RESEARCH PAPER |
A new self-compatibility haplotype in the sweet cherry Kronio, S5', attributable to a pollen-part mutation in the SFB gene
kovi
1,3
1East Malling Research, New Road, East Malling, Kent ME19 6BJ, UK
2Dipartimento di Colture Arboree, Università degli Studi di Palermo, Viale delle Scienze 11, 90128 Palermo, Italy
3Imperial College at Wye, Ashford, Kent TN25 5AH, UK
* To whom correspondence should be addressed. E-mail: ken.tobutt{at}emr.ac.uk
Received 21 August 2007; Revised 23 October 2007 Accepted 25 October 2007
| Abstract |
|---|
|
|
|---|
Kronio is a Sicilian cultivar of sweet cherry (Prunus avium), nominally with the incompatibility genotype S5S6, that is reported to be naturally self-compatible. In this work the cause of its self-compatibility was investigated. Test selfing confirmed self-compatibility and provided embryos for analysis; PCR with consensus primers designed to amplify S-RNase and SFB alleles showed that the embryos were of two types, S5S5 and S5S6, indicating that S6 pollen failed, but S5 succeeded, perhaps because of a mutation in the pollen or stylar component. Stylar RNase analysis indicated active S-RNases for both S5 and S6. The S-RNase alleles were cloned and sequenced; and sequences encode functional proteins. Cloning and sequencing of SFB alleles showed that S6 was normal but S5 had a premature stop codon upstream of the variable region HVa resulting in a truncated protein. Therefore, the self-compatibility can be attributed to a pollen-part mutation of S5, designated S5', the first reported case of breakdown of self-incompatibility in diploid sweet cherry caused by a natural mutation at the S-locus. The second intron of the S-RNase associated with S5' contained a microsatellite smaller than that associated with S5; primers designed to amplify across this microsatellite effectively distinguished S5 from S5'. Analysis of some other Sicilian cherries with these primers indicated that S5' is also present in the Sicilian cultivar Maiolina a Rappu, and this proved to be self-compatible.
Key words: Natural mutation, pollen-part mutant, Prunus avium, self-compatibility, SFB
| Introduction |
|---|
|
|
|---|
In cherry (Prunus avium), an economically important member of the Rosaceae family, most individuals are self-incompatible and certain pairs of individuals are cross-incompatible. This incompatibility is controlled by a single multiallelic locus, the S-locus, with gametophytic action (Crane and Lawrence, 1929). Only pollen tubes carrying an S-allele different from the two stylar S-alleles can reach the ovary to achieve fertilization. It has been established that the S-locus has at least two parts, one operating in the style and the other in the pollen (Lewis, 1949). In the past, the determination of self-incompatibility genotypes in sweet cherry cultivars, which are vegetatively propagated, was based on cross-pollination tests, in some cases followed by progeny testing (Crane and Brown, 1937). Such information is useful knowledge for farmers planting orchards and breeders planning crosses. By the 1960s, six S-alleles had been described on the basis of pollination studies (Matthews and Dow, 1969).
In recent years, there have been considerable advances in the molecular genetics of incompatibility in cherry concerning both the stylar and pollen parts. Progress in the discovery of new S-alleles was made by the demonstration that S-alleles in cherry code for stylar RNases (S-RNases) which can be detected using electrophoresis and activity staining (Bo
kovi
and Tobutt, 1996). Six new S-alleles were found by using such methods (Bo
kovi
et al., 1997; Bo
kovi
and Tobutt, 2001). Methods based on PCR have also been developed to detect S-alleles. Tao et al. (1999) and Wiersma et al. (2001) designed consensus primers that amplify the two introns of most, though not all, cherry S-RNases, exploiting the length polymorphism to discriminate alleles. Sonneveld et al. (2001, 2003) developed specific primers and improved consensus primers, and detected S16 in addition to S1–S14. De Cuyper et al. (2005), using these primers on accessions of wild cherry, have additionally detected alleles S17–S22. More recently, Sonneveld et al. (2006) designed fluorescent primers to distinguish alleles on the basis of polymorphism of the first intron. The S-locus also codes for the S-haplotype-specific F-box protein (SFB) expressed in the pollen (Yamane et al., 2003; Ikeda et al., 2004). The cherry SFB gene showed the F-box motif and two highly variable non-conserved regions, HVa and HVb (Ikeda et al., 2004). Vaughan et al. (2006) recently developed consensus primers that exploit the polymorphism of the intron present in the 5 untranslated region (UTR) of the SFB gene to distinguish alleles.
A similar gametophytic incompatibility system, mediated by S-RNases and SFB proteins, is found not only in various other members of the Rosaceae but also in the Solanaceae and Scrophulariaceae (McClure and Franklin-Tong, 2006) and doubtless in some other families of the same clade. However, the nature of the interaction of the S-RNase and SFB proteins remains unclear. Among current models are the two-component inhibitor model developed by, for example, Sonneveld et al. (2005) as an update of Luu et al. (2000, 2001), and the sequestration model presented by Goldraij et al. (2006).
