Skip Navigation

Journal of Experimental Botany 2007 58(13):3743-3748; doi:10.1093/jxb/erm224
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wang, A.
Right arrow Articles by Harada, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, A.
Right arrow Articles by Harada, T.
Agricola
Right arrow Articles by Wang, A.
Right arrow Articles by Harada, T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2007]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

RESEARCH PAPER

MdERFs, two ethylene-response factors involved in apple fruit ripening

Aide Wang1, Dongmei Tan2, Ayako Takahashi1,*, Tian Zhong Li3 and Takeo Harada1 {dagger}

1Laboratory of Plant Breeding and Genetics, Faculty of Agriculture and Life Science, Hirosaki University, Hirosaki 036-8561, Japan
2Department of Agriculture and Engineering, Weifang University, Weifang 261061, China
3College of Agronomy and Bio-tech., China Agricultural University, Beijing 100094, China

{dagger} To whom correspondence should be addressed. E-mail: tharada{at}cc.hirosaki-u.ac.jp

Received 23 June 2007; Revised 9 August 2007 Accepted 28 August 2007


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 References
 
Two MdERFs (ethylene-response factors) were isolated from ripening apple (Malusxdomestica Borkh. cv. Golden Delicious) fruit. The features of their conserved motifs indicated that MdERF1 and MdERF2 belong to group VII and group IX categories in Arabidopsis, respectively. MdERF1 was expressed predominantly in ripening fruit, although a small degree of expression was also observed in non-fruit tissues, whereas MdERF2 was expressed exclusively in ripening fruit. The increased expression in ripening fruit was repressed by treatment with 1-methylcyclopropene (1-MCP: a potent antagonist of ethylene receptors), indicating that transcription is regulated positively by the ethylene signalling system. Indeed, it was a tendency for cultivars with low ethylene production to show lower MdERFs expression than those with high ethylene production. On the basis of concomitant analyses of the expression of some genes related to ripening, the functions of MdERFs and the role of ethylene in the ripening process are discussed.

Key words: Apple fruit, ERF, ethylene, ripening


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 References
 
The involvement of ethylene gas in the ripening of apple fruit is a symbolic phenomenon that has a place in the history of research on plant hormones (Abeles et al., 1992). However, little is still known about the signal transduction mechanism involved. The expression of ripening-related genes (Wakasa et al., 2006), such as cell-wall-modifying enzymes, is induced through transduction of the ethylene signal from receptor(s) to dedicated transcription factors (Giovannoni, 2004). Ethylene-response factor (ERF) proteins, which were known formerly as ethylene-responsive element binding proteins (EREBPs), function as trans-factors at the last step of transduction in the nucleus (Ohme-Takagi and Shinshi, 1995). ERF-type transcription factors are specific to plants and belong to the large AP2/ERF superfamily that possesses the DNA-binding domain. Although Arabidopsis has 122 predicted ERF genes (Nakano et al., 2006), only a few have been characterized so far (Sakuma et al., 2002). In fact, in tomato, only the role of SlERFs in fruit ripening has been reported (Tournier et al., 2003; Pirrello et al., 2006).

The molecular mechanisms involved in fruit ripening have been studied to gain insight into the factors that contribute to differences in flesh softening rate among apple cultivars (Sunako et al., 1999; Harada et al., 2000; Wakasa et al., 2003, 2006; Oraguzie et al., 2004). Although the difference in ethylene production rate observed among apple cultivars can be explained by the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene (MdACS1) ‘allelotype’ or ‘genotype’ (Sunako et al., 1999; Harada et al., 2000), allelic form alone does not explain all the phenotypic variation in fruit softening/storage (Oraguzie et al., 2004). On the other hand, the expression of ripening-related genes is completely inhibited by the ethylene antagonist 1-methylcyclopropene (1-MCP), indicating that ethylene signalling is indispensable for the expression of these genes. In order to examine the role of ethylene transduction in apple ripening further, two ERF genes (MdERFs) isolated from the ripening fruit of ‘Golden Delicious’ apple were characterized, and the features of their expression were compared with those of other ripening-related genes. The results indicated that some factor(s) in addition to ethylene are responsible for regulating the level of MdERFs expression.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 References
 
