Skip Navigation

Journal of Experimental Botany 2007 58(15-16):4225-4233; doi:10.1093/jxb/erm279
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kriechbaumer, V.
Right arrow Articles by Glawischnig, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kriechbaumer, V.
Right arrow Articles by Glawischnig, E.
Agricola
Right arrow Articles by Kriechbaumer, V.
Right arrow Articles by Glawischnig, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2007 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. This paper is available online free of all access charges (see
http://jxb.oxfordjournals.org/open_access.html for further details)


RESEARCH PAPER

Maize nitrilases have a dual role in auxin homeostasis and β-cyanoalanine hydrolysis

Verena Kriechbaumer1, Woong June Park1 *, Markus Piotrowski2, Robert B. Meeley3, Alfons Gierl1 and Erich Glawischnig1,{dagger}

1Lehrstuhl für Genetik, Technische Universität München, Am Hochanger 8, D-85350 Freising, Germany
2Lehrstuhl für Pflanzenphysiologie, Ruhr-Universität, Universitätsstrasse 150, D-44801 Bochum, Germany
3Pioneer Hi-Bred International, 7300 NW 62nd Avenue, Johnston, IA 50131-1004, USA

{dagger} To whom correspondence should be addressed. E-mail: egl{at}wzw.tum.de

Received 18 September 2007; Revised 16 October 2007 Accepted 17 October 2007


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
The auxin indole-3-acetic acid (IAA), which is essential for plant growth and development, is suggested to be synthesized via several redundant pathways. In maize (Zea mays), the nitrilase ZmNIT2 is expressed in auxin-synthesizing tissues and efficiently hydrolyses indole-3-acetonitrile to IAA. Zmnit2 transposon insertion mutants were compromised in root growth in young seedlings and sensitivity to indole-3-acetonitrile, and accumulated lower quantities of IAA conjugates in kernels and root tips, suggesting a substantial contribution of ZmNIT2 to total IAA biosynthesis in maize. An additional enzymatic function, turnover of β-cyanoalanine, is acquired when ZmNIT2 forms heteromers with the homologue ZmNIT1. In plants carrying an insertion mutation in either nitrilase gene this activity was strongly reduced. A dual role for ZmNIT2 in auxin biosynthesis and in cyanide detoxification as a heteromer with ZmNIT1 is therefore proposed.

Key words: Auxin, cyanoalanine, IAA, IAN, maize, nitrilase


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
The auxin indole-3-acetic acid (IAA) is essential for numerous physiological and developmental processes in plants. While significant progress was made recently in understanding factors controlling auxin action, particularly IAA signalling (Dharmasiri et al., 2005; Kepinski and Leyser, 2005), the IAA biosynthetic pathways still remain to be resolved. Several pathways leading from tryptophan to IAA have been suggested after incorporation experiments with specific precursors and the identification of enzymatic steps in vitro (Ljung et al., 2002). Multiple mutants of the YUCCA gene family of Arabidopsis thaliana (Zhao et al., 2001), for which homologues have also been characterized in rice (Yamamoto et al., 2007), display an auxin-deficient phenotype. This phenotype is complemented by expression of the bacterial tryptophan monooxygenase IaaM (Cheng et al., 2006). Alternative pathways via the intermediates indole-3-acetaldoxime (IAOx) and indole-3-acetonitrile (IAN) have been mainly investigated in A. thaliana, a cruciferous plant that synthesizes indole glucosinolates from IAOx (Hull et al., 2000; Mikkelsen et al., 2000; Zhao et al., 2002) and the indolic phytoalexin camalexin via IAOx and IAN (Glawischnig et al., 2004; Nafisi et al., 2007). As these defence compounds are major sinks for tryptophan in Arabidopsis, putative joint precursor pools of IAA and indole glucosinolates complicate the analysis of IAA biosynthesis in Arabidopsis. The nitrilases AtNIT1, AtNIT2, and AtNIT3 were shown to hydrolyse IAN to IAA (Schmidt et al., 1996; Normanly et al., 1997; Grsic-Rausch et al., 2000; Kutz et al., 2002). However, their substrate specificities (Vorwerk et al., 2001) also indicate an alternative function, such as in glucosinolate degradation. A more distantly related Arabidopsis nitrilase, AtNIT4, did not hydrolyse IAN but metabolizes β-cyanoalanine (Piotrowski et al., 2001), an intermediate in cyanide detoxification. This group of β-cyanoalanine hydratases/nitrilases (NIT4 group) has been identified and characterized in different plant families, including the Fabaceae or the Solanaceae (Piotrowski et al., 2001; Piotrowski and Volmer, 2006).

Maize (Zea mays) accumulates comparatively high quantities of tryptophan-derived IAA conjugates in the kernel (Epstein et al., 1980; Glawischnig et al., 2000). IAN was identified as a potential IAA biosynthetic intermediate in seedlings and kernels. Kernel protein extracts also showed IAN hydrolytic activity, which was increasing from the third to the fifth week after pollination (Park et al., 2003), when most IAA conjugates accumulate. As candidate genes for the conversion of IAN, two genes encoding nitrilases, ZmNIT1 and ZmNIT2, were isolated. While for 18 nitriles tested no specific turnover by ZmNIT1 was observed, ZmNIT2 hydrolyses a number of substrates, including IAN (Park et al., 2003; Mukherjee et al., 2006), and its IAN turnover is one order of magnitude higher in comparison with AtNIT1, AtNIT2, and AtNIT3 (Vorwerk et al., 2001). In summary, these data suggest a role for ZmNIT2 in auxin biosynthesis (Park et al., 2003).

