Skip Navigation

Journal of Experimental Botany 2007 58(15-16):4373-4386; doi:10.1093/jxb/erm304
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Latijnhouwers, M.
Right arrow Articles by Carvalho, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Latijnhouwers, M.
Right arrow Articles by Carvalho, C. M.
Agricola
Right arrow Articles by Latijnhouwers, M.
Right arrow Articles by Carvalho, C. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2008]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

RESEARCH PAPER

Localization and domain characterization of Arabidopsis golgin candidates

Maita Latijnhouwers1 *, Trudi Gillespie1 {dagger}, Petra Boevink1, Verena Kriechbaumer2 {ddagger}, Chris Hawes2,§ and Claudine M. Carvalho2 

1Plant Pathology Programme, Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK
2School of Life Sciences, Oxford Brookes University, Headington, Oxford OX3 BP, UK

§ To whom correspondence should be addressed: chawes{at}brookes.ac.uk

Received 20 September 2007; Revised 30 October 2007 Accepted 31 October 2007


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Golgins are large coiled-coil proteins that play a role in tethering of vesicles to Golgi membranes and in maintaining the overall structure of the Golgi apparatus. Six Arabidopsis proteins with the structural characteristics of golgins were isolated and shown to locate to Golgi stacks when fused to GFP. Two of these golgin candidates (GC1 and GC2) possess C-terminal transmembrane (TM) domains with similarity to the TM domain of human golgin-84. The C-termini of two others (GC3/GDAP1 and GC4) contain conserved GRAB and GA1 domains that are also found in yeast Rud3p and human GMAP210. GC5 shares similarity with yeast Sgm1p and human TMF and GC6 with yeast Uso1p and human p115. When fused to GFP, the C-terminal domains of AtCASP and GC1 to GC6 localized to the Golgi, showing that they contain Golgi localization motifs. The N-termini, on the other hand, label the cytosol or nucleus. Immuno-gold labelling and co-expression with the cis Golgi Q-SNARE Memb11 resulted in a more detailed picture of the sub-Golgi location of some of these putative golgins. Using two independent assays it is further demonstrated that the interaction between GC5, the TMF homologue, and the Rab6 homologues is conserved in plants.

Key words: Arabidopsis, AtGRIP, AtCASP, GDAP1, Golgi, golgin, Rab


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
The Golgi apparatus in eukaryotic cells processes and sorts proteins, carbohydrates, and lipids. It consists of stacks of membrane-bounded cisternae that receive cargo from the endoplasmic reticulum (ER). In general, the material enters the stack on the cis side and moves through the stack to the trans side. The mode of transport within the stack is still a matter of debate and various models have been put forward to describe it (reviewed in Mironov et al., 2005). Processed cargo eventually enters the trans-Golgi and/or the trans-Golgi network (TGN), a network of tubules on the trans-side of the Golgi apparatus, where it is packaged into vesicles and delivered to the correct destination.

The Golgi apparatus in plants and animals have much in common, although a number of striking differences can be distinguished; whereas in mammals the Golgi stacks are generally arranged side-by-side in a perinuclear ribbon, the plant Golgi apparatus consists of numerous individual, motile stacks dispersed throughout the cytoplasm. In many cell types, the plant Golgi stacks move in close proximity to the ER network and their motility is dependent on actin (Boevink et al., 1998; Brandizzi et al., 2002; Saint-Jore et al., 2002).

The factors that determine the Golgi structure and the cohesiveness of the cisternae in plants are largely unknown. The structural organization of the mammalian Golgi apparatus, on the other hand, has received considerable attention in recent years. The so-called golgins have emerged as a family of proteins with a distinct role in maintaining Golgi structure. They form part of a Golgi matrix that remains after detergent extraction, a structure referred to as the Golgi ‘skeleton’ (Seemann et al., 2000). Golgins are large proteins with extensive coiled-coil domains, predicted to adopt long, rod-like conformations (reviewed in Gillingham and Munro, 2003; Short et al., 2005). Depletion of the golgins GM130, p115 or golgin-84 by RNAi resulted in Golgi fragmentation into mini stacks in mammalian cells (Diao et al., 2003; Sohda et al., 2005; Puthenveedu et al., 2006), showing that golgins are important for maintaining Golgi structure. How these proteins control Golgi organization remains largely undetermined and much about the functions of these proteins remains unknown. However, it is clear that they play a role in vesicle tethering. In vitro vesicle docking assays have revealed the need for p115, GM130, and Giantin for coat protein complex I (COPI) vesicle binding to Golgi membranes (Sonnichsen et al., 1998). Furthermore, golgin-84 and CASP were recently reported to be involved in tethering to Golgi cisternae of a subpopulation of COPI vesicles presumed to be involved in retrograde transport to the ER (Malsam et al., 2005).

A small group of golgins are integral membrane proteins, inserted into the membrane by means of a C-terminal transmembrane (TM) domain. The majority of golgins, however, are peripheral membrane proteins, sometimes recruited to the correct membrane through interaction with members of the Rab, ADP-ribosylation factor (ARF) or ARF-like (ARL) families of small GTPases. A C-terminal domain called GRIP, which is present in four human and one yeast golgin, interacts with GTP-bound ARL1 and is necessary for Golgi localization of these golgins (Panic et al., 2003; Setty et al., 2003). Most GRIP domain golgins locate to the trans-Golgi or the TGN. A second Golgi-targeting domain, distantly related to the GRIP domain, is present in the yeast golgin Rud3p. It binds ARF1 and is named GRIP-related ARF-binding (GRAB) domain. The GRAB domain is also found in the mammalian golgin GMAP210 (Gillingham et al., 2004). The most C-terminal coiled-coil domain of the human golgin TMF (TATA element modulatory factor) was shown to bind the three known human isoforms of Rab6 but not Rab1 (Fridmann-Sirkis et al., 2004). The yeast homologue of TMF, Sgm1p, also binds to the Rab6 homologue, YPT6 (Siniossoglou and Pelham, 2001). Two mammalian golgins, GM130 and Golgin-45, need proteins called Golgi reassembly stacking proteins (GRASPs) for association with membranes, which themselves are indispensable for Golgi structure (Shorter et al., 1999; Wang et al., 2003).

