS activity (Fig. 3e, f), and UGD2, 3, and 4::GUS are strongly expressed in the abscission zone at the base of siliques (Fig. 3d).


Figure 3
View larger version (54K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. UGD::GUS reporter gene expression in transgenic Arabidopsis thaliana plants reveals differential expression patterns for each UGD isoform (UGD1–4). (a) Two-day-old seedlings; (b) older flowers; (c) pollen sacs containing mature pollen; (d) base of siliques; (e, f) inside of siliques (manually opened; UGD1, 2, 3::GUS plants) and cotyledons with stained stomata (UGD1, 4::GUS plants).

 
Further analyses of expression of UGD genes in Arabidopsis via real-time PCR indicate that UGD2 is usually expressed at the highest level of all UGD genes in seedlings (Fig. 4, upper panel). In roots of seedlings, UGD2 and 3 are expressed at a very similar high level, while UGD4 is expressed only weakly and no UGD1 transcripts can be detected. Furthermore, in cotyledons and hypocotyl, UGD2 expression dominates again, in addition to lower levels of UGD3. Publicly available microarray data from AtGenexpress were also analysed. The RNA for the microarray hybridization was from 7-d-old hypocotyls and 17-d-old roots. The relative transcript amounts for each UGD gene are similar to our own data shown in the upper panel (Fig. 4, lower panel). As seen before with the reporter gene constructs, UGD1 expression can be demonstrated in cotyledons and hypocotyl. In etiolated seedlings, UGD2 and UGD3 are predominantly expressed.

Expression of recombinant UGD in E. coli
UGD converts UDP-Glc into UDP-GlcA and is located at a critical partitioning step for carbohydrates between the storage compound sucrose via the enzyme SPS and building blocks for matrix polysaccharides via the enzyme UGD. To obtain a deeper insight into the biochemical properties of the different UGD isoforms, the individual enzymes were expressed as recombinant proteins in E. coli by cloning the ORF of each UGD isoform into a His-tag expression vector. Though UGDs from different sources have been investigated as recombinant proteins, it was found to be necessary to optimize thoroughly the expression conditions for each of the highly homologous isoforms. Modifications of the procedure for soybean UGD expression in E. coli (Hinterberg et al., 2002) produced an adequate amount of active UGD2, 3, and 4 enzymes. An SDS–PAGE of the purified recombinant proteins, used for enzymatic analysis, is shown in Fig. 5. Several preparations of the recombinant proteins were analysed, which gave very similar data for the enzymatic activity. Expression of UGD1 could be obtained in E. coli but results in an inactive enzyme (data not shown). Several variations in E. coli culturing and protein purification conditions did not result in active recombinant UGD1 enzyme. Very recently Oka and Jigami (2006) published the expression of recombinant Arabidopsis UGD1 in yeast.


Figure 5
View larger version (87K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. SDS–PAGE analysis of recombinant UGD. Open reading frames of UGD2–4 were cloned into His-tagged expression vectors and transformed into E. coli. (a) Enzyme purification of active UGD3 (lanes 1–7) on SDS–PAGE (for purification details, see Materials and methods). Crude E. coli extract before IPTG induction (1) or 20 h after IPTG induction (2); (3) cell debris after centrifugation of disrupted E. coli cells; (4) column flow through; (5) flow through of washing step one; (6) flow through of washing step two; (7) purified recombinant UGD3 enzyme; lanes (8) and (9) show purification products of recombinant UGD2 and UGD3 enzyme; purification steps were carried out accordingly.

 
Enzyme kinetics
The affinity of the UGD isoforms for the cofactor NAD+ does not differ between UGD2, 3, and 4. All enzymes exhibit typical hyperbolic reaction kinetics, with a Km for NAD+ of ~40–45 µM (Table 2). The high affinity of the enzyme for NAD+ suggests that UGDs are not limited by the NAD+ supply under physiological conditions.