ZmNIT2 bears closer homology to AtNIT4 than to the other three Arabidopsis nitrilases. Nevertheless, β-cyanoalanine is not a substrate for ZmNIT2. Several members of Gramineae were shown to contain two or more genes encoding nitrilases of the NIT4 group. When heterologously expressed, none of these nitrilases, with the exception of ZmNIT2, feature enzymatic activity to known substrates. However, it has recently been shown that the NIT4 homologues of Sorghum bicolor must form heteromeric complexes to gain high activity with β-cyanoalanine (Jenrich et al., 2007). Individual components of these complexes could be substituted by the corresponding NIT4 orthologues of rice and barley, indicating that the NIT4 heterocomplex formation is conserved within the Poaceae.

In this paper, a dual biological function for maize nitrilases is proposed. ZmNIT2 homomers hydrolyse IAN to IAA, and Zmnit2 knockout mutants accumulate lower quantities of IAA conjugates in the kernels and roots of young seedlings, indicating that an IAN-dependent pathway contributes substantially to auxin biosynthesis in these tissues. In addition, ZmNIT1/ZmNIT2 heteromers are involved in cyanide detoxification via β-cyanoalanine turnover.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Isolation of genomic nitrilase clones and transposon-insertion mutants
A 7.5 kb {lambda}-clone, carrying the total ZmNIT2 cDNA sequence, and a 3.0 kb {lambda}-clone, carrying exons 3–5 of ZmNIT1, were isolated from a genomic library of the line CI31A and sequenced. The sequences of the first and second intron of ZmNIT1 were determined after PCR amplification (Hi Fidelity, Roche). The genomic sequences were deposited in GenBank: EF396163, ZmNIT1g; EF396164, ZmNIT2g. No additional non-allelic nitrilase sequences have been identified in the maize genome. The TUSC population of Mu-insertion lines was screened for disruption of the maize nitrilase genes (Mena et al., 1996). Candidates identified by PCR were re-screened by Southern analysis, and sequencing of the PCR products confirmed a Zmnit1::Mu and a Zmnit2::Mu line, each being disrupted within the fourth exon, at bp 739 and bp 742, respectively, of the open reading frame.

The following PCR primers were used for routine determination of the genotype (Mu2: AGAGAAGCCAACGCCAWGGCCTCYATTTCG; mutant alleles detected in PCR with the respective forward primers)

ZmNIT1mf: TCCGATTGGAAAAATGGGTGCTC

ZmNIT1mr: ACCTCAGGTCGCGAGTAGTG

ZmNIT2mf: TCAGGTCGAGAATAGTGGCCC

ZmNIT2mr: TGGAGGGGGGATGCTTTGTC

Plant material and growth conditions
Kernels of the wild-type maize B73 and lines carrying insertions of the transposon Mu were allowed to germinate in a beaker in rolls of wet filter paper (603/N, 75 g m–2; Sartorius) at 28 °C in the dark or, for determination of auxin phenotypes, in a growth chamber (16 h light per day, 100 µmol m–2 s–1; Heraeus HPS 2000). To determine the effect of IAN on root growth, IAN was added to the germination solution. Coleoptile curvature was analysed by applying IAN or IAA formulated in a lanoline paste (Haga and Iino, 1998). Adult phenotypes were monitored on greenhouse-grown plants with controlled watering.

Prior to quantitative analysis of the mutant phenotype, homozygous knockout mutants were selfed and backcrossed three times with the inbred line B73. For phenotype analysis of the nitrilase double mutation, backcrossed homozygous single mutants were crossed and the progeny selfed. Individuals homozygous for mutation in one nitrilase gene and heterozygous for insertion in the other were again selfed and their progeny were analysed.

Auxin concentration of insertion mutants
To determine the IAA concentrations in kernels segregating for Mu insertions in ZmNIT1 or ZmNIT2, kernels were allowed to germinate until the primary root emerged. While this emerging root was used to isolate genomic DNA for determination of the genotype by PCR, the kernels were ground in liquid nitrogen for IAA extraction. IAA concentrations in seedlings were determined after dissecting the terminal and second centimetre of roots, as well as coleoptiles from 3-d-old seedlings. The rest of the plant was used for DNA extraction. For IAA determination the tissues were ground in liquid nitrogen and the resulting powder was extracted twice for 2 h in acetone/water (7:3) at 4 °C, the acetone was removed by reduced pressure, and 50% of each extract was used to determine free and total IAA, respectively. Free IAA was isolated from the solutions by acidification with formic acid to pH 3 and two extractions with 1 vol. of EtOAc. To isolate ester-linked plus free IAA, the solution was hydrolysed in 1 M NaOH for 16 h at 75 °C and acidified to pH 3 with HCl prior to EtOAc extraction. As the amount of amide-linked IAA is very minor in maize (Jensen and Bandurski, 1994), for simplicity, this preparation is termed ‘total IAA’. IAA was quantified by HPLC analysis as described in Park et al. (2003) with additional fluorescence detection (Shimadzu F-10AXL; excitation 285 nm, emission 360 nm).