The first plant golgin, AtGRIP, was identified based on the presence of a C-terminal GRIP domain (Gilson et al., 2004). An AtGRIP–GFP fusion protein locates to Golgi stacks in tobacco epidermal cells and the GRIP domain interacts with an Arabidopsis ARL1 homologue (Latijnhouwers et al., 2005a; Stefano et al., 2006). Furthermore, an Arabidopsis protein with homology to the mammalian golgin CASP was identified and named AtCASP. It was shown to target GFP to Golgi stacks in both tobacco and monkey cells (Renna et al., 2005). Recently, a protein with a domain showing similarity to the GRAB domain was isolated and named GDAP1 (Matheson et al., 2007). GDAP1 was shown locate to Golgi stacks and additional ARF1-labelled structures, and to interact with Arabidopsis ARF1. AtGRIP, AtCASP, and GDAP1 are putative plant golgins, based on their domain structures and their Golgi localization. A number of additional Arabidopsis proteins have previously been referred to as potential golgins based on sequence similarity with mammalian or yeast golgins (Gillingham et al., 2002, 2004; Fridmann-Sirkis et al., 2004; Latijnhouwers et al., 2005b). Moreover, Rose et al. (2004) observed that the domain organizations of three Arabidopsis coiled-coil proteins (including AtCASP) were comparable to those of the mammalian golgins CASP and golgin-84.

In this report, the localization and domain characterization of six putative Arabidopsis golgins are described. The GFP fusions of all of these proteins co-localize with fluorescent Golgi markers and five are detected as fluorescent rings around the Golgi stacks. Two of these proteins possess C-terminal TM domains and share similarity with the mammalian protein golgin-84, whereas two others (one of which is GDAP1) are characterized by C-terminal GRAB domains. The remaining two proteins share regions of significant similarity with the mammalian golgins TMF and p115, respectively. It is demonstrated for all six of these putative golgins that the Golgi targeting domains are C-terminal. Using immuno-gold labelling, a first indication for the spatial distribution in the Golgi stack of three of the Arabidopsis golgins has been obtained. Finally, yeast two-hybrid experiments and an in vitro binding assay show that two Arabidopsis Rab6 homologues interact with the C-terminus of GC5, the Arabidopsis TMF homologue.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Construction of expression plasmids
Standard molecular techniques were used as described in Ausubel et al. (1999). Primers were obtained from MWG Biotech (Ebersberg, Germany) or from Invitrogen (Paisley, UK). Restriction enzymes were from New England Biolabs (Herts, UK). Expand HiFi polymerase (Roche, Basel, Switzerland) or Phusion high fidelity DNA polymerase (New English biolabs) were used for PCR. All PCR products were sequenced using the Big Dye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City. USA). Full length sequences for GC6, GC1, GC5, GC2, GC4, and GC3 were submitted to GenBank (accession numbers EU249327 [GenBank] to EU249332 [GenBank] ). The BLAST algorithm (http://www.ncbi.nlm.nih.gov/blast/) or (http://www.Arabidopsis.org/Blast/) was used for similarity searches. CLUSTALW (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_clustalw.html; Pole BioInformatique Lyonnais) was used to align Arabidopsis proteins with proteins from other organisms and to obtain similarity or identity values.

Total RNA from an Arabidopsis Col-0 cell suspension culture or from Arabidopsis Col-0 leaves or flower buds was used in a first strand cDNA synthesis reaction (Superscript III, Invitrogen, Paisley, UK) using an oligo dT20 primer. The cDNAs of AtGRIP, AtCASP, and GC1 to GC6 were amplified from this cDNA pool using forward and reverse primers corresponding to the 5' end and the 3' ends of the open reading frames, respectively. The sequence preceding the start codon in the forward primers was AGGCGCGCCAAAA, where the AscI site is underlined. The reverse primer extension following the stop codon was AAAAAAGCGGCCGCGCC, with the NotI sequence underlined. Using the AscI and NotI sites, the cDNAs were cloned into pENTR-1a-MCS (Latijnhouwers et al., 2005a). From pENTR-1a-MCS, the cDNAs were transferred to the binary vectors pMDC83 and pMDC43 (Curtis and Grossniklaus, 2003), using the Gateway cloning system, following instructions provided by the manufacturer (Invitrogen, Paisley, UK). In pMDC83, Gateway recombination sites precede the mGFP5 gene (Haseloff et al., 1997), whereas in pMDC43 they are situated at the 3' of the mGFP5 gene. YFP-Memb11 has been described previously by Chatre et al. (2005). To construct GFP-cGC1, GFP-cGC2, GFP-GRAB3, GFP-GRAB4, GFP-cGC5, and GFP-cGC6, C-terminal fragments were amplified from the respective cDNAs using the forward primers TCACGCCAGGAGCATACAG (cGC1), ACTGAAGTGGAAATTGAAC (cGC2), ATGACAAGGCTCAATAGAAT (GRAB3), ATGACAAGGCTCAATAGAAT (GRAB4), CAAGCTTCTCTTGATTCTTCAG (cGC5) and TATAGTCGGCCAAAAAGTG (cGC6), respectively, the primer sequences were again preceded by AGGCGCGCCAAAA, in combination with the reverse primers previously used to amplify the full-length cDNAs. The C-terminal fragments were cloned into pENTR-1a-MCS using the Asc1 and Not1 sites and transferred to pMDC43 using the Gateway system.