Plant materials
Samples of the apple (Malusxdomestica Borkh.) cultivar, Golden Delicious, were used in all experimentation, unless otherwise stated. Young leaves, flowers, stamens, and receptacles were obtained from orchard trees at the Aomori Apple Experimental Station. Tissue samples were collected once a week from May to November and prepared as described by Wakasa et al. (2003). Fruit from other cultivars were also used for comparison of the gene expression patterns with that of ‘Golden Delicious’.

Cloning of MdERFs cDNAs
Degenerate oligonucleotides (CCRTGGGGRAAATKKGCGGCK and CATAAGCVAVAKBGCRGCTTCYTC) designed by Tournier et al. (2003) were used in a polymerase chain reaction (PCR) with the cDNA template from ripening fruit. Full-length cDNA clones for MdERFs were isolated by screening using a ‘Golden Delicious’ cDNA library (Sunako et al., 1999).

RNA extraction and northern blot analysis
RNA extraction and gel blot analysis were performed as described by Sunako et al. (1999). The probes for MdERFs were prepared by PCR using the respective clones as a template. The following gene-specific primers were used to amplify their 3'-UTRs: MdERF1F, ATGACCTGGTGGCATATCAG; MdERF1R, CACCGTAGCAAACAACACAC; MdERF2F, TATGCTGGCAATTGGCGAGC; MdERF2R, ATGACCAATCCCGCACTCAC. The RNA gel blot analysis of MdACS1, MdACO1, and MdPG1 was carried out as in Wakasa et al. (2006).

Measurements of ethylene production rates
Intact fruits were enclosed in a gas-tight container (0.8 l) equipped with septa, then 1 ml of gas from the container headspace was sampled via a syringe. The ethylene concentration in the sample was measured with a gas chromatograph (Shimadzu, Kyoto, Japan) equipped with a flame ionization detector.

1-MCP treatment of fruit
The ethylene antagonist 1-MCP was used to suppress ethylene signal transduction. Fruits were treated with 1 p.p.m. of 1-MCP (EthylBloc, Rohm and Haas, Philadelphia, PA, USA) for 15 h at 24 °C. After treatment, the fruits were held at 24 °C for 12 d for comparison of ethylene production with untreated fruit and expression of ripening-related genes every 3 d (Wakasa et al., 2006).

RT-PCR analysis of MdERF2
Total RNA extracted from fruit collected at 22 d or 14 d before harvest, and at harvest, was used for first-strand cDNA synthesis using the MdERF2R primer (5'-ATGACCAATCCCGCACTCAC-3'). Then, PCR amplification was carried out using the gene-specific primer MdERF2F (5'-TATGCTGGCAATTGGCGAGC-3') and MdERF2R as described by Wakasa et al. (2006). The thermal cycling conditions were 3 min at 94 °C; then 25 cycles of 5 s at 94 °C, 15 s at 65 °C, and 20 s at 72 °C. To normalize for differences in total RNA, the concentration of actin (accession number EB136338) mRNA in each sample was determined using the primers 5'-GGCTGGATTTGCTGGTGATG-3' and 5'-TGCTCACTATGCCGTGCTCA-3'.