β-Cyanoalanine turnover by insertion mutants
β-Cyanoalanine conversion in wild type and Zmnit1 and Zmnit2 mutants was analysed in extracts (50 mM KPi, pH 8, 2 mM DTT) from kernels and in 4-d-old seedlings. Seedling protein was enriched by (NH4)2SO4 precipitation (40%). Desalted enzyme preparation (NAP column) was incubated for 4 h at 37 °C with 2.5 mM β-cyanoalanine. The reaction mixture was assayed by TLC with EtOH/H2O/NH4OH (28:9:3; v/v/v) as eluent and ninhydrin detection: Rf (β-cyanoalanine)=0.62, Rf (aspartate)=0.24, and Rf (asparagine)=0.43. For determination of enzymatic activity the reaction mixture was derivatized with o-phthaldialdehyde, and aspartate and asparagine were quantified after HPLC analysis, essentially following the method of Hill et al. (1979), with the modification that the derivatization was buffered in 50 mM Na-carbonate buffer, pH 10.5 containing 0.1% β-mercaptoethanol.

Determination of protein expression
B73 wild-type kernels were germinated in the dark for 3 d and then incubated in 100 µM solutions of different supplements, transferred to an illuminated (100 µmol m–2 s–1) growth chamber, or wounded by pressing with forceps. After 24 h, total nitrilase protein in the root tissue was determined by western analysis (Park et al., 2003).

Heterologous expression and characterization of enzymatic activities
ZmNIT2 was heterologously expressed under ampicilin selection as described (Park et al., 2003). ZmNIT1 was expressed in pET28a under kanamycin selection. Both enzymes were purified under native conditions by His-tag affinity purification via Ni-NTA agarose (Qiagen). For heteromerization, the purified nitrilase proteins were mixed in a 1:1 ratio. Alternatively, to confirm enzymatic activity of the heteromer, both plasmids were co-expressed and the His-tagged proteins were purified from bacteria selected on both ampicillin and kanamycin. Size estimation of nitrilase multimers was performed by size exclusion chromatography with a HiLoadTM16/60 SuperdexTM200 prep grade column (Amersham) and 100 mM TRIS–HCl, pH 8.0/100 mM KCl as eluent. Nitrilase activity was determined as described (Bolleter et al., 1961; Park et al., 2003). kcat determinations were based on the molecular weight of monomers for homomers and a ZmNIT1/ZmNIT2 dimer for heteromers.

Directed yeast-two-hybrid
Physical interaction of ZmNIT1 and ZmNIT2 was confirmed by directed yeast two-hybrid analysis (Fields and Song, 1989) according to the supplier's manual (Stratagene). The ZmNIT1 coding sequence was cloned into pAD-GAL4-2.1 (ZmNIT1-pAD) and the ZmNIT2 coding sequence into pBD-GAL4 Cam (ZmNIT2-pBD). The yeast strain YRG-2 was transformed with ZmNIT2-pBD and, after selection on tryptophan-deficient medium, retransformed with ZmNIT1-pAD. Yeast clones carrying both plasmids were selected on minimal medium (–Trp, –Leu, –His). The presence of both plasmids was confirmed after DNA isolation (Hoffman and Winston, 1987) and retransformation into Escherichia coli XL1 blue. Interaction of ZmNIT1 and ZmNIT2 was monitored by β-galactosidase activity.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
ZmNIT1/ZmNIT2 heteromers catalyse the hydrolysis of IAN and β-cyanoalanine
Two nitrilase genes, ZmNIT1 and ZmNIT2, are encoded in the maize genome and are both expressed in developing kernels and seedlings (Park et al., 2003). The nitrilase ZmNIT2 was shown to catalyse the hydrolysis of a number of nitriles to the corresponding acids. The auxin precursor indole-3-acetonitrile (IAN) is a preferred substrate of ZmNIT2 that shows a 64–500 times higher catalytic efficiency towards IAN when compared with AtNIT1, AtNIT2, or AtNIT3. By contrast, ZmNIT1 only hydrolysed β-cyanoalanine with a low turnover rate (~0.001 s–1; Table 1) and no other activity was demonstrated (Park et al., 2003).


View this table:
[in this window]
[in a new window]

 
Table 1. Nitrilase activities of ZmNIT1, ZmNIT2, and ZmNIT1/ZmNIT2 heteromers with IAN or β-cyanoalanine as a substrate

 
Multimerization is a known feature of nitrilases (O'Reilly and Turner, 2003). Accordingly, purified recombinant ZmNIT2 subjected to size exclusion chromatography eluted with the void volume, showing that high-molecular-weight multimers are formed (data not shown). Similarly, large complexes were obtained with 1:1 mixtures of purified ZmNIT1 and ZmNIT2. These presumed heteromers acquired a new enzymatic function in addition to the activities of ZmNIT2 homomers. Apart from IAN, β-cyanoalanine was now efficiently hydrolysed. With respect to the ZmNIT1 homomer, a greater than 400-fold increase of the catalytic efficiency for the substrate β-cyanoalanine was observed with a Km value of 0.3 mM (Table 1). Similar results were obtained when the two proteins were co-expressed in E. coli (data not shown).

A directed yeast two-hybrid experiment was performed to confirm the physical interaction of the two proteins. Yeast clones carrying a ZmNIT2–pBD construct were transformed with a ZmNIT1–activation domain fusion. Of ~100 colonies growing on the selection medium, eight were tested for β-galactosidase activity. Six out of these eight clones stained blue and carried both constructs. These experiments provided independent evidence of the physical interaction of ZmNIT1 and ZmNIT2.

Nitrilases are induced by light and the substrates IAN and β-cyanoalanine
Apart from kernel tissues, nitrilase expression was also detected in young roots and coleoptilar tips (Park et al., 2003). Therefore, modulation of nitrilase protein expression was investigated by western analysis in 3-d-old root tips using antibodies that detect both homologous proteins equally. Nitrilase protein concentration was determined 24 h after the treatment (Fig. 1). While wounding and the application of jasmonic acid repressed protein expression, a 2-fold induction by light was observed. Remarkably, the substrates IAN and β-cyanoalanine induced nitrilase protein expression. Gibberellic acid, kinetin, abscisic acid, or epi-brassinolide had no obvious influence on the abundance of nitrilases (data not shown).