To create nGC6:EYFP:cGC6, a fragment encoding amino acids 1–389 of GC6 was amplified using the XbaI site-containing forward primer CTCTAGAACTAGTATGGATTTGGCATCC and TGGATCCTGATCTCGGGATGTGGGA, with a BamHI site, as the reverse primer. The second fragment, corresponding to the amino acids 390–925 was amplified using CGGATCCTCTAGAAGATGATGTTCA, containing a BamHI site and the reverse primer TGAGCTCTCAGTCTTCTTCAGA containing a SacI site. The stop codon of EYFP (Clontech, Moutain View, USA) was removed, and the EYFP sequence was inserted into GC6 using newly created BamH1 sites. The resulting fragment was cloned into the binary vector pVKH18-En6 (Batoko et al., 2000) using the XbaI and SacI sites.

RabH1b, RabH1c, RabD1, and RabD2A (Rutherford and Moore, 2002) were amplified with forward primers containing BamH1 sites and reverse primers containing HindIII sites. The PCR fragments of RabH1b, RabH1c, RabD1, and RabD2A were inserted into the BamH1 and HindIII sites of pRP265 (Smith and Johnson, 1988) to create fusion proteins with GST. cGC5 and GRAB3 were inserted into the BamH1 and HindIII sites of pQE-30 (Qiagen, Hilden, Germany) to fuse it with the six-histidine tag. For the yeast two-hybrid assay, cDNAs were amplified using primers containing Sma1 sites. The PCR fragments were digested with SmaI and inserted into pGBKT7 (BD Biosciences Clontech, Moutain View, USA) for fusions to the GAL4 binding domain (GBD) and into pGADT7-Rec for fusions to the GAL4 activation domain (GAD).

Transient expression in plants
Wild-type Nicotiana tabacum plants and N. tabacum line CB137 plants were grown in a greenhouse at 22 °C (day temperature) and 18 °C (night temperature) with a minimum of 16 h light. Each construct was transformed into Agrobacterium tumefaciens GV3101 or AGL1 by electroporation or heat shock. Agrobacterium expression was performed as described previously (Latijnhouwers et al., 2005a). In brief, overnight Agrobacterium cultures strains were centrifuged (6 min; 2600 g) and the pellets resuspended in 5 ml (10 mM MgCl2, 10 mM MES pH 5.6, 150 µM acetosyringone). The bacterial suspension was diluted with the same buffer to adjust the inoculum concentration to the final OD600 value (see figure legends). Infiltrations were performed as described in Batoko et al. (2000). For experiments requiring co-infection of more than one construct, bacterial strains containing the constructs were mixed prior to the leaf infiltration, with the inoculum of each mixed construct adjusted to the required final OD600.

Confocal imaging
Imaging was conducted on a Leica TCS-SP2 AOBS using an HCX APO 63x/0.90w water dipping lens. GFP was imaged using 488 nm excitation and its emission was collected from 500–520 nm or from 500–510 nm if imaged in combination with YFP. For mRFP, excitation at 561 nm was used and emission collected at 600–620 nm. The excitation wavelength for YFP was 514 nm and its emission was recorded at 535–545 nm. GFP and mRFP were imaged simultaneously, whereas GFP and YFP or YFP and mRFP were imaged sequentially using a line by line mode. The optimal pinhole diameter was maintained at all times. Post-acquisition image processing was done using Photoshop 8.0 software (Adobe Systems Incorporated, USA).

High-pressure freezing and immuno-gold labelling
2 mm diameter discs from expressing leaves were taken using a disposable biopsy punch (Stiefel Laboratories Ltd, Wooburn Green, UK), and placed in an aluminium sample holder. Prior to capping the sample holder, the sample was covered with MES buffer Pairs of holders were clamped together and samples were immediately frozen using a BAL-TEC HPM 010 high-pressure freezer.

Freeze-substitution was carried out in a Reichert AFS (Leica, Vienna, Austria) freeze-substitution system. Sample holders were split open under liquid nitrogen and placed into plastic porous specimen pots containing the substitution medium (0.5% uranyl acetate in 100% ethanol) previously frozen in liquid nitrogen. Plastic specimen pots were put into a universal aluminium container onto the surface of the frozen substitution medium and transferred into the Reichert AFS precooled to –160 °C. Sample temperature was increased to –85 °C over 5 h. Freeze-substitution was carried out by slowly warming the samples at 1 °C per hour to –20 °C. Samples were rinsed in cold ethanol and, after careful removal from the sample holders, embedded stepwise in LR White medium resin (Agar Scientific, Stansted, Essex, England) over one week. Polymerization was under UV light for 24 h at –20 °C and for another 24 h at 0 °C.

Ultrathin sections were cut with a RMC Powertome XL ultramicrotome (RMC, Tucson, Arizona, USA) and collected on formvar-coated 300 mesh hexagon copper grids (Agar Scientific, Stansted, Essex, England).