View this table:
[in this window]
[in a new window]

 
Table 2. Kinetic analysis of UGD2, 3, and 4 from Arabidopsis thaliana

 
In contrast to almost identical Km values for NAD+, the kinetic constants for UDP-Glc are highly dissimilar. UGD2 shows the highest affinity (of the UGDs studied here) for the substrate UDP-Glc, with a Km of 123 µM, followed by UGD4 (171 µM) and UGD3 (335 µM) (Table 2). The catalytic constant kcat was determined for the different isoforms with a value between 1.17 s–1 (UGD4) and 2.52 s–1 (UGD3) (see Table 2). Thus the different isoforms differ in the turnover rate of UDP-GlcA formation.

In some bacteria the activity of UGDs is modulated by phosphorylation on Tyr10, a conserved residue within the NAD-binding site (Mijakovic et al., 2004). Recombinant UGDs were incubated with alkaline phosphatase, which can dephosphorylate the bacterial UGD (Mijakovic et al., 2003, 2004), but no difference in the enzyme activity was found.

Fine tuning of UGD activity was reported to be mediated by feedback inhibition of the enzyme by UDP-xylose, a product obtained from UDP-GlcA after decarboxylation by the enzyme UDP-xylose synthase (Neufeld and Hall, 1965; Hinterberg et al., 2002). The Ki value for UDP-xylose was determined for each isoform in the presence of different concentrations of UDP-Glc. The inhibition is competitive to UDP-Glc and therefore is seen mostly at low concentrations of UDP-Glc in the assays. UGD2 is more sensitively inhibited by UDP-xylose (Ki ~83 µM) compared with UGD3 and 4, which exhibit a Ki of ~160 µM and 220 µM, respectively (Fig. 6a–c).


Figure 6
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. Inhibitory effect of UDP-xylose on UGD2, 3, and 4 from Arabidopsis thaliana. Saturation curves of UDP-glucose at various inhibitor concentrations (25–350 µM) are shown. Additional plots represent the apparent Km at different inhibitor concentrations revealing the Ki value. (a) UGD2; (b) UGD3; (c) UGD4.

 
The superfamily of nucleotide-sugar dehydrogenases is quite conserved, and the substrate specificity cannot readily be predicted by bioinformatic tools. Therefore, different nucleotide-sugars were tested to determine if they are accepted as substrates for UGDs from Arabidopsis (Table 3). Unlike UDP, activated forms of glucose (ADP-Glc and TDP-Glc) are not converted into the corresponding NDP-GlcA derivatives, suggesting no direct interference with the starch biosynthesis pathway. In contrast to previous studies (Stewart and Copeland, 1998), no evidence for a direct oxidation of UDP-galactose into UDP-galacturonic acid was found. Products of the enzyme assay were separated by HPLC (Fig. 7). A time-dependent increase of the product UDP-GlcA was observed, directly correlating to the increase in NADH in the spectophotometric assay. The product analysis for the substrate specificity assays is shown in Fig. 7 using recombinant UGD1. This isoform has the highest number of amino acid changes from the UGD consensus sequences (compare Fig. 1) and was thus considered to be the most likely candidate for a nucleotide-sugar dehydrogenase accepting substrates other than UDP-Glc. None of the four UGDs from Arabidopsis accepted UDP-galactose as a substrate (Fig. 7). In bacteria, members of the NDP-sugar dehydrogenase family use nucleotide-sugars such as GDP-mannose, UDP-galactose, UDP-N-acetylglucosamine or UDP-N-acetylgalactosamine as substrates. None of these potential substrates is accepted by the Arabidopsis UGDs. In summary, the data indicate that Arabidopsis has only true UGDs which accept UDP-Glc as their only substrate. The UGDs clearly prefer NAD+ as a cofactor. Exchanging NAD+ for NADP+ greatly reduces the enzyme activity to ~20% (Table 3).