Figure 1
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Nitrilase protein expression in 3-d-old primary roots. Induction and repression of nitrilase protein expression was monitored by western analysis for 24 h in darkness after wounding (W), incubation with 100 µM solutions of methyl jasmonate (MeJa), IAN, IAA, β-cyanoalanine (β-Cy), or 1-aminocyclopropan-1-carboxylic acid (ACC), as well as growth in the light (L). (A) Representative western blot. (B) Nitrilase protein concentration as a percentage of control (C) treatment. Three biological replicates were analysed.

 
Isolation of transposon-insertion mutants of ZmNIT1 and ZmNIT2
Genomic clones of the maize nitrilases were isolated and their exon–intron structures were determined (Fig. 2). Both genes contain five exons and conserved exon–intron borders. A striking feature of the ZmNIT2 gene is its large first intron of 4.0 kb, 6.6 times the average and 24 times the median intron size in maize (Haberer et al., 2005).


Figure 2
View larger version (8K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Gene structure of ZmNIT1 and ZmNIT2. The exon–intron structure of ZmNIT1 and ZmNIT2 is shown. The transposon insertion sites in the Zmnit1::Mu and Zmnit2::Mu alleles within the fourth exon are indicated with an inverted triangle.

 
To address the function of maize nitrilases in vivo, a population of plants carrying the transposon Mu was screened for insertions in the maize nitrilase genes. Initial candidates were identified by PCR (Mena et al., 1996). One line for each gene, designated as Zmnit1::Mu and Zmnit2::Mu, carried a transposon insertion in the fourth exon. The insertions were confirmed by sequencing of the PCR products and Southern analysis. Homozygous knockout mutants were identified and backcrossed three times with the wild-type line B73 to minimize the transposon background.

Zmnit2 mutants are less sensitive to IAN
B73 wild-type kernels were germinated in the presence of IAN to test whether IAN exhibits auxin activity in maize seedlings and can therefore be considered as an IAA precursor. Root and coleoptile lengths were determined after 5 d. The application of 1 µM IAN resulted in a significant reduction in root length. This inhibition of root growth increased with higher IAN concentrations (Fig. 3A). By contrast, supplementation of IAN in concentrations up to 1 mM had no effect on coleoptile length. When 1 mM IAA, formulated in lanoline, was applied to coleoptiles a strong curvature was observed within 15 min (Fig. 3B). No effect was observed when IAN was applied in an identical way. In summary, external application of IAN resulted in auxin effects in roots but not in coleoptiles.


Figure 3
View larger version (60K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Auxin effect of exogenously applied IAN. (A) Root (black columns) and shoot (grey columns) length of maize B73 seedlings germinated for 5 d in the presence of various concentrations of IAN (C=water control; n=20). (B) Coleoptile curvature test. Representative coleoptiles are depicted 15 min after application of 1 mM IAN or IAA.

 
To investigate whether ZmNIT2 is responsible for converting the IAA precursor IAN to IAA in vivo, sensitivity of root growth to IAN was compared between wild-type and Zmnit2::Mu seedlings. While application of 10 µM IAN to wild-type seedlings resulted in an ~25% reduction in root growth, no effect on Zmnit2::Mu plants was observed. IAN at 100 µM inhibited root growth in the mutant but significantly less in comparison with wild-type seedlings (Fig. 4A, B). Mutation of ZmNIT1 did not significantly influence the auxin effect of IAN (Fig. 4A).


Figure 4
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. Reduced IAN sensitivity and root growth in Zmnit2 knockout mutant seedlings. (A) Representative 3-d-old seedlings of wild type (1, 2), Zmnit1 knockout (3, 4), and Zmnit2 knockout (5, 6) grown in the absence (1, 3, 5) or presence of 100 µM IAN (2, 4, 6). (B) Primary root length of a population segregating for Zmnit2::Mu grown for 4 d in varying concentrations of IAN. After incubation with 10 µM IAN, an auxin effect was observed in wild-type (n=11), but not in mutant seedlings (n=10). (C) Time course of primary root length in a population segregating for Zmnit2::Mu. Numbers indicate the average root length of mutant seedlings (n=8) relative to root length of wild-type seedlings (n=7) of the same age.

 
Morphological phenotype of nitrilase mutants: Zmnit2 knockout mutants are inhibited in root growth
A segregating Zmnit2::Mu population was analysed for root length 48, 60, and 96 h after imbibition (Fig. 4C). Zmnit2 mutants had significantly shorter primary roots. The effect was most dramatic 2 d after imbibition, demonstrating that ZmNIT2 is important for germination and/or root growth in the first 2 d after germination. No segregation of a root length phenotype along with the Zmnit1 mutation was observed (data not shown).

Populations of adult plants segregating for Zmnit1::Mu and Zmnit2::Mu were analysed for plant height, stem thickness, number of leaves, leaf diameter, and number of cobs per plant. No significant segregation of a phenotype with mutation in one of the nitrilase genes was observed (Fig. S1 in Supplementary data available at JXB online).