Occasional cherries are self-compatible and, as self-compatibility is a desirable trait, aiding regular production and facilitating orchard management, it is a principal objective of many breeding programmes. Most modern self-compatible cultivars derive from the selection JI2420, and at least one appears to derive from JI2434 (Sonneveld et al., 2003), of which two different forms are known (Bo
kovi
et al., 2000; Sonneveld et al., 2005). These selections were raised at the John Innes Institute, from crosses in which X-ray-irradiated pollen was used in a nominally incompatible pollination (Lewis and Crowe, 1954), and have the mutant alleles S4' and S3', respectively (Bo
kovi
et al., 2000), where the prime (') indicates a mutation in the pollen part of the S locus (Lewis and Crowe, 1954). Recently it has been shown that their self-compatibility is attributable to defective F-box genes, a frameshift mutation in the case of S4' (Ushijma et al., 2004; Sonneveld et al., 2005) and a total deletion in the case of S3' (Sonneveld et al., 2005). No natural self-compatible alleles have been reported in sweet cherry.
A few sweet cherry cultivars unrelated to JI2420 and JI2434 are reported in the literature to be naturally self-compatible. These include the Spanish cultivar Temprana de Sot and its sport Cristobalina (Herrero, 1964; Wünsch and Hormaza, 2004a, b), and the Italian cultivar Kronio (Calabrese et al., 1984), named after the mountain in Sicily in which it was collected, and possibly also grown under different names, such as Aquaiola, Primintia (Calabrese et al., 1984), or Prummintiva. Moreover, Spina (1959) described the Italian cultivar Maiolina as having a low level of self-compatibility, and an accession known as Maiolina a Rappu appears to be closely related to Kronio (Marchese et al., 2007). The nature of the self-compatibility in Cristobalina (S3S6) has recently been the subject of study (Wünsch and Hormaza, 2004b); it appears that its self-compatibility may be attributable to a non-S locus, the nature of which is unknown. The genotype of Kronio has been reported as S5S6 on the basis of PCR amplification of S-RNase and SFB alleles (Marchese et al., 2007), but its self-compatibility has not been explained. Kronio could perhaps have a common origin with Cristobalina because they both have S6 and are early ripening, and there are historical links between Sicily and Spain.
In diploid Prunus species that are essentially self-incompatible, self-compatibility caused by natural mutation affecting the stylar component has been reported in almond (P. dulcis) and attributed to Sf (Bo
kovi
et al., 1999), and natural self-compatibility affecting the pollen component has been reported in Japanese apricot (P. mume), Sf (Tao et al., 2002; Ushijima et al., 2004), in apricot (P. armeniaca), Sc (Vilanova et al., 2006), and in Japanese plum (P. salicina), Se (Beppu et al., 2005). Translocation of an S allele, or of the pollen part, i.e. the SFB allele, giving heteroallelic pollen has been found as a cause of self-compatibility in Solanaceae (Brewbaker and Natarajan, 1960; Golz et al., 2001; Tsukamoto et al., 2005) and has been proposed as a cause of self-compatibility in Prunus (Brewbaker and Natarajan, 1960) but not demonstrated. So far, there appear to be no deletions or truncations of the pollen component reported in Solanaceae (Tsukamoto et al., 2005) or Scrophulariaceae.
This work was undertaken primarily to discover the nature of the self-compatible mutation in Kronio. Using a combination of classic crossing, analysis of the stylar proteins for activity of S-RNases, PCR amplification of S-RNase and SFB alleles, and cloning and sequencing, a novel allele has been characterized. Maiolina a Rappu was also investigated.
| Materials and methods |
|---|
|
|
|---|
Plant material
Two Kronio trees, not virus tested, growing on a farm in Sciacca, Sicily, were used for selfing and test-crossing, and provided styles for S-RNase analysis and leaves for cloning S5- and S6-RNase and SFB; their identities were confirmed by fingerprinting (Marchese et al., 2007). The cultivars Colney, genotype S5S6 (Bo
kovi
et al., 1997), and Summit, S1S2 (Bo
kovi
and Tobutt, 1996), growing at East Malling Research were the source of pollen for crosses. Seeds from two progenies, Kronio selfed and KronioxSummit, were fingerprinted to confirm parentage and analysed by PCR to determine the S-genotype. The cultivar, Maiolina a Rappu, genotype S5S6 (Marchese et al., 2007), in the collection at the Dipartimento di Colture Arboree, University of Palermo (Italy), provided leaves for investigating the S5-SFB allele by cloning and seeds for checking for evidence of self-compatibility. In addition, to screen for variants of S5-RNase, two Sicilian cultivars, Cavallaro (S5S9) and Dura Succosa (S1S5) (Marchese et al., 2007), and seeds from the cross ColneyxKronio were analysed.
Controlled pollination
The Kronio trees were selfed to confirm their self-compatibility and to obtain a progeny for study of the segregation of S-RNase and SFB alleles. Flowers were bagged at the balloon stage to avoid contamination, and self-pollination occurred naturally inside the bags (Table 1).
|
Kronio was pollinated with the nominally cross-incompatible cultivar Colney (S5S6). In addition, as a control and to raise a progeny to check the segregation of the Kronio alleles, it was pollinated with the fully cross-compatible cultivar Summit (S1S2). Anthers were collected from flowers at the late balloon stage and allowed to dehisce for 1 d. For each cross, 300 flowers were emasculated, pollinated, and bagged (Table 1). In addition, pollen of Kronio was used to pollinate Summit and Colney, 200 and 100 flowers, respectively, even though the germination of Kronio pollen on agar plates was poor, only 2%, whereas the germination of Summit pollen was 35%.