View this table:
[in this window]
[in a new window]

 
Table 3. Substrate specifity of UGD1, 2, 3. and 4 from Arabidopsis thaliana

 

Figure 7
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7. Product analysis of UGD enzyme assays. (A) Standard compounds relevant for the enzyme assay (1, UMP; 2, UDP-Gal; 3, UDP-Glc; 4, UDP-GlcA). (B) UGD assay with recombinant UGD2, in which the substrate UDP-Glc is converted into UDP-GlcA. The minor peak in trace B corresponding to compound 1 represents UMP, a breakdown product of UDP-Glc hydrolysis. (C) Control assay in which the enzyme UGD2 was omitted. No UDP-GlcA product is formed. (D) Control assay in which UDP-Glc was omitted. The small peak #5 contains an unknown impurity. (E) Enzyme assays with recombinant UGD1 and substrate UDP-Glc, which is converted to UDP-GlcA by UGD1. (F) Enzyme assay with recombinant UGD1 and substrate UDP-Gal. UDP-Gal is not converted to an oxidized product but remains unchanged in the assay, indicating that UDP-Gal is not a substrate of UGD1.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The cell wall of Arabidopsis contains large amounts of hemicelluloses and pectic polymers, which are predominantly derived from the common precursor UDP-GlcA (Zablackis et al., 1995). Therefore, biochemical pathways for the formation of UDP-GlcA are of great importance for the supply of glycosyl donors for polymer synthases and glycosyl transferases in the Golgi apparatus. As the nucleotide-sugars derived from UDP-GlcA are almost exclusively used for the synthesis of cell wall material, the entry point of nucleotide-sugars into a pool for cell wall synthesis is tightly controlled. Previous studies have shown a close correlation between UGD transcripts and enzyme activity in Arabidopsis (Seitz et al., 2000). Furthermore, Gahan et al. (1997) and Johansson et al. (2002) have regarded UGD as a marker enzyme for developing xylem cells from cambium meristems in trees, because of a tight correlation between cell division, growth, and UGD enzyme activity. These studies have been extended by analysing the whole gene family of UGD genes from Arabidopsis. The available sequence data from the genome project as well as the sequenced EST libraries suggest four highly similar members of the UGD gene family in Arabidopsis (UGD1–4) in addition to a pseudogene (partial sequence). In the rice genome, at least five sequences for putative UGD genes can be identified (compare the tree in Fig. 1C). The presence of isoforms for UGDs was ignored in previous studies (Tenhaken and Thulke, 1996; Stewart and Copeland, 1998; Seitz et al., 2000; Turner and Botha, 2002). The main reason seems to be highly conserved amino acid sequences, which result in proteins with similar chromatographic properties.

Nucleotide-sugar dehydrogenases represent a large family of quite well conserved proteins, which oxidize the primary alcohol group at C6 of various sugars into the corresponding uronic acid (Roychoudhury et al., 1989). In bacteria, diverse substrates are converted by different family members. Based on multiple protein sequence alignments, it is likely that some of the annotations regarding the substrates are falsely assigned (data not shown). The PFAM database (http://www.sanger.ac.uk/Software/Pfam/) for patterns in proteins annotated the UGD-like genes from Arabidopsis and rice, and also plant EST sequences as ‘UDP-glucose/GDP-mannose dehydrogenase family’ (PF03721). This suggests that the substrate specificity of enzymes from this family cannot be predicted accurately by bioinformatics but needs experimental support. By expressing the proteins UGD1, 2, 3, and 4 as recombinant proteins, it has been shown here that they are true UGDs.

In the light of the separate nucleotide-sugar pools for cell wall synthesis and for sucrose synthesis, it is important to know whether UDP-Glc is the only entry point of nucleotide-sugars into the cell wall pool. Previously Stewart and Copeland (1998) reported that one of the soybean UGDs also accepts UDP-galactose as a substrate, suggesting that the pectin precursor UDP-galacturonic acid may be directly derived from UDP-galactose. This possibility is excluded for the Arabidopsis UGDs based on the enzyme activity measurements with different potential substrates, which clearly indicate UDP-Glc as the only convertible substrate. As the measurement for UDP-Glc dehydrogenase activity in the study of Stewart and Copeland (1998) was based on an increase of NADH in the assay without analysis of the product, it seems possible either that the substrate UDP-galactose contained some residual UDP-Glc or that the enzyme preparation was contaminated with residual UDP-glucose-4-epimerase, which could have converted part of the UDP-galactose into UDP-Glc. The recent cloning of the genes encoding UDP-GlcA-4-epimerase (Mølhøj et al., 2004; Usadel et al., 2004), which produces UDP-galacturonic acid as glycosyl donor for pectic polymers, further supports this conclusion. Stewart and Copeland (1998) have purified a UDP-Glc dehydrogenase from soybean nodules, but the presence of isoforms was not considered. To our knowledge, only a single UGD from soybean has been characterized biochemically in more detail (Hinterberg et al., 2002), but evidence for the conversion of UDP-galactose was also not found in this study.