ZmNIT2 contributes to total IAA biosynthesis in maize kernels and young roots
Zmnit2 mutants displayed a root phenotype in germinating seedlings. Therefore, kernels, right at the onset of germination, as well as primary roots and coleoptiles of 3-d-old seedlings were analysed for free and total IAA content. In seedlings segregating for Zmnit1::Mu and Zmnit2::Mu, free IAA concentration was not affected (Fig. 5A). The total IAA quantity was not influenced by Zmnit1 mutation in seedlings (Fig. 5B) and kernels (Fig. 5C). By contrast and consistent with the enzymatic function and expression pattern of ZmNIT2, Zmnit2::Mu kernels contained ~35% reduced concentrations of total IAA (Fig. 5D). Total IAA concentration was also analysed in 3-d-old seedlings segregating for the Zmnit2::Mu allele. In homozygous mutants, within the basal first centimetre of the primary root, where ZmNIT2 protein was localized (Park et al., 2003), the amount of total IAA was reduced by ~25% (Fig. 5E). These data demonstrate that ZmNIT2 significantly contributes to the total IAA pool of maize kernels and seedling roots.


Figure 5
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. Metabolic phenotypes of maize nitrilase knockout mutants: evidence for the contribution of ZmNIT2 to IAA biosynthesis. (A) Free IAA content in wild-type (black), Zmnit1::Mu (dark grey), and Zmnit2::Mu (light grey) kernels (n=8). (B) A population segregating for Zmnit1::Mu was analysed for total IAA in kernel tissue. Black columns=wild type (n=9); grey columns=homozygous mutant kernels (n=8). (C) Total IAA in root tips of wild-type (n=8) and Zmnit1 knockout seedlings (n=6). (D) A population segregating for Zmnit2::Mu was analysed for total IAA in kernel tissue. Black columns=wild type (first column; n=8); grey columns=Zmnit2 mutant (second column; n=10) that show 35% reduction in total IAA levels. To clarify a possible additional contribution of ZmNIT1 to the total IAA pool, the effect of the Zmnit2::Mu allele segregating in the Zmnit1::Mu background (third column, Zmnit1::Mu: n=9, fourth column, double mutant: n=7), and the effect of the Zmnit1::Mu allele segregating in the Zmnit2::Mu background (fifth column, Zmnit2::Mu: n=8, sixth column, double mutant: n=7), were analysed. Double mutants (white columns) synthesized total IAA levels similar to Zmnit2 single mutants. * Significantly reduced total IAA content in Zmnit2 mutants in comparison with ZmNIT2 plants. E/F=free IAA (hatched columns) and total IAA (solid columns) in primary root sections. (E) and coleoptiles (F) of seedlings segregating for Zmnit2::Mu. * Zmnit2 mutants (grey columns; n=10) show significantly reduced total IAA contents in the root tip in comparison with wild-type seedlings (black columns: n=8).

 
To investigate whether a Zmnit1 mutation has an additive effect, populations in which (i) Zmnit1::Mu segregates in the Zmnit2::Mu background and (ii) Zmnit2::Mu segregates in the Zmnit1::Mu background were analysed for total IAA concentration in the kernel (Fig. 5D). While these data confirm the role of ZmNIT2 in total IAA biosynthesis, no additional contribution of ZmNIT1 was detected.

ZmNIT1 and ZmNIT2 are both essential for β-cyanoalanine hydrolysis
For the hydrolysis of β-cyanoalanine in vitro, formation of a ZmNIT1/ZmNIT2 heteromer was essential. Therefore, extracts of both Zmnit1::Mu and Zmnit2::Mu kernels and seedlings were analysed for β-cyanoalanine turnover to investigate whether functional expression of both nitrilases is required for the formation of aspartate and asparagine from β-cyanoalanine (Fig. 6). Efficient asparagine formation was observed in extracts from wild-type plants, in particular in extracts from seedlings. This activity was reduced to ~10% when the reaction was performed with protein extracts from Zmnit2::Mu and was absent in reactions preformed with Zmnit1::Mu or the double mutant. This demonstrated that functionality of both genes is required for an efficient β-cyanoalanine turnover.


Figure 6
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. Maize nitrilase knockout mutants are compromised in β-cyanoalanine turnover. (A) HPLC-based quantification of β-cyanoalanine turnover in seedling (S) and kernel (K) extracts; wild type (WT), Zmnit1::Mu (Zmnit1), Zmnit2::Mu (Zmnit2), and Zmnit1 Zmnit2 double mutant (Zmnit1/2). (B) TLC analysis of the β-cyanoalanine turnover in seedling extracts (WT, wild type; Zmnit1, Zmnit1::Mu; Zmnit2, Zmnit2::Mu). Quantitative conversion was observed in wild type; some product formation also in Zmnit2 mutants.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
There are several lines of evidence for the importance of the nitrilase ZmNIT2 in auxin biosynthesis in maize. (i) ZmNIT2 is expressed in tissues with auxin-synthesizing activity (Jensen and Bandurski, 1994), such as kernels and primary root tips, and hydrolyses IAN to IAA in vitro (Park et al., 2003). (ii) Seedlings and kernels contain the intermediate IAN, as well as IAN-hydrolysing activity (Park et al., 2003). (iii) Most remarkably, Zmnit2 knockout mutants accumulate significantly fewer IAA conjugates in kernels and primary root tips (Fig. 5D, E) where nitrilase protein and the substrate IAN are present. The biosynthetic origin of the substrate IAN is not known. In A. thaliana, during camalexin induction IAN is synthesized from tryptophan via two cytochrome P450-dependent steps (Glawischnig et al., 2004; Nafisi et al., 2007). Whether a similar pathway is active in maize remains to be investigated.