S-RNase activity of Kronio
To check the activity of the stylar S-RNases, proteins were extracted from styles of Kronio (S5S6) and reference cultivars Colney (S5S6), Bradbourne Black (S3S5), and Merton Heart (S3S6), and were separated electrophoretically on acrylamide gels using isoelectric focusing (IEF) and stained for RNase activity, as described by Bo
kovi
and Tobutt (1996).
PCR analysis of segregation
To study the segregation of S-alleles, DNA was extracted from 45 seeds of the Kronio selfed progeny and 42 of the KronioxSummit progeny, and also from the parents, using the method of Doyle and Doyle (1987). To confirm parentage, the samples were fingerprinted with a set of simple sequence repeats (SSRs) as described by Vaughan and Russell (2004) and Marchese et al. (2007). Then the samples were amplified with two fluorescent consensus primer pairs for the incompatibility (S) locus, one amplifying across the first intron of the S-RNase gene (PaSPcons-F1 and PaC1cons-R1) (Sonneveld et al., 2006) and the other across the intron of the SFB gene (F-BOX5'A and F-BOX intronR) (Vaughan et al., 2006), using the conditions described by Vaughan and Russell (2004). Product sizes were determined using an ABI Prism 3100 Genetic Analyser and GENESCAN and GENOTYPER software (Perkin Elmer, USA, and Applied Biosystems, USA), and seedling genotypes were deduced by comparison with the product sizes of S-RNase and SFB alleles reported by Vaughan et al. (2006). The goodness-of-fit of segregations to Mendelian segregation ratios (1:1) was tested with the
2 test.
Cloning and sequencing S-RNase and SFB alleles
To characterize the S-haplotypes in Kronio, partial lengths of S-RNase and SFB alleles were cloned and sequenced. The two S-RNase alleles were amplified from genomic DNA with proof-reading KOD DNA polymerase (Merck Biosciences, Nottingham, UK) and with PaConsI-F and PaConsII-R primers, following the PCR conditions reported by Sonneveld et al. (2003). The amplified DNA was purified and concentrated using the QiaQuick PCR purification spin kit (Qiagen, Crawley, UK). Then, PCR products were cloned into pCR'4 Blunt-TOPO vector (Invitrogen, Paisley, UK) or pCR'-Blunt II-TOPO vector (Invitrogen) according to the manufacturer's instruction, transformed into One Shot®Mach1TM-T1R chemically competent Escherichia coli (Invitrogen), and screened by using colony PCR. Plasmid DNA was extracted by using a QIAprep® Spin Miniprep kit and inserts were sequenced using M13 and internal primers. To amplify separately each of the two SFB alleles, in one amplification, two new allele-specific primer pairs, S5-SFB-F: GTGAGTCATTGGATTTTCA and S5-SFB-R: TGTAAGTAATTGCAAACACG and S6-SFB-F: TGAGTCATTGGACTTTCTG and S6-SFB-R: GCAAACAATAATTCGATTTCAC, were designed, respectively, from the sweet cherry sequences for S5-SFB (AY805050; Vaughan et al., 2006) and S6-SFB (AY805051; Vaughan et al., 2006). PCRs were performed using 100 ng of genomic DNA in 30 µl reactions containing 1x KOD buffer (Merck Biosciences), 0.2 mM dNTPs, 1 mM MgSO4, 0.5 µM forward and reverse primers, and 1 µl of KOD polymerase. Amplifications were carried out as described by Vaughan et al. (2006) using an annealing temperature of 57 °C. PCR products for the alleles S5-SFB and S6-SFB were cloned in pCR'-BluntII-TOPO vector (Invitrogen), according to the manufacturer's instructions. The colonies obtained were screened using M13-F and M13-R primers. For each of the two alleles at the S-locus, plasmids from three positive colonies, extracted by using a QIAprep® Spin Miniprep kit, were sequenced using M13 and internal primers.
Similarly, S5-SFB was cloned from the cultivar Maiolina a Rappu.
Sequence alignment and analysis
The sequence contigs were assembled and translated using SeqMan and EditSeq programs, respectively (DNAStar, Madison, WI, USA). Nucleotide sequences or deduced amino acid sequences were aligned by using the Clustal W method of the MegAlign computer program (DNAStar), and the following published EMBL sequences were included for comparison: AJ635291, AJ635292, AJ635289, AJ635290, AY805050, and AY805051. Kronio nucleotide sequences were submitted to the NCBI/GenBank database.
Primers for the S5-RNase microsatellite
To facilitate recognition of variants of S5-RNase differing with respect to a microsatellite in the second intron, a primer pair was designed flanking the microsatellite. This was S5-2SSR-F: 6-FAM TGTTATTATCGTGCAGACGTTATG and S5-2SSR-R: TTTGACTTGAAGCTTTCATTTAGG. These primers were used to screen three more Sicilian sweet cherry cultivars known to have S5 (Marchese et al., 2007) and three seeds from the cross ColneyxKronio. Approximately 50 ng of genomic DNA was used for PCR amplification in 25 µl reactions containing 1x PCR buffer (Qiagen), 2.0 mM MgCl2, 0.2 mM dNTPs, 0.2 µM of each primer. and 1.25 U of Taq DNA polymerase (Qiagen). Primers gave satisfactory amplification with the following conditions: 2 min at 94 °C, 35 cycles of 94 °C for 1 min, 57 °C for 1 min and 72 °C for 1 min, with a 5 min final extension step at 72 °C. PCR products were run on a 1.5% agarose gel for 2 h at 100 V. Then, following a 1:20 dilution, PCR products were also screened using an automated ABI Prism 3100 Genetic Analyser. Allele sizes were determined using GENESCAN and GENOTYPER software.