For immunolabelling, sections were incubated by floating the grids on droplets of phosphate buffered saline (PBS) pH 7 containing 50 mM glycine for 15 min to inactivate residual free aldehyde groups. They were then incubated with blocking solution for goat gold conjugates (PBS, pH 7.4, 5% BSA, 0.1% CWFS gelatine, 5% normal serum 10 mM sodium azide) (Aurion, Wageningen, Netherlands) for 1 h, and equilibrated by washing on IGL buffer (PBS pH 7.4; 0.1% BSA-c; 0.1% Tween-20), three times for 5 min. They were then transferred to anti-GFP antiserum (ab290; AbCam, Cambridge, UK), diluted 1:2000 in IGL buffer, for 1 h at room temperature. The diluted antiserum had been pre-absorbed overnight with approximately 1 mg Nicotiana tabacum protein extract (frozen ground leaf tissue washed in acetone) at room temperature. The grids were washed six times for 5 min with IGL buffer and incubated on secondary antibody (goat anti-rabbit IgG antibody conjugated with 15 nm gold, Amersham Biosciences, Buckinghamshire, UK), diluted 1:50 in IGL buffer, for 2 h with gentle agitation. The grids were extensively washed in IGL buffer (3 times 5 min), PBS (3 times 5 min), 0.1 M phosphate buffer (2 times 5 min) and ddH2O (5 times 2 min) and dried. Sections were stained with uranyl acetate followed by lead citrate and examined under a Phillips CM10 transmission electron microscope. The specificity and reliability of the immuno-gold labelling were tested by two negative controls; either, the primary antiserum was omitted to test for unspecific labelling of the goat anti-rabbit IgG antibody–gold conjugate, or sections from untransformed control leaves (i.e. lacking GFP) were used to test the specificity of the primary antiserum.

Yeast 2-hybrid analysis and affinity chromatography
Yeast strain AH109 was sequentially transformed with a pGBKT7 bait vector and a pGADT7-Rec prey vector using a lithium acetate method (Gietz et al., 1995). Colonies were selected on synthetic plates lacking histidine, tryptophan, leucine, and adenine for up to 7 d. Positive yeast transformants were replated on plates containing X-{alpha}-gal (Clontech) to test the expression of the reporter gene MEL1.

For in vitro binding studies, GST fusion proteins were produced in E. coli JM109 cells, bound to glutathione sepharose beads (Sigma Aldrich, Gillingham, UK), purified and loaded with GDP or GTP{gamma}S (Sigma Aldrich) as previously described (Gillingham et al., 2004). Affinity chromatography was carried out as described by Latijnhouwers et al. (2005a). A lysate was prepared of E. coli JM109 expressing a His6-tagged protein. The lysate was incubated with sepharose-bound GST fusion proteins, in the presence of GDP or GTP{gamma}S for 2 h at 4 °C. The interacting proteins were eluted in elution buffer [(20 mM Tris pH 8.0, 1.5 M NaCl, 2 mM EDTA, 5 mM β-mercaptoethanol and 1 mM of the opposite nucleotide (GTP{gamma}S or GDP)].

The eluates were analysed on SDS-PAGE and blotted onto nitrocellulose (Schleicher and Schuell, Dassel, Germany). Western blots were probed with an anti-His6 antibody conjugated with HRP (Sigma Aldrich) in (PBS, 0.1% Tween 20, 5% milk powder) and developed using the ECL detection system (Amersham biosciences, Buckinghamshire, UK).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Six putative Arabidopsis golgins
cDNAs of six large coiled-coil proteins from Arabidopsis were amplified from Arabidopsis cell culture or leaf cDNA and fused to the 3’ end of the mGFP5 gene (Haseloff et al., 1997) in binary vectors. The proteins had previously been noted to share sequence similarity with golgins from mammals and yeast (Gillingham et al., 2002, 2004; Fridmann-Sirkis et al., 2004; Latijnhouwers et al., 2005b), although the regions of significant similarity were mainly confined to specific domains (Table 1). To save confusion, the proteins were arbitrarily named GC1 to GC6 (for Golgin Candidate 1 to 6). One of them, GC3, has recently been named GDAP1 by Matheson et al. (2007). The six GFP fusion proteins were expressed in tobacco CB137 epidermal cells using infiltration of a suspension of Agrobacterium tumefaciens carrying the appropriate construct (agroinfiltration). The tobacco line CB137 stably expresses the signal anchor sequence of a rat sialyl transferase fused to mRFP (ST-mRFP) as a Golgi marker (Fig. 1I; Latijnhouwers et al., 2005a). GFP-fusions of the previously characterized putative Arabidopsis golgins AtGRIP and AtCASP were included for comparison (Renna et al., 2005; Latijnhouwers et al., 2005a).


View this table:
[in this window]
[in a new window]

 
Table 1. Putative Arabidopsis golgins described in the text

 

Figure 1
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. GC1 to GC5 are Golgi-localized large coiled-coil proteins. Confocal images of GFP-AtGRIP, GFP-AtCASP, and GFP-GC1 to GFP-GC6 (shown in green), expressed in tobacco CB137 leaf epidermal cells expressing ST-mRFP (shown in magenta). Agrobacterium suspensions were infiltrated at OD600=0.1. Left images show the signal from the green channel. Right images show mixed green and magenta channels (A) GFP-AtGRIP. (B) GFP-AtCASP. (C) GFP-GC1. (D) GFP-GC2. (E) GFP-GC3/GDAP1. (F) GFP-GC4. (G) GFP-GC5. (H) GFP-GC6. (I) ST-mRFP only. Arrowheads indicate non-Golgi structures in (E) and (F). Scale bar=1 µm.