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 References
 
Molecular characteristics of MdERF1 and MdERF2
Two partial cDNA clones were isolated from apple cDNAs using degenerate primers targeted to the highly conserved ERF domain, and each of the 3’ regions was obtained by 3’ RACE. Then, the 3’ UTRs were used to screen a cDNA library of ripening ‘Golden Delicious’ apple fruit. The predicted coding regions of two positive clones possessed a conserved AP/ERF DNA binding domain and a region rich in basic amino acids (P/L-K-K/P-R-R) that could serve as a putative nuclear localization signal (Raikhel, 1992). Therefore, they were designated MdERF1 (accession number AB288347) and MdERF2 (accession number AB288348), respectively (Fig. 1). Part of their respective sequences was identical to EST sequences from apple fruit (Newcomb et al., 2006). However, there are no descriptions about the partial sequences of MdERF1 and MdERF2 so far. As shown in Fig. 2, Southern hybridization to genomic DNA showed that each probe hybridized to one or two of three restriction enzyme fragment(s), revealing that each respective MdERF is a single gene in the apple genome.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. A schematic representation of the cDNA structures of MdERF1 and MdERF2. Alignments of the AP2/ERF domains between MdERFs and those of the conserved motifs with the corresponding AtERF in Arabidopsis are shown. Boxes indicate the open reading frames, starting from the first ATG codon, and lines show putative untranslated regions. Block boxes indicate the AP/ERF domain; arrows represent putative nuclear localization signals. Numbers above the line indicate positions of amino acid residues; numbers below the line refer to nucleotide positions. AtERF#75 and AtERF#100 are generic names of the Arabidopsis ERF genes (Nakano et al., 2006).

 

Figure 2
View larger version (142K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. DNA gel blot analyses using a specific probe for each MdERF. Ten micrograms of genomic DNA was digested with HindIII (lane 1), EcoRI (lane 2), and DraI (lane 3).

 
MdERF1 and MdERF2 expression in ripening fruit
To clarify the expression pattern of the MdERFs at the transcriptional level, northern hybridizations were performed using different apple plant tissues (Fig. 3). The MdERF1 signal was clearly detected in ripening fruit and also in root and shoot tissues. On the other hand, a very weak signal of the MdERF2 transcript was only observed in fruit tissue. The expression level of both MdERFs was then analysed during fruit ontogeny. As shown in Fig. 4, MdERF1 was expressed weakly in young fruit in May and continued to be expressed throughout development, and then the level increased at the ripening stage. In the case of MdERF2, a detectable transcript was obtained only in the ripening fruit from the end of October. To confirm the exclusive expression of MdERF2 at the ripening stage, RT-PCR was performed (Fig. 5). This indicated that the transcript was present at 14 d before commercial maturity (day 0), but was not evident at 22 d before harvest.


Figure 3
View larger version (45K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3. RNA gel blot analysis of MdERF1 and MdERF2 in ripening fruit and non-fruit tissues. Each lane was loaded with total RNA from fruit (F), young leaves (L), shoots (Sh), root (R), stigmata (St), and receptacles (Re). rRNA is shown as loading control.

 

Figure 4
View larger version (34K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4. Changes in MdERF1 and MdERF2 expression during fruit ontogeny. Apple fruit of ‘Golden Delicious’ were sampled weekly from May to November.

 

Figure 5
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5. RT-PCR analysis of MdERF2 transcript accumulation during ripening. The MdAct gene was used as an internal reference. Times are means day(s) before/after harvest.

 
Repression of MdERF1 and MdERF2 expression by 1-MCP
To understand the role of ethylene in MdERFs expression during ripening, the fruit was treated at commercial maturity with 1-MCP, an ethylene antagonist. The treated fruit showed a marked reduction of the MdERF1 transcript (Fig. 6) and complete disappearance of the MdERF2 signal, indicating that their expression was regulated by ethylene. However, MdERF1 expression in the treated fruit appeared to increase gradually during ripening, as was the case in the control fruit.


Figure 6
View larger version (46K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 6. Changes in the accumulation of MdERF1 and MdERF2 mRNA in ‘Golden Delicious’ apple fruit with or without 1-MCP treatment. Ribosomal RNA was used to normalize RNA loading. Numbers above each lane indicate the number of storage days after harvest at 24 °C.