The biochemical data for the UGD isoforms from Arabidopsis showing a graded affinity for UDP-Glc and substrate turnover numbers suggest a role in the regulation of carbon fluxes into nucleotide-sugar pools for cell walls. During most of the life cycle of Arabidopsis, UGD2, 3, and 4 are co-expressed in the same tissues and thus different affinities for UDP-Glc and substrate turnover numbers might limit the use of too much UDP-Glc for cell wall polymers. In contrast, UGD1 has a high affinity for UDP-Glc (Oka and Jigami, 2006) but is expressed at low levels. Seitz et al. (2000) demonstrated a histochemical UGD activity stain in whole seedlings, which shows only a minor UGD activity in the hypocotyl compared with the primary root. In these seedlings, UGD1 is the major expressed isoform (compare Fig. 3). Kinetic constants for UGDs from different organisms vary over a wide range. One of the soybean UGDs, which has previously been characterized, has a high affinity for UDP-Glc (Km ~21 µM; Hinterberg et al. 2002) similar to a UGD from sugarcane (Km ~19 µM; Turner and Botha, 2002), whereas UGDs from maize (Km=380 µM and 950 µM) show much higher Km values (Kärkönen et al. 2005). The Arabidopsis UGDs have an intermediate Km for UDP-Glc, ranging from 123 µM to 335 µM. Oka and Jigami (2006) determined a high affinity Km (15.3 µM) for UDP-Glc for UGD1 from Arabidopsis. The high affinity of UGDs for UDP-Glc is correlated with a strong feedback inhibition by UDP-xylose (~10 µM in soybean; 17 µM in sugarcane) but with much higher Ki values for the Arabidopsis UGD2, 3, and 4 (Ki 80–220 µM) as indicated in Table 2. Interestingly, Oka and Jigami (2006) determined the Ki of UDP-xylose for UGD1 to be 4.9 µM. This particular isoform also has a high affinity for the substrate UDP-Glc (15.3 µM), suggesting a structural modification of the enzyme substrate-binding pocket which increases the affinity for both the substrate UDP-Glc and the inhibitor UDP-Xyl. The kcat values indicate a similar substrate conversion rate by the different isoforms, ranging from 1.17 s–1 for the slowest enzyme UGD4 to 2.52 s–1 for the fastest enzyme UGD3, and intermediate values for UGD2. These turnover rates agree well with data for the UGD from S. pyogenes (kcat=1.8 s–1) (Ge et al., 2004) and the enzyme purified from bovine liver (kcat= 2.92 s–1; calculated on the basis of 50 kDa per subunit) (Zalitis and Feingold, 1969). In contrast, Bar-Peled et al. (2004) reported a much lower value for the UGD from Cryptococcus neoformans (kcat=0.27 s–1). The 2-fold difference in the turnover number between the Arabidopsis isoforms may well be important. UGD3 has the lowest affinity for UDP-Glc but the highest turnover number, indicating that the flux of UDP-sugars into UDP-GlcA by UGD3 is significant under conditions of a non-limited supply of UDP-Glc. Though the exact concentration of UDP-Glc in Arabidopsis leaves is not known and probably depends on environmental conditions as well, it can be assumed to be in the range of 1 mM. Dancer et al. (1990) estimated 3–4 mM UDP-Glc for spinach leaves. Farré et al. (2001) calculated 0.83 mM for the UDP-Glc concentration in potato tubers. The main competitor enzyme of UGDs for the substrate UDP-Glc is SPS, utilizing UDP-Glc for the biosynthesis of sucrose. The Km values of SPSs for UDP-Glc are usually slightly higher than the Km of UGDs reported here (Avigad, 1982). In addition, cellulose is synthesized from UDP-Glc or sucrose cleaved via membrane-bound isoforms of sucrose synthase into UDP-Glc and fructose. For example, cotton antisense plants for sucrose synthase have impaired cellulose trichomes, indicating an essential role for sucrose synthase in providing UDP-Glc for cellulose biosynthesis (Ruan et al., 2003). The same mechanism may also apply to other β-glucan synthases (Buckeridge et al., 1999; Konishi et al., 2004). These findings suggest a supply of UDP-Glc from sucrose for various β-glucan synthases, which is presumably independent of the soluble UDP-Glc pool. Whether UGD uses UDP-Glc from cleaved sucrose to a larger extent is not known. However, strong evidence for this use is lacking, as indicated by the analysis of single and double knockout mutants in sucrose synthase, which show no cell wall mutant phenotypes (Bieniawska et al., 2007). The flux of UDP-Glc into either sucrose or UDP-GlcA (for cell wall hemicelluloses) will therefore depend on several factors including the Km for UDP-Glc of the enzymes, enzyme substrate turnover numbers, amount of enzyme, and post-translational regulation of activity. In a recent paper by Park et al. (2007) the authors report on transgenic tobacco plants overexpressing an SPS gene, which have a reduced amount of arabinose and xylose in their cell wall. This indicates that the flux of UDP-Glc into hemicellulose material via UGD was displaced by favouring sucrose formation. Taking the data from reporter gene expression, real-time PCR, and knockout mutants (R Reboul, M Klinghammer, T Tenhaken, unpublished data), into account, it is concluded that UGD2 and UGD3 are the major contributing enzymes for the flux from UDP-Glc into UDP-GlcA in Arabidopsis.