The levels of free, active IAA are robustly controlled, reflecting a number of regulatory mechanisms and a high degree of redundancy in IAA biosynthetic enzymes (Ljung et al., 2002; Woodward and Bartel, 2005; Kriechbaumer et al., 2006). Important mechanisms controlling IAA homeostasis are formation and hydrolysis of IAA conjugates that normally exceed the active free IAA. These general features of IAA metabolism explain that, despite a reduction in total IAA, the Zmnit2 mutation did not affect the concentration of free auxin in a macroscopic sense. It is likely that reduced IAA synthesis is counterbalanced by inhibition of conjugate formation from IAA, synthesized by alternative pathways, or enhanced IAA-conjugate hydrolysis.

At the onset of germination, expression of nitrilase protein is high and then rapidly declines (Park et al., 2003). Accordingly, Zmnit2 mutants displayed reduced root growth directly after germination. Low concentrations of IAA stimulate growth of maize roots (Pilet and Saugy, 1987). In particular, cells of the maize seedling root designated as the ‘distal elongation zone’ were shown to be growth stimulated by IAA concentrations in the nanomolar range (Ishikawa and Evans, 1993). Possibly, ZmNIT2 provides these low physiological IAA concentrations after germination, and loss of this function cannot be complemented by enhanced IAA-conjugate hydrolysis in primary root directly after germination. A recovery of root growth in Zmnit2 mutants was recorded after 2 d, consistent with the observed unaffected free IAA concentrations.

By contrast, IAA concentrations in the micromolar range inhibit growth of primary roots (Pilet and Saugy, 1987). External application of the IAA precursor IAN resulted in similar effects in wild-type but not in Zmnit2::Mu seedlings, indicating that this auxin effect of IAN is due to hydrolysis to IAA by ZmNIT2. Despite active expression of ZmNIT2 in this tissue, no effect of applied IAN on coleoptiles was observed. It is possible that, in this tissue, IAN is not efficiently taken up and therefore does not reach the active site of ZmNIT2.

Nitrilase protein expression in roots was induced by the substrates IAN and β-cyanoalanine. By contrast to the transcript levels (Park et al., 2003), induction of protein accumulation by light was also observed. Light is regularly described as antagonist of both auxin and ethylene accumulation (Vandenbussche et al., 2003; Nishimura et al., 2006). Therefore, induction of maize nitrilase by light was unexpected and the role of this regulation remains to be investigated. Nitrilase protein concentration was greatly reduced in response to wounding, possibly following similar mechanisms involved in wound regulation of the Arabidopsis nitrilase AtNIT1. AtNIT1 transcription was repressed in response to wounding (Cheong et al., 2002) and AtNIT1 protein showed fast aggregation in wounded cells (Cuttler and Somerville, 2005). While nitrilases from Arabidopsis and Brassica have been shown to be jasmonate inducible (Grsic et al., 1999; Bennett et al., 2005), in the present study repression of nitrilase protein expression was observed. Jasmonate is a known antagonist of auxin-induced growth (Irving et al., 1999). It may be the case that jasmonate interferes with IAA biosynthesis by repressing nitrilase expression in maize seedling roots.

In other grasses, such as sorghum and rice, no enzymatic activities were detected for homomers of known nitrilases, which are all members of the AtNIT4 group. However, nitrilase heteromers, composed of ZmNIT1 and ZmNIT2 homologues, hydrolysed β-cyanoalanine (Jenrich et al., 2007) which is discussed as an intermediate in cyanide detoxification. Similarly, ZmNIT1 and ZmNIT2 form high-molecular-weight heteromeric complexes with β-cyanoalanine nitrilase activity. The IAN-hydrolysing activity of ZmNIT2 homomers is a specific feature of ZmNIT2 and is not described for other members of the AtNIT4 group. Interestingly, broadening of the substrate spectrum in response to aggregate formation was also observed for a nitrilase from Rhodococcus rhodochrous (Nagasawa et al., 2000). The data observed for maize nitrilases open up the possibility that shifting substrate recognition from IAN to β-cyanoalanine in addition is part of a regulatory mechanism linking IAA biosynthesis and the degradation of cyanide, produced as a by-product of ethylene synthesis. In conclusion, a dual function for ZmNIT2 in both auxin biosynthesis and cyanide detoxification is proposed.


    Supplementary data
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Figure S1. Comparison of wild-type (black bars: n=19), Zmnit1::Mu (dark gray bars: n=17), and Zmnit2::Mu (light gray bars: n=20) mutant plants in A) total plant height 4, 6, and 8 weeks after germination (wag), B) stem thickness and leave diameter of the 5th leave 4 wag and C) the number of leaves 4 wag and cobs at the adult stage.


    Acknowledgements
 
We thank Moritz Gegg, Sabine Merl, and Bastian Weiß for practical assistance, Dr James Eaton-Evans and Dr Ulrich Genschel for critical reading of the manuscript, and Dr Monika Frey for valuable suggestions. This project was supported by the Deutsche Forschungsgemeinschaft (grant numbers GI140-7 and PI424/1) and the Leonhard-Lorenz-Foundation.


    Footnotes
 
* Present address: Department of Molecular Biology, BK21 Graduate Program for RNA Biology, Institute of Nanosensor and Biotechnology, Dankook University, Yongin-si, Gyeonggi-do 448-701, South-Korea. Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Bennett RN, Wenke T, Freudenberg B, Mellon FA, Ludwig-Müller J. The tu8 mutation of Arabidopsis thaliana encoding a heterochromatin protein 1 homolog causes defects in the induction of secondary metabolite biosynthesis. Plant Biology (2005) 7:348–357.[CrossRef][Medline]

Bolleter WT, Bushman CJ, Tidwell PW. Spectrophotometric determination of ammonia as indophenol. Analytical Biochemistry (1961) 33:592–594.