Confirmation of self-compatibility in Maiolina a Rappu
To check for self-compatibility of Maiolina a Rappu, seeds from open pollination were screened by using primers for the S-locus and 10 microsatellites in the two multiplexes, A and C, as described by Vaughan and Russell (2004) and Marchese et al. (2007).
| Results |
|---|
|
|
|---|
Pollinations
After self-pollination of the cultivar Kronio, 157 fruits were obtained from 400 flowers, confirming its self-compatibility; 40% of the fruits contained recoverable embryos, half of which were plump, while the remaining half were shrivelled. A high proportion of shrivelled seeds, containing immature embryos, is not unexpected in early ripening cultivars, and inbreeding depression may have been another contributing factor.
Kronio did not set any fruit when pollinated with the fully cross-incompatible cultivar Colney (S5S6), suggesting that Colney pollen tubes are arrested in the style of Kronio. With pollen of the fully cross-compatible cultivar Summit (S1S2), 124 Kronio fruits were obtained from 300 flowers; 80% of these fruits contained plump embryos.
From the cross of ColneyxKronio, six fruits, of which five contained plump embryos, were set from 100 flowers pollinated, indicating compatibility. The cross of SummitxKronio gave 28 fruits from 200 flowers; 75% of the fruits contained plump seeds, even though the germination of Kronio pollen tested on agar was poor, perhaps because of virus infection; Prunus dwarf virus (PDV) is reported to reduce pollen germination in sweet cherry (Andersone et al., 2002).
S-RNases
The IEF gel revealed two bands of RNase activity for stylar extracts of Kronio which, by comparison with Colney (S5S6), Bradbourne Black (S3S5), and Merton Heart (S3S6), clearly correspond to S5 and S6, indicating that both alleles code for active S-RNases (Fig. 1). This result is consistent with the lack of fruit set from the cross of KronioxColney.
|
Progeny segregation analysis by PCR
PCR analysis to determine S-allele genotypes of Kronio selfed seeds by using consensus primers for the S-RNase and SFB genes followed by fluorescent sizing gave patterns consistent with S5 and S6 alleles. The selfed progeny segregated 19 S5S5:26 S5S6, approximately 1:1,
2=4.29 (Table 1); no S6S6 seeds were found. This result is consistent with a mutation of the S5 allele, either a pollen-part ' or a stylar-part ° mutation. Mutation of S6 would have resulted in the class S6S6 instead of S5S5. As the cross of KronioxColney did not give any fruit set, it was possible to deduce that the mutated S5 is S5' rather than S5°, affecting the pollen part rather than the stylar part. Had the genotype been S5°, the cross KronioxColney would have been semi-compatible. A non-S mutation would be expected to result in both homozygous classes as well as heterozygotes. Had only S-RNase primers been used, then the segregation pattern would not have eliminated the possibility of a duplication of only S6-SFB (S6e) and not of the S6-RNase; the heteroallelic pollen being self-compatible would give classes S5S5S6e and S6S5S6e, but PCR with S-RNase primers would show classes S5S5 and S5S6.
PCR genotyping of 42 seeds from the cross KronioxSummit showed the segregation 8 S1S5:15 S1S6:11 S2S5:8 S2S6, consistent with the segregation expected from a fully compatible cross, 1:1:1:1,
2=5.17 (Table 1). These data indicate the absence of S-allele duplication in Kronio as this condition would have resulted in some of the seedlings inheriting both S5 and S6, as well as S1 or S2.
When Maiolina a Rappu seeds derived from open pollination were analysed using primers for the S-locus and a set of 10 SSRs, some 80% were found to derive from self-pollination, half S3S5 and half S5S5 (data not shown), indicating self-compatibility in this cultivar associated with the S5 allele.
Cloning and sequencing S-RNases
The deduced amino acid sequences of the S5-RNase and S6-RNase were aligned with the Colney S-RNase sequences in the EMBL database and were submitted under the accession numbers EU077235 and EU077236, respectively. The sequence of Kronio S6-RNase matched those of Colney (AJ635291 and AJ635292). The sequence of Kronio S5-RNase showed minor variation in comparison with those of Colney (AJ635289 and AJ635290) but only in the two introns. In particular, the first microsatellite present in the second intron of Kronio was 2 bp longer than that of Colney, (CT)12 versus (CT)11, and the second microsatellite of Kronio was 36 bp shorter than that of Colney, (AT)5 versus (AT)23 (data not shown).
S5-RNase in other Sicilian cultivars and discrimination by PCR of S5' from S5 in cultivars and seedlings
In the survey of three other Sicilian cultivars scored as having S5, namely Cavallaro (S5S9), Dura Succosa (S1S5), and Maiolina a Rappu (S3S5), together with Kronio (S5S6) with primers designed to amplify across the second microsatellite in the S5-RNase second intron, Maiolina a Rappu showed the same product as Kronio of almost 150 bp on an agarose gel; the remaining cultivars showed a longer product of
190 bp, indicating that they do not have the Kronio S5-RNase variant.
When two seeds of genotype S5S5' obtained from the ColneyxKronio cross were analysed with the specific primers and the products separated on the sequencer, they showed the two variants of S5-RNase, i.e. a peak at 154 bp and a peak at 190 bp, showing that the primers successfully distinguish the two variants (Fig. 2). A third seed, S5'S6, gave a peak only at 154 bp. When both variants are present, the peak at 154 bp was amplified preferentially.
|
Cloning and sequencing of SFB
The sequences of S5 and S6 SFB were submitted to the database under the accession numbers EU077237 and EU077238, respectively.