 
The AtGRIP and AtCASP fusions both co-located with ST-mRFP, as was reported previously (Fig. 1A, B). GC3/GDAP1 had previously been shown to co-locate with another Golgi marker, ERD2 (Boevink et al., 1998; Matheson et al., 2007) and, thus, its co-localization with ST-mRFP confirms the Golgi localization of this protein (Fig. 1E). GC1, 2, 4, 5, and 6 also labelled the same organelles as ST-mRFP, suggesting that they too are Golgi proteins. At higher magnification, GFP-AtCASP, GFP-GC1, and GFP-GC2 were observed as green fluorescent rings around the ST-mRFP-fluorescent bodies (Fig. 1B–D). When these fusion proteins were expressed at high levels, Golgi stacks were sometimes observed to aggregate into large clusters (results not shown). GFP-GC3/GDAP1 and GFP-GC4 displayed similar rings around the Golgi stacks, but were also detected on structures that did not co-locate with ST-mRFP (Fig. 1E, F, arrows). In the case of GC3/GDAP1, these non-Golgi structures have been studied in more detail (Matheson et al., 2007). They were shown to be identical to ARF-GFP-labelled structures that can bud from the Golgi and that can also be stained by the stryryl dye FM4-64, suggesting that it concerns a post-Golgi compartment (Stefano et al., 2006; Xu and Scheres, 2005; Matheson et al., 2007). GFP-GC5 similarly appeared as rings around Golgi stacks, but a relatively high level of GFP fluorescence was also detected in the cytoplasm (Fig. 1G). GFP-GC6 concentrated on one side of the ST-mRFP-labelled Golgi body (Fig. 1H). In the case of GFP-GC6, only a minority of cells showed Golgi labelling, presumably reflecting the sensitivity of location to expression levels. Most cells accumulated the GFP-fusion protein in large structures that appeared to be membrane-bounded, frequently rounded and sometimes elongated in shape (see Supplementary data Fig. S1 at JXB online). It was not possible to assess the nature of these structures and it is speculated that they are either involved in degradation of a surplus of the GFP-GC6 fusion protein or are formed from aggregated Golgi. GFP-GC1 to GFP-GC5 were also expressed in wild-type tobacco leaves in the presence of ST-YFP (transient expression) and the co-labelling patterns were the same as the ones described for ST-mRFP (results not shown).

AtGRIP located to Golgi stacks regardless of whether it was fused to the N-terminus or the C-terminus of GFP (Latijnhouwers et al., 2005a). By contrast, when AtCASP and GC1 to GC5 were fused to the N-terminus of GFP, their labelling patterns were reminiscent of cytoplasmic labelling. In the case of GC3-GFP and GC4-GFP, large aggregates were also observed (results not shown). GFP-GC6 and GC6-GFP showed the same combination of Golgi labelling in some cells and the previously described large structures in others. In addition, EYFP (a GFP derivative with high quantum yield) was inserted between amino acid no. 389 and 390 of GC6 (nGC6:EYFP:cGC6). The nGC6:EYFP:cGC6 fusion protein, again, resulted in the same labelling patterns as GFP-GC6 (Golgi stacks and large unidentified structures). Co-expression of this construct with ST-mRFP also showed a similar distribution of YFP fluorescence on one side of the ST-labelled Golgi stacks (see Supplementary data Fig. S2 at JXB online).

GC1 to GC6 share sequence similarity with mammalian and yeast golgins
Figure 2 is a schematic representation of the domain structures of AtGRIP, AtCASP, and GC1 to GC6. Arabidopsis large coiled-coil domain proteins have been annotated in the Arabicoil database (www.coiled-coil.org/Arabidopsis/; Rose et al., 2004). The positions and sizes of the predicted coiled-coil domains in the golgins were derived from this database and drawn to scale. The sequences of our GC1 and GC5 cDNA clones showed that the splicing patterns giving rise to the corresponding mature mRNAs differed from those reported in The Arabidopsis Information Resource (TAIR) database (www.Arabidopsis.org). In the case of GC1, four splicing events differed between our sequence and the sequence in the database and in GC5 only one was different. The programme Paircoil (http://paircoil2.csail.mit.edu/) was used to predict positions and sizes of the coiled-coil domains in GC1 and GC5.


Figure 2
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Domain distribution in eight putative Arabidopsis golgins. Diagram showing eight putative Arabidopsis golgins with predicted coiled-coil regions and additional domains. Numbers indicate first and last amino acids of the full-length proteins and the first residue of the C-terminal fragments cGC1, cGC2, GRAB3, GRAB4, cGC5, and cGC6, respectively. Additional domains are as indicated in the figure.Figure 2 indicates the site in GC6 where EYFP was inserted.