 
MdERFs expression level and ethylene production level
To investigate the relationship between the degree of MdERFs expression and the level of ethylene production, fruit of ‘Fuji’, a representative low-ethylene-producing apple cultivar, was compared with that of ‘Golden Delicious’. ‘Fuji’ fruit produced around 0.5 nl g–1 FW h–1 ethylene from one month before harvest, whereas in ‘Golden Delicious’, production increased gradually and reached a plateau at around 70 nl g–1 FW h–1 (Fig. 7). Although MdERF1 and MdERF2 transcripts were detected in ‘Golden Delicious’, no signal of either transcript was observed in fruit of ‘Fuji’. To clarify whether higher ethylene production is correlated with higher MdERFs expression during ripening, harvested fruit of various cultivars that had been stored at room temperature (Wakasa et al., 2006) were used. Figure 8 shows the changes in the rate of ethylene production and expression of MdERF1 and MdERF2 during ripening in 14 apple cultivars. Because ‘Golden Delicious’, ‘Kotaro’, ‘Delicious’, and ‘Kitarou’ don't have the transposon of the MdACS1 allele (Harada et al., 2000), their ethylene production rate rose to around 100 nl g–1 FW h–1, and a clear expression of MdERF1 was observed. However, ‘Hozuri’ and ‘Ralls Janet’ showed a high expression level that did not correspond with the ethylene production level in each. In the case of MdERF2, although clear bands didn't obtain due to weak signals, its transcript was also detected in both ‘Hozuri’ and ‘Ralls Janet’.


Figure 7
View larger version (78K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 7. Changes in the expression of MdERF1, MdERF2, and other ripening-related genes and rate of ethylene production by fruit on a tree. Data obtained from ‘Fuji’ and ‘Golden Delicious’ apple fruit harvested from 3 October to 2 November are shown in order from left to right. Data for different ripening stages (–14, 0, 3, 6, 9, and 12 d after harvest) are shown in order from left to right.

 

Figure 8
View larger version (52K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 8. Changes in the rate of ethylene production and expression of MdERF1 during ripening of 14 apple cultivars. Data for different ripening stages (–14, 0, 3, 6, 9, and 12 d after harvest) are shown in order from left to right.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
References
 
Sequence analysis clearly indicated that the two MdERFs isolated in this study belong to the ERF family of the AP2/ERF superfamily, which is defined by the ERF/AP2 domain (59 amino acids) that is involved in DNA binding. AP2 family proteins contain two repeated AP2/ERF domains, while ERF family proteins like MdERFs contain a single AP2/ERF domain (Riechmann and Meyerowitz, 1998). In Arabidopsis, 122 of the 147 genes identified as possibly encoding AP2/ERF domain(s) have been assigned to the ERF family (Nakano et al., 2006). Furthermore, the ERF family is grouped into two major subfamilies, ERF conserving the 14th alanine (A14) and the 19th aspartic acid (D19) and CBF/DREB in which valine (V14) and glutamic acid (E19) are present at the respective positions (Yang et al., 2002; Sakuma et al., 2002; Tournier et al., 2003; Nakano et al., 2006). The predicted amino acid sequences of both MdERFs show A14 and E19, indicating that they belong to the ERF subfamily. The N-terminal sequence MCGGAII/L and the C-terminal LWS (I/L/Y) of MdERF1 are a characteristic signature of group VII among the 12 ERF groups (Nakano et al., 2006). Tomato SlERF2, possessing these motifs, is expressed not only in ripening fruit but also in germinating seed, and a small amount of its transcript accumulates in all plant tissues (Pirrello et al., 2006). The transcript of MdERF1 was also detected in non-fruit tissue, but showed strongest expression in ripening fruit. On the other hand, MdERF2 had a conservative group IX motif (CMIX-3), which is considered to function as a transcriptional activation domain (Nakano et al., 2006).

In fruit treated with 1-MCP, a low level of the MdERF1 transcript was detected and the level increased slightly during ripening. This does not indicate that the increase was not under the control of ethylene, because 1-MCP was applied only transiently before the start of incubation at 24 °C. As ripening progressed, de novo-synthesized ethylene receptor(s) could have appeared (El-Sharkawy et al., 2003), and this could have resulted in de novo expression of MdERFs. Therefore, MdERF1 expression is considered to be regulated by ethylene.