The sequence S6-SFB of Kronio was identical to that of Governor Wood (AY805051). However, when the coding region of Kronio S5-SFB was aligned with that of Late Black Bigarreau (AY805050), a premature stop codon, TAG (due to a point mutation A:G at position 972 of the nucleotide sequence), was found in place of TGG coding for tryptophan, before the HVa region at position 287 of the amino acid sequence in all three independent colonies (Fig. 3). Therefore, Kronio S5-SFB lacks 80 amino acid residues. Other differences were a change from threonine to isoleucine at position 2 of the amino acid sequence (position 117 of the nucleotide sequence) and a virtual change from glutamine to arginine at position 343 of the amino acid sequence; but this latter change will not occur in the protein, as S5-SFB is truncated after the stop codon (Fig. 3). In addition, two nucleotides differed in the intron located in the 5 UTR. The first discrepancy was A:C, at position 91, and the second was A:T, at position 99 (data not shown).
|
The S5-SFB sequence of Maiolina a Rappu was identical to that of Kronio and had the same premature stop codon.
| Discussion |
|---|
|
|
|---|
In this report evidence is presented that self-compatibility in the Sicilian cherry cultivar Kronio is due to a previously unreported pollen-part mutation S5'.
S5' in Kronio and Maiolina a Rappu
Selfing confirmed the self-compatibility of Kronio, and the genotype of the selfed seedlings indicated that the mutation responsible affected S5. The two active RNases seen on the activity gel, the normal S-RNase sequences, the absence of seedlings when Kronio was crossed with the fully incompatible cultivar Colney, and, finally, obtaining seeds when Colney was crossed with Kronio indicated a ' pollen-part rather than stylar-part mutation. As none of the seedlings from Kronio selfed or from KronioxSummit inherited both S5 and S6 as well as S1 or S2, the possibility of duplication of S6 resulting in heteroallelic compatible pollen could be excluded. Sequencing of SFB alleles indicated that S5-SFB had a premature stop codon, so that the protein is truncated before the two hypervariable regions. The nature of S5' is consistent with previous findings that a truncated SFB product, in S4', confers self-compatibility (Ushijima et al., 2004; Sonneveld et al., 2005). Lack of self-interaction between the truncated S5 pollen product and S5-RNase in Kronio, according to the two-component inhibitor model (Luu et al., 2000, 2001; Sonneveld et al., 2005), would allow the destruction of S5-RNase by a general inhibitor. According to the recently proposed RNase sequestration model (Goldraij et al., 2006), the release of S5-RNase trapped within the vacuole of an S5' pollen tube would not be triggered.
The distinctive number of repeats in the larger of the two SSRs in the second intron of the RNase of S5', which corresponds to that described by Sonneveld et al. (2003), allowed the design of informative primers. Interestingly, amplification with the second intron consensus primers PaConsII-F and PaConsII-R produced, on agarose, a secondary, weaker, band in cultivars with S5 which Sonneveld et al. (2003) attributed to a secondary structure of DNA perhaps associated with the presence of a microsatellite. In contrast, S5' in Kronio and Maiolina a Rappu gave only a single band (data not shown), perhaps because the shorter SSR determines a different DNA conformation.
When three other Sicilian cultivars having S5 were tested with the primers flanking the SSR, Maiolina a Rappu, which had already been demonstrated to be closely related to Kronio (Marchese et al., 2007), had the same length SSR as Kronio. Cloning the SFB of Maiolina a Rappu confirmed that the accession has the mutant S5'-SFB, and analysis of the Maiolina a Rappu seeds from open pollination demonstrated that it is indeed self-compatible. Thus Maiolina a Rappu should be removed from SI group VII (Marchese et al., 2007) and added to the SC group with the genotype S3S5'.
Interestingly, growers in the Etna area in Sicily have noticed that Maiolina a Rappu crops reliably even when planted in single-cultivar orchards. However, a cultivar of this name was described by Spina (1959) as self-incompatible, so our accession of Maiolina a Rappu does not correspond to that one. Nevertheless, Spina (1959) did describe another local cultivar called Maiolina (syn. Maiulina, Prummintiva, Primaticcia) having a low level of self-compatibility. In Sicily, all local sweet cherry accessions ripening in early May are called Maiolina, which may be regarded more as a landrace than a unique cultivar. Kronio belongs to this type.
It is possible that self-compatibility in cherry may have been indirectly selected by man. If flowering is very early, and few pollinators are available, then self-incompatible early flowering varieties would not crop well. So selection for reliable cropping in such types may have led to selection for self-compatibility.
Other pollen part mutations in Prunus, other Rosaceae, and other families
Previously, two other pollen-part mutations, S3' and S4', have been characterized in sweet cherry. These alleles arose at the John Innes Institute, induced by pollen irradiation and selected by nominally incompatible pollination (Lewis, 1949, 1951). S3' lacks an SFB altogether (Sonneveld et al., 2005); in S4' the SFB has a premature stop codon (Ushijima et al., 2004; Sonneveld et al., 2005). S4' occurs in most self-compatible cultivars, many of which are Canadian and derive from JI2420, while S3' has so far been reported in only one cultivar, from Hungary, which apparently derives from another JI selection (Sonneveld et al., 2003).