 
AtGRIP possesses a C-terminal GRIP domain sharing up to 50% identity with GRIP domains from four human golgins (Gilson et al., 2004). AtCASP shows 32% overall amino acid identity to human CASP and has a single C-terminal TM domain (Renna et al., 2005). Two TM prediction programmes, DAS-domain prediction (Cserzo et al., 1997) and TMPRED (Hofmann and Stoffel, 1992), predicted that GC1 and GC2 similarly possess single C-terminal TM domains. These TM domain are 50% and 46% identical, respectively, to the TM domain of human golgin-84, and GC1 and GC2 have the same predicted membrane topology as golgin-84 (Fig. 3A). The alignments of the full-length proteins are presented in Supplementary Fig. S3 at JXB online. GC1 and GC2 share 17% overall identity and 56% similarity. Short regions in the C-termini of GC3/GDAP1 and GC4 are 32% and 30% identical, respectively, to the C-terminal GRAB domain of the human golgin GMAP210 (Fig. 3B). Downstream of the GRAB domain in both GC3 and GC4, a second motif was detected, called the GRAB-associated 1 (GA1) motif. This motif is also conserved in the GRAB domain proteins from other organisms (Gillingham et al., 2004). GC3 and GC4 are 70% identical at the protein level. The most C-terminal predicted coiled-coil domain of GC5 shows sequence similarity to the C-terminus of human TMF (32% amino acid identity in the C-terminal 109 amino acids). This region is also conserved in the yeast golgin Sgm1p and single proteins from Neurospora crassa and Drosophila melanogaster (Fridmann-Sirkis et al., 2004; Fig. 3C). Finally, the N-terminus of GC6 shows 40% amino acid identity with human p115 (Fig. 3D). The N-terminus of p115 is predicted to be a globular domain to an otherwise rod-like structure (Sapperstein et al., 1995). As is the case in both human p115 and yeast Uso1p, this domain is followed by two regions of coiled-coil in GC6. A region similar to the short C-terminal acidic domain found in p115 and Uso1p can also be distinguished in GC6 but it contains fewer acidic amino acids and is, therefore, less distinct (Sapperstein et al., 1995).


Figure 3
View larger version (57K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Alignments of conserved domains from GC1 to GC6 with those of golgins from Homo sapiens, Drosophila melanogaster, Caenorabditis elegans, Neurospora crassa, and Saccharomyces cerevisiae. (A) Alignment of predicted TM domains from GC1 and GC2 with TM domains from golgin-84 (NCBI accession AAD09753) and homologues from D. melanogaster (Q8SZ63) and C. elegans (P90970). (B) Alignment of predicted GRAB and GA1 domains from GC3/GDAP1 and GC4 with corresponding domains from S. cerevisiae Rud3p (NP_014859), H. sapiens GMAP210 (CAA73095), and a homologue from D. melanogaster (FlyBase symbol CG33206-PB). (C) Alignment of C-terminal, predicted coiled-coil domain from GC5 with corresponding domains from H. sapiens TMF (P82094), S. cerevisiae Sgm1p (NP_012668), and homologues from N. crassa (CAB97305), and D. melanogaster (FlyBase (http://flybase.bio.indiana.edu) symbol CG4557-PA). (D) Alignment of N-terminus of GC6 with N-termini from H. sapiens p115 (NP_003706), homologues from D. melanogaster (NP_572417), C. elegans (NP_502593), and S. cerevisiae Uso1p (NP_010225).

 
The C-terminal domains of GC1 to GC6 target GFP to the Golgi
According to Misumi et al. (2001) the predominant Golgi-localization signal in human golgin-84 resides in the C-terminal domain, encompassing the TM domain and approximately 100 amino acids preceding the TM domain. C-terminal domains of GC1 (amino acids 558–715) and GC2 (amino acids 508–668), comprising the TM domains and 100–115 amino acids upstream, were fused to the C-terminus of GFP. The resulting fusion proteins GFP-cGC1 and GFP-cGC2 both co-located with ST-mRFP in CB137 epidermal cells and labelled ring-shaped structures around Golgi bodies. Their labelling patterns were indistinguishable from the corresponding GFP-labelled full-length proteins (Fig. 4A, B), although at high expression levels, GFP-cGC2 accumulated on small, structures of unidentified nature (Fig. 4C). The GC1 and GC2 N-termini (amino acids 1–558 for GC1 and 1–508 for GC2) fused to the C-terminus of GFP resulted in cytoplasmic labelling, as well as labelling of the nucleus in the case of the GC2 N-terminus (see Supplementary data Fig. S4 at JXB online).


Figure 4
View larger version (50K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. The Golgi-targeting signals of GC1 to GC6 are located in the C-termini. Confocal images of the C-termini of GC1 to GC6, fused to GFP (shown in green), expressed in tobacco CB137 epidermal cells expressing ST-mRFP (shown in magenta). Agrobacterium suspensions were infiltrated at OD600=0.1. Left images show the signal from the green channel. Right images show mixed green and magenta channels. (A) GFP-cGC1. (B) GFP-cGC2. (C) GFP-cGC2; high level of expression. (D) GFP-GRAB3. (E) GFP-GRAB4. (F) GFP-cGC5. (G) GFP-cGC6. Arrowheads indicate non-Golgi structures in (D) and (E). Scale bar=1 µm.