The most abundant accumulation of the MdERF1 transcript was observed in ‘Golden Delicious’, ‘Kotaro’, and ‘Hozuri’ fruit incubated at 24 °C. At room temperature, fruit of ‘Golden Delicious’ and ‘Kotaro’ produced about 200 nl g–1 FW h–1 ethylene (Waksasa et al., 2006). Therefore, it is likely that the higher the amount of ethylene production, the greater the expression of MdERFs becomes. The apparent lack of MdERF1 transcript in a low-ethylene-producing cultivar like ‘Fuji’ may mean that the level of ethylene (around 0.2 nl g–1 FW h–1) is below the threshold at which MdERFs transcription can be detected by RNA gel blotting. However, clear accumulation of the MdERF1 transcript was also observed in ‘Ralls Janet’, which produces a very low level of ethylene. Therefore, the relationship between MdACS1 genotypes, which accounts for the level of ethylene in ripening fruit (Sunako et al., 1999), and the level of MdERFs expression was not stringent. These results indicate that the ethylene cascade is not an exclusive regulator of MdERFs expression. As shown in Fig. 9, another transcription factor(s) derived from the maturation cascade also appears to function as a regulator of gene expression.


Figure 9
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 9. A model for signal transduction of ripening-related genes. Expression of MdERFs is regulated by at least two factors from the ethylene and maturation cascades. Furthermore, the activity of MdERFs as a transcription factor is also modulated by other regulatory factor(s).

 
Arabidopsis ethylene-responsive element binding protein (AtEBP), which belongs to group VII, interacts with a bZIP transcription factor to activate the expression of plant defence genes (Buttner and Singh, 1997). OsEBP89 of rice, belonging to group VII, also interacts with a Myc transcription factor to regulate expression of the Wx gene (Zhu et al., 2003). Furthermore, Pti4 of tomato, classified into group IX, is phosphorylated by a kinase, thus enhancing its binding to the target DNA (Gu et al., 2000). Therefore, although the expression of MdERFs increased almost concomitantly with those of MdACO1 and MdPG1 in ripening fruit, MdERFs would be necessary to activate the expression of these ripening-related genes through some additional regulatory mechanism involving another regulatory protein.

It is concluded that although ethylene signalling is indispensable for MdEFRs expression, other factor(s) derived from an ethylene-independent cascade is necessary not only for initiating the expression of MdERFs but also as a transcription factor in ripening fruit.


   Acknowledgements
 
We thank the Aomori Apple Experimental Station for providing the plant materials used in this study. This work was supported by a Grant-in-Aid for Scientific Research in Japan.


   Footnotes
 
* Present address: Kuji Agricultural Information Center, Kuji 028-8042, Japan. Back


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Abeles FB, Morgan PW, Saltveit ME. Ethylene in plant biology (1992) 2nd edn. San Diego: Academic Press.

Büttner M, Singh KB. Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein, interacts with an ocs element binding protein. Proceedings of the National Academy of Sciences, USA (1997) 94:5961–5966.[Abstract/Free Full Text]

El-Sharkawy I, Jones B, Li ZG, Lelièvre JM, Pech JC, Latché A. Isolation and characterization of four ethylene perception elements and their expression during ripening in pears (Pyrus communis L.) with/without cold requirement. Journal of Experimental Botany (2003) 54:1615–1625.[Abstract/Free Full Text]

Giovannoni JJ. Genetic regulation of fruit development and ripening. The Plant Cell (2004) 16:170–180.[CrossRef]

Gu YQ, Yang C, Thara VK, Zhou J, Martin GB. Pti4 is induced by ethylene and salicylic acid, and its product is phosphorylated by the Pto kinase. The Plant Cell (2000) 12:771–786.[Abstract/Free Full Text]

Harada T, Sunako T, Wakasa Y, Soejima J, Satoh T, Niizeki M. An allele of 1-aminocyclopropane-1-carboxylate synthase gene (Md-ACS1) accounts for the low ethylene production in climacteric fruits of some apple cultivars. Theoretical and Applied Genetics (2000) 101:742–746.[CrossRef][Web of Science]