Mutant-specific primers have been developed to distinguish S4' from S4 (Yamane et al., 2004; Zhu et al., 2004). So far there are no specific primers available to amplify the region flanking the deletion in S3'. For S5, the primers detecting SSR variation in the S-RNase intron have proved informative in detecting S5'; however, it is not known whether S5' is invariably associated with the (AT)5 microsatellite.
The nature of self-compatibility in the Spanish cultivar Cristobalina (S3S6) has not yet been resolved but is thought to be non-S (Wünsch and Hormaza, 2004b). Therefore, despite historic links between Spain and Sicily and the presence of S6 in both Kronio and Cristobalina, the nature of the self-compatibility of these two early ripening cultivars is different.
S5' is the first natural pollen-part mutation characterized in sweet cherry. In another normally self-incompatible diploid Prunus crop, almond (P. dulcis), natural self-compatibility has been characterized in material from Puglia. In that case, the Sf allele lacks RNase activity (Bo
kovi
et al., 1999) apparently because of a substitution of an active site histidine residue in the S-RNase by an arginine residue (Ma and Oliveira, 2001). Other mutant self-compatibility alleles in diploid Prunus are Sc in apricot, in which an insertion upstream from the HVa hypervariable region in the SFB leads to a defective protein lacking HVa and HVb (Vilanova et al., 2006), Sf in Japanese apricot, in which an insertion in the middle of the coding region of the SFB causes a frameshift and a premature stop codon (Ushijima et al., 2004), and Se in Japanese plum, the nature of which is unknown (Beppu et al., 2005). Peach (P. persica) is self-compatible and is reported to have mutant pollen S-haplotypes, S1', S2', and S2m', the wild-type versions of which occur in almond or Japanese plum (Tao et al., 2007).
Incidentally, natural style- and pollen-part mutations have been reported in tetraploid sour cherry, i.e. S13° and S13' (Bo
kovi
et al., 2006; Tsukamoto et al., 2006), and S1' (Hauck et al., 2006), that are due to structural alterations such as substitution, insertion of nucleotides, or other inactivation. Tsukamoto et al. (2006) suggested that polyploidization and gene duplication are indirectly responsible for such dysfunction of S-haplotypes and the emergence of self-compatibility in tetraploid sour cherry. The evidence from Kronio shows a dysfunctional haplotype in diploid cherry, indicating that such mutants can occur independently of genome duplication.
No pollen-part mutants have yet been characterized in other diploid Rosaceae, such as Malus or Pyrus, although autotetraploidy results in self-compatibility because of the competitive interaction between the two specificities in heteroallelic pollen (Crane and Lewis, 1941; Lewis and Modlibowska, 1942). In Solanaceae, pollen part mutants are attributed to duplication of the pollen component (Golz et al., 2001; Tsukamoto et al., 2005). No mutations of the SFB gene have been reported in this family or in the Scrophulariaceae.
Use of Kronio as a new source of self-compatibility
Kronio could be a useful new source of self-compatibility, as mentioned by Marchese et al. (2007). The allele S5' is being introduced into breeding lines, to reduce reliance on material derived from the John Innes selections. As Kronio is small fruited, it is desirable that the other parents be large-fruited, such as Colney or Summit. Kronio is exceptionally early flowering, apparently needing little winter chilling, and is early ripening; so some of these new breeding lines may be useful for adaptation to warmer climates than currently experienced in the UK. Crosses of the type S6SxxKronio (S5'S6) should give seedlings that are all self-compatible, S5'S6 and S5'Sx, an example of the general strategy proposed by Williams and Brown (1960) for generating non-segregating progenies of self-compatible seedlings.
| Acknowledgements |
|---|
Cherry genetics at EMR is funded by Defra. AM gratefully acknowledges receipt of a grant from Palermo University and Regione Sicilia, and RB a grant from the Mount Trust.
| References |
|---|
|
|
|---|
Andersone D, Wustenberghs H, Cook NC, Keulemans J. Effect of infection by viruses on vegetative and reproductive growth of sweet cherry on Damil and Inmil rootstocks. Horticultural Science (Prague) (2002) 29:99–104.
Beppu K, Komatsu N, Himane H, Yaegaki H, Yamaguchi M, Tao R, Kataoka I. Se-haplotype confers self-compatibility in Japanese plum (Prunus salicina Lindl). Journal of Horticultural Science and Biotechnology (2005) 80:760–764.
Bo
kovi
R, Russell K, Tobutt KR. Inheritance of stylar ribonucleases in cherry progenies, and reassignment of incompatibility alleles to two incompatibility groups. Euphytica (1997) 95:221–228.[CrossRef][Web of Science]
Bo
kovi
R, Tobutt KR. Correlation of stylar ribonuclease zymograms with incompatibility alleles in sweet cherry. Euphytica (1996) 90:245–250.[CrossRef][Web of Science]
Bo
kovi
R, Tobutt KR. Genotyping cherry cultivars assigned to incompatibility groups, by analysing stylar ribonucleases. Theoretical and Applied Genetics (2001) 103:475–485.[CrossRef][Web of Science]
Bo
kovi
R, Tobutt KR, Duval H, Batlle I, Dicenta F, Vargas FJ. A stylar ribonuclease assay to detect self-compatible seedlings, on almond progenies. Theoretical and Applied Genetics (1999) 99:800–810.[CrossRef][Web of Science]
Bo
kovi
R, Tobutt KR, Schmidt H, Sonneveld T. Re-examination of (in)compatible genotypes of two John Innes self-compatible sweet cherry selections. Theoretical and Applied Genetics (2000) 101:234–240.[CrossRef][Web of Science]
Bo
kovi
RI, Wolfram B, Tobutt KR, Cerovi
R, Sonneveld T. Inheritance and interactions of incompatibility alleles in the tetraploid sour cherry. Theoretical and Applied Genetics (2006) 112:315–326.[CrossRef][Web of Science][Medline]
Brewbaker JL, Natarajan AT. Centric fragment and pollen part mutation of incompatibility alleles in Petunia. Genetics (1960) 45:699–704.