 
The GRAB domain-containing C-termini of yeast Rud3p and human GMAP210 provide the Golgi-localization signal for these proteins (Gillingham et al., 2004). To test if the localization signals in GC3/GDAP1 and GC4 also reside in the C-terminus, fusion proteins with GFP were prepared of the C-terminal 161 and 169 amino acids of GC3/GDAP1 and GC4, respectively. The resulting fusion proteins were named GFP-GRAB3 and GFP-GRAB4 and encompass the conserved GRAB and GA1 domains. The fusion proteins were expressed in tobacco CB137 epidermal cells and both labelled ring-like structures that co-located with ST-mRFP (Fig. 4D, E). Additional fluorescent structures were detected that did not co-locate with ST-mRFP, similar to those observed with full-length GFP-GC3/GDAP1 and GFP-GC4. The N-terminal domain of GC3/GDAP (amino acids 1–551) showed cytoplasmic labelling whereas in the case of GC4 (amino acids 1–556), the fluorescence was predominantly found in the nucleus (see Supplementary data Fig. S4 at JXB online). The C-terminal 139 amino acids of GC5 (cGC5), containing the region of similarity with human TMF and yeast Sgm1p, targeted GFP to Golgi stacks and to the cytoplasm, again showing very similar fluorescence to the corresponding full-length protein GFP-GC5 (Fig. 4F). Fluorescence was observed in the cytoplasm and around the nucleus with the N-terminus of GC6 (amino acids 1–817) fused to GFP (see Supplementary data Fig. S4 at JXB online). The C-terminal 225 amino acids of GC6 encompass the region that corresponds to the region in human p115 which binds Rab1 and is responsible for Golgi targeting. This part of GC6 was fused to the C-terminus of GFP and the fusion protein showed the same distribution as full-length GFP-GC6 (Fig. 4G); some cells with clear Golgi labelling and others with large, irregularly-shaped GFP-fluorescent structures.

Sub-Golgi localization of Arabidopsis golgins relative to YFP-Memb11
To characterize further which regions of the Golgi stacks were labelled with the GFP-tagged golgin candidates, the fusion proteins were co-expressed with a fusion protein of the Arabidopsis Q-SNARE Memb11 (Chatre et al., 2005) and YFP. The human and yeast homologues of Memb11 (called Membrin and Bos1, respectively), are cis Golgi SNARE proteins (Hay et al., 1997). It has been shown that overexpression of YFP-Memb11 in tobacco epidermal cells causes ERD2, the Arabidopsis homologue of the H/KDEL receptor (Hay et al., 1997), to redistribute to the ER (Chatre et al., 2005). This effect was not found with other SNARE-XFP fusion proteins. Memb11 is therefore most likely involved in processes related to transport at the ER–Golgi interface or cis Golgi (Chatre et al., 2005). High magnification images of YFP-Memb11 in CB137 plants suggested that its location overlaps with, but does not fully coincide with, ST-mRFP (Fig. 5H). Furthermore, it has previously been shown that it locates to the opposite side of the stack to AtGRIP-GFP in a ST-mRFP/YFP-Memb11/AtGRIP-GFP triple labelled cell (Latijnhouwers et al., 2005a). This led to the suggestion that AtGRIP is a trans-Golgi or TGN protein. When GFP-AtCASP and GFP-GC1 to GFP-GC5 were co-expressed with YFP-Memb11 in tobacco CB137 epidermal cells, triple-labelled Golgi were detected in cells expressing low levels of each of the three fluorescent proteins. YFP-Memb11 was detected precisely in the centre of the rings formed by GFP-AtCASP and GFP-GC1 to GFP-GC5 (Fig. 5A–F). In the case of GFP-AtCASP and GFP-GC1 to GC4, the GFP and YFP signals both located slightly to one side of the area labelled by ST-mRFP (especially clear in the insets to Fig. 5B and D). This localization of AtCASP and GC1 to GC4 relative to Memb11 clearly differs from that of AtGRIP, indicating that they locate to a different part of the Golgi to the GRIP domain protein, most likely the cis Golgi area. Due to the fainter Golgi fluorescence of GFP-GC5 and the higher level of fluorescence in the cytoplasm, its location relative to ST-mRFP was difficult to discern.


Figure 5
View larger version (63K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. GFP fluorescence of AtCASP and GC1 to GC5 surrounds YFP-Memb11 fluorescence. Confocal images of GFP-AtCASP and GFP-GC1 to GFP-GC5 (green), co-expressed with YFP-Memb11 (blue) in tobacco CB137 expressing ST-mRFP (red). Agrobacterium suspensions of GFP-CASP and GFP-GC1 to GFP-GC5 were infiltrated at OD600=0.1. YFP-Memb11 was infiltrated at OD600=0.05. Left images show the signal from the mixed green and blue channels. Right images show mixed green, blue and red channels. (A) GFP-AtCASP+YFP-Memb11. (B) GFP-GC1+YFP-Memb11. (C) GFP-GC2+YFP-Memb11. (D) GFP-GC3/GDAP1+YFP-Memb11. (E) GFP-GC4+YFP-Memb11. (F) GFP-GC5+YFP-Memb11. (G) AtGRIP-GFP+YFP-Memb11 (Latijnhouwers et al., 2005a). (H) YFP-Memb11+ST-mRFP. Scale bar=2 µm; scale bar insets=0.5 µm.

 
AtGRIP, AtCASP, and GC1 are localized by immuno-gold labelling
To study the location of three of the eight putative Arabidopsis golgins in more detail, tobacco leaves expressing AtGRIP-GFP, GFP-CASP, and GFP-GC1 were high-pressure frozen and labelled with an anti-GFP antibody and a gold-conjugated secondary antibody. In the case of AtGRIP, the gold label was predominantly found in trans-Golgi cisternae and on vesicular or tubular structures adjoining the trans-Golgi, presumably the TGN, (see Fig. 6A–D for representative images). In GFP-AtCASP (Fig. 6E, F) and GFP-GC1 (Fig. 6G, H) expressing cells, gold label was mainly detected in the often bulbous margins of the cisternae. No gold label was found associated with Golgi stacks in control leaves.