Cheng Y, Dai X, Zhao Y. Auxin biosynthesis by the YUCCA flavin monooxygenases controls the formation of floral organs and vascular tissues in Arabidopsis. Genes and Development (2006) 20:1790–1799.[Abstract/Free Full Text]

Cheong YH, Chang HS, Gupta R, Wang X, Zhu T, Luan S. Transcriptional profiling reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal responses in Arabidopsis. Plant Physiology (2002) 129:661–677.[Abstract/Free Full Text]

Cutler SR, Somerville CR. Imaging plant cell death: GFP-Nit1 aggregation marks an early step of wound and herbicide induced cell death. BMC Plant Biology (2005) 5:4.[CrossRef][Medline]

Dharmasiri N, Dharmasiri S, Estelle M. The F-box protein TIR1 is an auxin receptor. Nature (2005) 435:441–445.[CrossRef][Medline]

Epstein E, Cohen JD, Bandurski RS. Concentration and metabolic turnover of indoles in germinating kernels of Zea mays L. Plant Physiology (1980) 65:415–421.[Abstract/Free Full Text]

Fields S, Song O. A novel genetic system to detect protein–protein interactions. Nature (1989) 340:245–246.[CrossRef][Medline]

Glawischnig E, Hansen BG, Olsen CE, Halkier BA. Camalexin is synthesized from indole-3-acetaldoxime, a key branching point between primary and secondary metabolism in Arabidopsis. Proceedings of the National Academy of Sciences, USA (2004) 101:8245–8250.[Abstract/Free Full Text]

Glawischnig E, Tomas A, Eisenreich W, Spiteller P, Bacher A, Gierl A. Auxin biosynthesis in maize kernels. Plant Physiology (2000) 123:1109–1119.[Abstract/Free Full Text]

Grsic S, Kirchheim B, Pieper K, Fritsch M, Hilgenberg W, Ludwig-Müller J. Induction of auxin biosynthetic enzymes by jasmonic acid and in clubroot diseased Chinese cabbage plants. Physiologia Plantarum (1999) 105:521–531.[CrossRef]

Grsic-Rausch S, Kobelt P, Siemens JM, Bischoff M, Ludwig-Müller J. Expression and localization of nitrilase during symptom development of the clubroot disease in Arabidopsis. Plant Physiology (2000) 122:369–378.[Abstract/Free Full Text]

Haberer G, Young S, Bharti AK, et al. Structure and architecture of the maize genome. Plant Physiology (2005) 139:1612–1624.[Abstract/Free Full Text]

Haga K, Iino M. Auxin–growth relationships in maize coleoptiles and pea internodes and control by auxin of the tissue sensitivity to auxin. Plant Physiology (1998) 117:1473–1486.[Abstract/Free Full Text]

Hill DW, Walters FH, Wilson TD, Stuart JD. High performance liquid chromatographic determination of amino acids in the picomole range. Analytical Chemistry (1979) 51:1338–1341.[Medline]

Hoffman CS, Winston F. A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene (1987) 57:267–272.[CrossRef][ISI][Medline]

Hull AK, Vij R, Celenza JL. Arabidopsis cytochrome P450s that catalyze the first step of tryptophan-dependent indole-3-acetic acid biosynthesis. Proceedings of the National Academy of Sciences, USA (2000) 97:2379–2384.[Abstract/Free Full Text]

Irving HR, Dyson G, McConchie R, Parish RW, Gehring CA. Effects of exogenously applied jasmonates on growth and intracellular pH in maize coleoptile segments. Journal of Plant Growth Regulation (1999) 18:93–100.[Medline]

Ishikawa H, Evans ML. The role of the distal elongation zone in the response of maize roots to auxin and gravity. Plant Physiology (1993) 102:1203–1210.[Abstract]

Jenrich R, Trompetter I, Bak S, Olsen CE, Møller BL, Piotrowski M. Evolution of heteromeric nitrilase complexes in Poaceae with new functions in nitrile metabolism. Proceedings of the National Academy of Sciences, USA (2007) 104:18848–18853.[Abstract/Free Full Text]

Jensen PJ, Bandurski RS. Metabolism and synthesis of indole-3-acetic acid (IAA) in Zea mays (levels of IAA during kernel development and the use of in vitro endosperm systems for studying IAA biosynthesis). Plant Physiology (1994) 106:343–351.[Abstract]

Kepinski S, Leyser O. The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature (2005) 435:446–451.[CrossRef][Medline]

Kriechbaumer V, Park WJ, Gierl A, Glawischnig E. Auxin biosynthesis in maize. Plant Biology (2006) 8:334–339.[CrossRef][Medline]

Kutz A, Müller A, Peter H, Kaiser WM, Piotrowski M, Weiler EM. A role for nitrilase 3 in the regulation of root morphology in sulfur starving Arabidopsis thaliana. The Plant Journal (2002) 30:95–106.[CrossRef][ISI][Medline]

Ljung K, Hull AK, Kowalczyk M, Marchant A, Celenza J, Cohen JD, Sandberg G. Biosynthesis, conjugation, catabolism and homeostasis of indole-3-acetic acid in Arabidopsis thaliana. Plant Molecular Biology (2002) 50:309–332.[CrossRef][ISI][Medline]

Mena M, Ambrose BA, Meeley RB, Briggs SP, Yanofsky MF, Schmidt RJ. Diversification of C-function activity in maize flower development. Science (1996) 274:1537–1540.[Abstract/Free Full Text]