Calabrese F, Fenech L, Raimondo A. Kronio: una cultivar di ciliegio molto precoce e autocompatibile. Frutticoltura (1984) 46(5):27–30.
Crane MB, Brown AG. Incompatibility and sterility in the sweet cherry, Prunus avium L. Journal of Pomology and Horticultural Science (1937) 15:86–116.
Crane MB, Lawrence WJC. Genetical and cytological aspects of incompatibility and sterility in cultivated fruits. Journal of Pomology and Horticultural Science (1929) 7:276–301.
Crane MB, Lewis D. Genetical studies in pears. III. Incompatibility and sterility. Journal of Genetics (1941) 43:31–44.[Web of Science]
DeCuyper B, Sonneveld T, Tobutt KR. Determining self-incompatibility genotypes in Belgian wild cherries. Molecular Ecology (2005) 14:945–955.[CrossRef][Medline]
Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin (1987) 19:11–15.
Goldraij A, Kondo K, Lee CB, Hancock CN, Sivaguru M, Vazquez-Santana S, Kim S, Philips TE, Cruz-Garcia F, McClure B. Compartmentalization of S-RNase and HT-B degradation in self-incompatible Nicotiana. Nature (2006) 439:805–810.[CrossRef][Medline]
Golz JF, Oh H-Y, Su V, Kusaba M, Newbigin E. Genetic analysis of Nicotiana pollen-part mutants is consistent with the presence of an S-ribonuclease inhibitor at the S locus. Proceedings of the National Academy of Sciences, USA (2001) 98:15372–15376.
Hauck NR, Ikeda K, Tao R, Iezzoni AF. The mutated SI-haplotype in sour cherry has an altered S-haplotype-specific F-box protein gene. Journal of Heredity (2006) 97:514–520.
Herrero J. Cartografia de las varietades frutales de hueso y pepita (1964) Zaragoza, Spain: CSIC Aula Dei.
Ikeda K, Igic B, Ushijima K, Yamane H, Hauck NR, Nakano R, Sassa H, Iezzoni AF, Kohn JR, Tao R. Primary structural features of the S haplotype-specific F-box protein, SFB, in Prunus. Sexual Plant Reproduction (2004) 16:235–243.[CrossRef][Web of Science]
Lewis D. Structure of the incompatibility gene. II. Induced mutation rate. Heredity (1949) 3:339–355.[Web of Science][Medline]
Lewis D. Structure of the incompatibility gene. III. Types of spontaneous and induced mutation. Heredity (1951) 5:399–414.[Web of Science]
Lewis D, Crowe LK. Structure of the incompatibility gene. IV. Types of mutation in Prunus avium L. Heredity (1954) 8:357–363.[Web of Science]
Lewis D, Modlibowska I. Genetical studies in pears. IV. Pollen-tube growth and incompatibility. Journal of Genetics (1942) 43:211–222.[Web of Science]
Luu D-T, Qin X, Laublin G, Yang Q, Morse D, Cappadocia M. Rejection of S-heteroallelic pollen by a dual-specific S-RNase in Solanum chacoense predict a multimeric SI pollen component. Genetics (2001) 159:329–335.
Luu D-T, Qin X, Morse D, Cappadocia M. S-RNase uptake by compatible pollen tubes in gametophyic self-incompatibility. Nature (2000) 407:649–651.[CrossRef][Medline]
Ma RC, Oliveira MM. Molecular cloning of the self-incompatibility genes S1 and S3 from almond (Prunus dulcis cv. Ferragnés). Sexual Plant Reproduction (2001) 14:163–167.[CrossRef][Web of Science]
Marchese A, Tobutt KR, Raimondo A, Motisi A, Bo
kovi
RI, Clarke J, Caruso T. Morphological characteristics, microsatellite fingerprinting and determination of incompatibility genotypes of Sicilian sweet cherry cultivars. Journal of Horticultural Science and Biotechnology (2007) 82:41–48.
Matthews P, Dow KP. Incompatibility groups: sweet cherry (Prunus avium). In: Abstract bibliography of fruit breeding and genetics to 1965—Knight RL, ed. (1969) Prunus. Farnham Royal: Commonwealth Agricultural Bureau. 540–544.