    Acknowledgements
 
We thank Christoph Klos and Beate Hinterberg for helpful suggestions. This work was supported by a grant from the German Science Foundation (DFG, Bonn, Germany).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Amrein KE, Takacs B, Stieger M, Molnos J, Flint NA, Burn P. Purification and characterization of recombinant human p50csk protein-tyrosine kinase from an Escherichia coli expression system overproducing the bacterial chaperones GroES and GroEL. Proceedings of the National Academy of Sciences, USA (1995) 92:1048–1052.[Abstract/Free Full Text]

Avigad G. Sucrose and other disaccharides. In: Encyclopedia of plant physiology—Loewus FA, Tanner W, eds. (1982) Berlin: Springer-Verlag. 217–347.

Bar-Peled M, Griffith CL, Ory JJ, Doering TL. Biosynthesis of UDP-GlcA, a key metabolite for capsular polysaccharide synthesis in the pathogenic fungus Cryptococcus neoformans. Biochemical Journal (2004) 381:131–136.[CrossRef][Web of Science][Medline]

Bieniawska Z, Paul Barratt DH, Garlick AP, Thole V, Kruger NJ, Martin C, Zrenner R, Smith AM. Analysis of the sucrose synthase gene family in Arabidopsis. The Plant Journal (2007) 49:810–828.[CrossRef][Web of Science][Medline]

Buckeridge MS, Vergara CE, Carpita NC. The mechanism of synthesis of a mixed-linkage (1->3), (1->4)beta-D-glucan in maize. Evidence for multiple sites of glucosyl transfer in the synthase complex. Plant Physiology (1999) 120:1105–1116.[Abstract/Free Full Text]

Burget EG, Verma R, Molhoj M, Reiter WD. The biosynthesis of L-arabinose in plants: molecular cloning and characterization of a Golgi-localized UDP-D-xylose 4-epimerase encoded by the MUR4 gene of Arabidopsis. The Plant Cell (2003) 15:523–531.[Abstract/Free Full Text]

Campbell RE, Mosimann SC, van De Rijn I, Tanner ME, Strynadka NC. The first structure of UDP-glucose dehydrogenase reveals the catalytic residues necessary for the two-fold oxidation. Biochemistry (2000) 39:7012–7023.[CrossRef][Medline]

Chomczynski P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Analytical Biochemistry (1987) 162:156–159.[Web of Science][Medline]

Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant Journal (1998) 16:735–743.[CrossRef][Web of Science][Medline]

Dancer J, Neuhaus HE, Stitt M. Subcellular compartmentation of uridine nucleotides and nucleoside-5'-diphosphate kinase in leaves. Plant Physiology (1990) 92:637–641.[Abstract/Free Full Text]