Nakano T, Suzuki K, Fujimura T, Shinshi H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiology (2006) 140:411–432.[Abstract/Free Full Text]

Newcomb RD, Crowhurst RS, Gleave AP, et al. Analyses of expressed sequence tags from apple. Plant Physiology (2006) 141:147–166.[Abstract/Free Full Text]

Ohme-Takagi M, Shinshi H. Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. The Plant Cell (1995) 7:173–182.[Abstract]

Oraguzie NC, Iwanami H, Soejima J, Harada T, Hall A. Inheritance of Md-ACS1 gene and its relationship to fruit softening in apple (Malus domestica Borkh. Theoretical and Applied Genetics (2004) 108:1526–1533.[CrossRef][Web of Science][Medline]

Pirrello J, Jaimes-Miranda F, Sanchez-Ballesta MT, Tournier B, Khalil-Ahmad Q, Regad F, Latché A, Pech JC, Bouzayen M. Sl-ERF2, a tomato ethylene response factor involed in ethylene response and seed germination. Plant and Cell Physiology (2006) 47:1195–1205.[Abstract/Free Full Text]

Raikhel N. Nuclear targeting in plants. Plant Physiology (1992) 100:1627–1632.[Free Full Text]

Riechmann JL, Meyerowitz EM. The AP2/EREBP family of plant transcrition factors. Biological Chemistry (1998) 379:633–646.[Web of Science][Medline]

Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochemical and Biophysical Research Communications (2002) 290:998–1009.[CrossRef][Web of Science][Medline]

Sunako T, Sakuraba W, Senda M, Akada S, Ishikawa R, Niizeki M, Harada T. An allele of the ripening-specific 1-aminocyclopropane-1-carboxylate synthase gene (ACS1) in apple fruit with a long storage life. Plant Physiology (1999) 119:1297–1303.[Abstract/Free Full Text]

Tournier B, Sanchez-Ballesta MT, Jones B, Pesquet E, Regad F, Latché A, Pech JC, Bouzayen M. New members of the tomato ERF family show specific expression pattern and diverse DNA-binding capacity to the GCC box element. FEBS Letters (2003) 550:149–154.[CrossRef][Web of Science][Medline]

Wakasa Y, Hatsuyama Y, Takahashi A, Sato T, Niizeki M, Harada T. Divergent expression of six expansin genes during apple fruit ontogeny. European Journal of Horticultural Science (2003) 68:253–259.[Web of Science]

Wakasa Y, Kudo H, Ishikawa R, Akada S, Senda M, Niizeki M, Harada T. Low expression of an endopolygalacturonase gene in apple fruit with long-term storage potential. Postharvest Biology and Technology (2006) 39:193–198.[CrossRef][Web of Science]

Yang HJ, Shen H, Chen L, Xing YY, Wang ZY, Zhang JL, Hong MM. The OsEBP-89 gene of rice encodes a putative EREBP transcription factor and is temporally expressed in developing endosperm and intercalary meristem. Plant Molecular Biology (2002) 50:379–391.[CrossRef][Web of Science][Medline]

Zhu Y, Cai XL, Wang ZY, Hong MM. An interaction between a MYC protein and an EREBP protein is involved in transcriptional regulation of the rice Wx gene. The Journal of Biological Chemistry (2003) 278:47803–47811.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J Exp BotHome page
I. El-Sharkawy, S. Sherif, I. Mila, M. Bouzayen, and S. Jayasankar
Molecular characterization of seven genes encoding ethylene-responsive transcriptional factors during plum fruit development and ripening
J. Exp. Bot., March 1, 2009; 60(3): 907 - 922.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wang, A.
Right arrow Articles by Harada, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, A.
Right arrow Articles by Harada, T.
Agricola
Right arrow Articles by Wang, A.
Right arrow Articles by Harada, T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?