McClure BA, Franklin-Tong V. Gametophytic self-incompatibility: understanding the cellular mechanisms involved in self pollen tube inhibition. Planta (2006) 224:233–245.[CrossRef][Web of Science][Medline]
Sonneveld T, Robbins TP, Bo
kovi
R, Tobutt KR. Cloning of six cherry self-incompatibility alleles and development of allele-specific PCR detection. Theoretical and Applied Genetics (2001) 102:1046–1055.[CrossRef][Web of Science]
Sonneveld T, Robbins TP, Tobutt KR. Improved discrimination of self-incompatibility S-RNase alleles in cherry and high throughput genotyping by automated sizing of first intron polymerase chain reaction products. Plant Breeding (2006) 125:305–307.[CrossRef][Web of Science]
Sonneveld T, Tobutt KR, Robbins TP. Allele-specific PCR detection of sweet cherry self-incompatibility (S) alleles S1 to S16 using consensus and allele-specific primers. Theoretical and Applied Genetics (2003) 107:1059–1070.[CrossRef][Web of Science][Medline]
Sonneveld T, Tobutt KR, Vaughan SP, Robbins TP. Loss of pollen-S function in two self-compatible selections of Prunus avium is associated with deletion/mutation of an S-haplotype-specific F-box gene. The Plant Cell (2005) 17:37–51.
Spina P. La coltura del ciliegio nella zona etnea. Ricerche sulla biologia fiorale e descrizione delle cultivar. Annali Istituto Sperimentale di Agrumicoltura (1959) 13(4):43–132.
Tao R, Yamane H, Sugiura A, Murayama H, Sassa H, Mori H. Molecular typing of S-alleles through identification, characterisation and cDNA cloning for S-RNases in sweet cherry. Journal of the American Society of Horticultural Science (1999) 124:224–233.
Tao R, Habu T, Namba A, Yamane H, Fuyuhiro F, Iwamoto K, Sugiura A. Inheritance of Sf-RNase in Japanese apricot (Prunus mume) and its relation to self-compatibility. Theoretical and Applied Genetics (2002) 105:222–228.[CrossRef][Web of Science][Medline]
Tao R, Watari A, Hanada T, Habu T, Yaegaki H, Yamaguchi M, Yamane H. Self-compatible peach (Prunus persica) has mutant versions of the S haplotypes found in self-incompatible Prunus species. Plant Molecular Biology (2007) 63:109–123.[CrossRef][Web of Science][Medline]
Tsukamoto T, Ando T, Watanabe H, Marchesi E, Kao T-h. Duplication of the S-locus F-box gene is associated with breakdown of pollen function in an S-haplotype identified in a natural population of self-incompatible Petunia axillaries. Plant Molecular Biology (2005) 57:141–153.[CrossRef][Web of Science][Medline]
Tsukamoto T, Hauck NR, Tao R, Jiang N, Iezzoni AF. Molecular characterization of three non-functional S-haplotypes in sour cherry (Prunus cerasus). Plant Molecular Biology (2006) 62:371–383.[CrossRef][Web of Science][Medline]
Ushijima K, Yamane H, Watari A, Kakehi E, Ikeda K, Hauck NR, Iezzoni AF, Tao R. The S haplotype-specific F-box protein gene, SFB, is defective in self-compatible haplotypes of Prunus avium and P. mume. The Plant Journal (2004) 39:573–586.[CrossRef][Web of Science][Medline]
Vaughan SP, Russell K. Characterization of novel microsatellites and development of multiplex PCR for large-scale population studies in wild cherry, Prunus avium. Molecular Ecology Notes (2004) 4:429–431.[CrossRef][Web of Science]
Vaughan SP, Russell K, Sargent DJ, Tobutt KR. Characterisation of pollen S alleles in Prunus avium and their application in a novel method suitable for large-scale population studies of self-incompatibility in Prunus species. Theoretical and Applied Genetics (2006) 112:856–866.[CrossRef][Web of Science][Medline]
Vilanova S, Badenes ML, Burgos L, Martinez-Calvo J, Llacer G, Romero C. Self-compatibility of two Prunus armeniaca selections is associated with two pollen-part mutations of different nature. Plant Physiology (2006) 142:629–641.
Wiersma PA, Whu L, Zhou C, Hampson C, Kappel F. Identification of self-compatibility alleles in sweet cherry (Prunus avium L.) and clarification of incompatibility groups by PCR and sequencing analysis. Theoretical and Applied Genetics (2001) 102:700–708.[CrossRef][Web of Science]
Williams W, Brown AG. Breeding new varieties of fruit trees. Endeavour (1960) 19:147–155.[CrossRef]
Wünsch A, Hormaza JI. S-allele identification by PCR analysis in sweet cherry cultivars. Plant Breeding (2004a) 123:327–331.[CrossRef][Web of Science]
Wünsch A, Hormaza JI. Genetic and molecular analysis in Cristobalina sweet cherry, a spontaneous self-compatible mutant. Sexual Plant Reproduction (2004b) 17:203–210.[CrossRef][Web of Science]
Yamane H, Ikeda K, Ushijima K, Sassa H, Tao R. A pollen-expressed gene for a novel protein with an F-box motif that is very tightly linked to a gene for S-RNase in two species of cherry, Prunus cerasus and P. avium. Plant and Cell Physiology (2003) 44:764–769.
Yamane H, Ushijima K, Tao R, Ikeda K, Iezzoni AF, Hauck NR, Watari A. Molecular markers for the self-compatible S4'-haplotype, a pollen-part mutant in sweet cherry (Prunus avium L.). Journal of the American Society for Horticultural Science (2004) 129:724–728.
Zhu M, Zhang X, Zhang K, Jiang L, Zhang L. Development of a simple molecular marker specific for detecting the self-compatible S4 haplotype in sweet cherry (Prunus avium L.). Plant Molecular Biology Reporter (2004) 22:387–398.[Web of Science]
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
) or inconsistency (X) with the hypothesis of Kronio having a pistil part ° or pollen part ' mutation or a duplicate allele (e)