Farré EM, Tiessen A, Roessner U, Geigenberger P, Trethewey RN, Willmitzer L. Analysis of the compartmentation of glycolytic intermediates, nucleotides, sugars, organic acids, amino acids, and sugar alcohols in potato tubers using a non-aqueous fractionation method. Plant Physiology (2001) 127:685–700.[Abstract/Free Full Text]

Gahan PB, McGarry A, Wang L, Doré T, Carmignac DF. Glucose-6-phosphate and UDP-D-glucose dehydrogenases: possible markers of vascular differentiation. Phytochemical Analysis (1997) 8:110–114.[CrossRef][Web of Science]

Ge X, Penney LC, van de Rijn I, Tanner ME. Active site residues and mechanism of UDP-glucose dehydrogenase. European Journal of Biochemistry (2004) 271:14–22.[Web of Science][Medline]

Gibeaut DM. Nucleotide sugars and glycosyltransferases for synthesis of cell wall matrix polysaccharides. Plant Physiology and Biochemistry (2000) 38:69–80.[CrossRef][Web of Science]

Hinterberg B, Klos C, Tenhaken R. Functional characterization of recombinant UDP-glucose dehydrogenase from soybean. Plant Physiology and Biochemistry (2002) 40:1011–1017.[CrossRef][Web of Science]

Jefferson RA. Assaying chimeric genes in plants: the GUS gene fusion system. Plant Molecular Biology Reports (1987) 5:387–405.

Johansson H, Sterky F, Amini B, Lundeberg J, Klexzkowsli LA. Molecular cloning and characterization of a cDNA encoding poplar UDP-glucose dehydrogenase, a key gene of hemicellulose/pectin formation. Biochimica et Biophysica Acta (2002) 1576:53–58.[Medline]

Kanter U, Usadel B, Guerineau F, Li Y, Pauly M, Tenhaken R. The inositol oxygenase gene family of Arabidopsis is involved in the biosynthesis of nucleotide sugar precursors for cell-wall matrix polysaccharides. Planta (2005) 221:243–254.[CrossRef][Web of Science][Medline]

Kärkönen A, Murigneux A, Martinant JP, Pepey E, Tatout C, Dudley BJ, Fry SC. UDP-glucose dehydrogenases of maize: a role in cell wall pentose biosynthesis. Biochemical Journal (2005) 391:409–415.[CrossRef][Web of Science][Medline]

Karsai A, Muller S, Platz S, Hauser MT. Evaluation of a home-made SYBR green I reaction mixture for real-time PCR quantification of gene expression. Biotechniques (2002) 32:790–796.[Web of Science][Medline]

Kobayashi M, Nakagawa H, Suda I, Miyagawa I, Matoh T. Purification and cDNA cloning of UDP-D-glucuronate carboxy-lyase (UDP-D-xylose synthase) from pea seedlings. Plant and Cell Physiology (2002) 43:1259–1265.[Abstract/Free Full Text]

Konishi T, Ohmiya Y, Hayashi T. Evidence that sucrose loaded into the phloem of a poplar leaf is used directly by sucrose synthase associated with various beta-glucan synthases in the stem. Plant Physiology (2004) 134:1146–1152.[Abstract/Free Full Text]

Loewus FA, Kelly S, Neufeld EF. Metabolism of myo-inositol in plants: conversion to pectin, hemicellulose, D-xylose and sugar acids. Proceedings of the National Academy of Sciences, USA (1962) 48:421–425.[Free Full Text]

Mijakovic I, Petranovic D, Deutscher J. How tyrosine phosphorylation affects the UDP-glucose dehydrogenase activity of Bacillus subtilis YwqF. Journal of Molecular Microbiology and Biotechnology (2004) 8:19–25.[CrossRef][Web of Science][Medline]

Mijakovic I, Poncet S, Boel G, et al. Transmembrane modulator-dependent bacterial tyrosine kinase activates UDP-glucose dehydrogenases. EMBO Journal (2003) 22:4709–4718.[CrossRef][Web of Science][Medline]