Mikkelsen MD, Hansen CH, Wittstock U, Halkier BA. Cytochrome P450 CYP79B2 from Arabidopsis catalyzes the conversion of tryptophan to indole-3-acetaldoxime, a precursor of indole glucosinolates and indole-3-acetic acid. Journal of Biological Chemistry (2000) 275:33712–33717.[Abstract/Free Full Text]

Mukherjee C, Zhu D, Biehl ER, Parmar RR, Hua L. Enzymatic nitrile hydrolysis catalyzed by nitrilase ZmNIT2 from maize: an unprecedented β-hydroxy functionality enhanced amide formation. Tetrahedron (2006) 62:6150–6154.[CrossRef][ISI]

Nafisi M, Goregaoker S, Botanga CJ, Glawischnig E, Olsen CE, Halkier BA, Glazebrook J. Arabidopsis cytochrome P450 monooxygenase 71A13 catalyzes the conversion of indole-3-acetaldoxime in camalexin synthesis. The Plant Cell (2007) 19:2039–2052.[Abstract/Free Full Text]

Nagasawa T, Wieser M, Nakamura T, Iwahara H, Yoshida T, Gekko K. Nitrilase of Rhodococcus rhodochrous J1: conversion into the active form by subunit association. European Journal of Biochemistry (2000) 267:138–144.[ISI][Medline]

Nishimura T, Mori Y, Furukawa T, Kadota A, Koshiba T. Red light causes a reduction in IAA levels at the apical tip by inhibiting de novo biosynthesis from tryptophan in maize coleoptiles. Planta (2006) 224:1427–1435.[CrossRef][ISI][Medline]

Normanly J, Grisafi P, Fink GR, Bartel B. Arabidopsis mutants resistant to the auxin effects of indole-3-acetonitrile are defective in the nitrilase encoded by the NIT1 gene. The Plant Cell (1997) 9:1781–1790.[Abstract]

O'Reilly C, Turner PD. The nitrilase family of CN hydrolysing enzymes – a comparative study. Journal of Applied Microbiology (2003) 95:1161–1174.[CrossRef][Medline]

Park WJ, Kriechbaumer V, Müller A, Piotrowski M, Meeley RB, Gierl A, Glawischnig E. The nitrilase ZmNIT2 converts indole-3-acetonitrile to indole-3-acetic acid. Plant Physiology (2003) 133:794–802.[Abstract/Free Full Text]

Pilet PE, Saugy M. Effect on root growth of endogenous and applied IAA and ABA: a critical reexamination. Plant Physiology (1987) 83:33–38.[Abstract/Free Full Text]

Piotrowski M, Schönfelder S, Weiler EW. The Arabidopsis thaliana NIT4 and its orthologs in tobacco β-cyano-L-alanine hydratase/nitrilase. Journal of Biological Chemistry (2001) 276:2616–2621.[Abstract/Free Full Text]

Piotrowski M, Volmer JJ. Cyanide metabolism in higher plants: cyanoalanine hydratase is a NIT4 homolog. Plant Molecular Biology (2006) 61:111–122.[CrossRef][ISI][Medline]

Schmidt RC, Müller A, Hain R, Bartling D, Weiler EW. Transgenic tobacco plants expressing the Arabidopsis thaliana nitrilase II enzyme. The Plant Journal (1996) 9:683–691.[CrossRef][ISI][Medline]

Vandenbussche F, Vriezen WH, Smalle J, Laarhoven LJ, Harren FJ, van der Straeten D. Ethylene and auxin control the Arabidopsis response to decreased light intensity. Plant Physiology (2003) 133:517–527.[Abstract/Free Full Text]

Vorwerk S, Biernacki S, Hillebrand H, Janzik I, Müller A, Weiler EW, Piotrowski M. Enzymatic characterization of the recombinant Arabidopsis thaliana nitrilase subfamily encoded by the NIT2/NIT1/NIT3-gene cluster. Planta (2001) 212:508–516.[CrossRef][ISI][Medline]

Woodward AW, Bartel B. Auxin: regulation, action, and interaction. Annals of Botany (2005) 95:707–735.[Abstract/Free Full Text]

Yamamoto Y, Kamiya N, Morinaka Y, Matsuoka M, Sazuka T. Auxin biosynthesis by the YUCCA genes in rice. Plant Physiology (2007) 143:1362–1371.[Abstract/Free Full Text]

Zhao Y, Christensen SK, Fankhauser C, Cashman JR, Cohen JD, Weigel D, Chory J. A role for flavin monooxygenase-like enzymes in auxin biosynthesis. Science (2001) 291:306–309.[Abstract/Free Full Text]

Zhao Y, Hull AK, Gupta NR, Goss KA, Alonso J, Ecker JR, Normanly J, Chory J, Celenza JL. Trp-dependent auxin biosynthesis in Arabidopsis: involvement of cytochrome P450s CYP79B2 and CYP79B3. Genes and Development (2002) 16:3100–3112.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Plant Physiol.Home page
R. Sanchez-Perez, K. Jorgensen, C. E. Olsen, F. Dicenta, and B. L. Moller
Bitterness in Almonds
Plant Physiology, March 1, 2008; 146(3): 1040 - 1052.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kriechbaumer, V.
Right arrow Articles by Glawischnig, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kriechbaumer, V.
Right arrow Articles by Glawischnig, E.
Agricola
Right arrow Articles by Kriechbaumer, V.
Right arrow Articles by Glawischnig, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?