Mølhøj M, Verma R, Reiter WD. The biosynthesis of D-galacturonate in plants. Functional cloning and characterization of a membrane-anchored UDP-D-glucuronate-4-epimerase from Arabidopsis. Plant Physiology (2004) 135:1221–1230.[Abstract/Free Full Text]

Neufeld EF, Hall CW. Inhibition of UDP-D-glucose dehydrogenase by UDP-D-xylose: a possible regulatory mechanism. Biochemical and Biophysical Research Communications (1965) 19:456–461.[CrossRef][Web of Science][Medline]

Oka T, Jigami Y. Reconstruction of de novo pathway for synthesis of UDP-glucuronic acid and UDP-xylose from intrinsic UDP-glucose in Saccharomyces cerevisiae. FEBS Journal (2006) 273:2645–2657.[CrossRef][Web of Science][Medline]

Park JY, Canam T, Kang KY, Ellis DD, Mansfield SD. Over-expression of an Arabidopsis synthase (SPS) gene alters plant growth and fibre development. Transgenic Research (2007) (in press) DOI 10.1007/s11248-007-9090-2.

Reiter W, Vanzin GF. Molecular genetics of nucleotide sugar interconversion pathways in plants. Plant Molecular Biology (2001) 47:95–113.[CrossRef][Web of Science][Medline]

Roychoudhury S, May TB, Gill JF, Singh SK, Feingold DS, Chakrabarty AM. Purification and characterization of guanosine diphospho-D-mannose dehydrogenase. A key enzyme in the biosynthesis of alginate by Pseudomonas aeruginosa. Journal of Biological Chemistry (1989) 264:9380–9385.[Abstract/Free Full Text]

Ruan YL, Llewellyn DJ, Furbank RT. Suppression of sucrose synthase gene expression represses cotton fiber cell initiation, elongation, and seed development. The Plant Cell (2003) 15:952–964.[Abstract/Free Full Text]

Seifert GJ. Nuceleotide sugar interconversions and cell wall biosynthesis: how to bring the inside to the outside. Current Opinion in Plant Biology (2004) 7:277–284.[CrossRef][Web of Science][Medline]

Seitz B, Klos C, Wurm M, Tenhaken R. Matrix polysaccharide precursors in Arabidopsis cell walls are synthesised by alternative pathways with organ specific expression patterns. The Plant Journal (2000) 21:537–546.[CrossRef][Web of Science][Medline]

Stewart DC, Copeland L. Uridine-5'-diphosphate dehydrogenase from soybean nodules. Plant Physiology (1998) 116:349–355.[Abstract/Free Full Text]

Tenhaken R, Thulke O. Cloning of an enzyme that synthesizes a key nucleotide sugar precursor of hemicellulose biosynthesis from soybean: UDP-glucose dehydrogenase. Plant Physiology (1996) 112:1127–1134.[Abstract]

Turner W, Botha FC. Purification and kinetic properties of UDP-glucose dehydrogenase from sugarcane. Archives of Biochemistry and Biophysics (2002) 407:209–216.[CrossRef][Web of Science][Medline]

Usadel B, Schluter U, Mølhøj M, Gipmans M, Verma R, Kossmann J, Reiter WD, Pauly M. Identification and characterization of a UDP-D-glucuronate 4-epimerase in Arabidopsis. FEBS Letters (2004) 569:327–331.[CrossRef][Web of Science][Medline]

Winter H, Huber SC. Regulation of sucrose metabolism in higher plants: localization and regulation of activity of key enzymes. Critical Reviews in Biochemistry and Molecular Biology (2000) 35:253–289.[Web of Science][Medline]

Zablackis E, Huang J, Muller B, Darvill AG, Albersheim P. Characterization of the cell-wall polysaccharides of Arabidopsis thaliana leaves. Plant Physiology (1995) 107:1129–1138.[Abstract]

Zalitis J, Feingold DS. Purification and properties of UDPG dehydrogenase from beef liver. Archives of Biochemistry and Biophysics (1969) 132:457–465.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Klinghammer, M.
Right arrow Articles by Tenhaken, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klinghammer, M.
Right arrow Articles by Tenhaken, R.
Agricola
Right arrow Articles by Klinghammer, M.
Right arrow Articles by Tenhaken, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?