Figure 6
View larger version (127K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. Immuno-gold labelling shows AtGRIP on the trans Golgi and TGN and AtCASP and GC1 on the cisternal rims. Electron micrographs showing sections of high-pressure frozen tobacco epidermal cells infiltrated expressing AtGRIP-GFP, GFP-AtCASP or GFP-GC1 by agroinfiltration. The sections were incubated with anti-GFP and gold-labelled secondary antibody. (A–D) AtGRIP-GFP; arrows indicate structures that likely correspond to the TGN. (E–F) GFP-AtCASP. (G, H) GFP-GC1. Scale bar=0.3 µm.

 
The C-terminus of GC5 interacts with Rab6 GTPase homologues
The C-terminal domain of the yeast golgin Sgm1p interacts with the yeast Rab6 homologue, Ypt6p, which recruits Sgm1p to Golgi membranes (Siniossoglou and Pelham, 2001). TMF, the human homologue of Sgm1p, binds the three human Rab6 isoforms, but not Rab1 (Fridmann-Sirkis et al., 2004). To investigate whether the interaction between TMF and Rab6 is conserved in Arabidopsis, the C-terminus of GC5 and the two Arabidopsis Rab6 homologues, RabH1b and RabH1c (Bednarek et al., 1994; Rutherford and Moore, 2002), were used in a yeast two-hybrid assay. cGC5 was fused to the Gal4-binding domain (GBD-cGC5) and both Rab6 homologues were fused to the Gal4-activation domain (GAD-RabH1b and GAD-RabH1c, respectively). The test showed a clear interaction between cGC5 and both RabH1b and RabH1c (Fig. 7A). By contrast, GBD-cGC5 did not interact with the Rab1 homologue RabD2a (Batoko et al., 2000), nor did the C-terminus of GC3/GDAP1 (GRAB3) interact with any of the three GAD-Rab proteins. Next, RabH1b and RabH1c were fused to glutathione-S-transferase (GST) and cGC5 to a six histidine tag. GST-RabH1b and GST-RabH1c were immobilized on glutathione agarose and incubated with an Escherichia coli lysate of a strain producing His6-cGC5. The interacting proteins were eluted, separated on SDS-PAGE, and detected using an anti-His6 antibody on western blot. His6-cGC5 showed a strong interaction with both GST-RabH1b and GST-RabH1c and the interactions were equally efficient in the presence of GDP and GTP (Fig. 7B). No binding was detected between His6-cGC5 and GST-fusions of the two Rab1 homologues RabD1 and RabD2A (Fig. 7B). Again, a His6-tagged version of GRAB3 failed to interact with any of the four GST-tagged Rab proteins.


Figure 7
View larger version (75K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7. RabH1b and RabH1c interact with the C-terminus of GC5. (A) Results of yeast two-hybrid analysis. Yeast cells were first transformed with GBD-cGC5 or GBD-GRAB3 and subsequently with GAD-RabH1b, GAD-RabH1c or GAD-RabD2A and plated on plates lacking tryptophan, leucine and adenine. The presence of two interacting partners allows hydrolysis of X-{alpha}-gal, resulting in a blue reaction product. GBD=GAL4 binding domain. GAD=GAL4 activation domain. (B) Western blot of total lysate of E. coli strains expressing His6-cGC5 or His6-GRAB3 (lys) and of proteins that bound to GST-RabH1b, GST-RabH1c, GST-RabD1, and GST-RabD2A. GST proteins were preloaded with GDP or the non-hydrolysable analogue of GTP, GTP{gamma}S. Bound proteins were eluted in elution buffer with the opposite nucleotide and applied to SDS-PAGE. The Western blot was probed with an anti-His6 antibody. (C) Western blot of total lysates of E. coli strains expressing GST-RabH1b, GST-RabH1c, GST-RabD1 or GST-RabD2a showing that similar quantities of GST fusion protein were immobilized onto GST-sepharose. The western blot was incubated with an anti-GST antibody (Sigma).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
This study is a clear example of how the availability of sequence information for the complete Arabidopsis genome can accelerate the discovery of new genes and proteins. Similarity searches using the BLAST algorithm allowed putative plant homologues to be identified for Golgi-associated structural proteins of the golgin family present in other organisms. The golgins are large proteins that consist predominantly of poorly-conserved coiled-coil regions. Fortunately, many of them possess additional domains that show higher sequence conservation across kingdoms. The first putative Arabidopsis golgin, for example, was identified based on the presence of a conserved GRIP domain (Gilson et al., 2004; Latijnhouwers et al., 2005a). The human genome contains four such GRIP domain golgins, whereas AtGRIP is the only one present in the Arabidopsis genome. The second plant golgin, AtCASP, shows high sequence conservation in its C-terminal TM domain and some overall sequence conservation. In addition to CASP, the human genome includes at least two additional golgins with C-terminal TM domains; giantin and golgin-84 (reviewed in Short et al., 2005). Giantin has so far only been found in mammals and no possible homologues were detected in Arabidopsis. By contrast, BLAST searches revealed two different Arabidopsis proteins possessing TM domains with significant similarity to the golgin-84 TM domain. In the absence of evidence for them being functional golgin-84 homologues, the choice was made to name them golgin candidates (GC1 and GC2). Although both have orthologues in the rice genome, the GC1 orthologue has been inactivated by means of a retrotransposon insertion into the gene (Latijnhouwers et al., 2005b). As is the case with golgin-84, the GRAB domain golgins Rud3p and GMAP210, occurring as single proteins in yeast and humans, respectively, have two putative homologues in Arabidopsis. One of these was recently shown to target GFP to the Golgi and to interact with ARF1-GFP (Matheson et al., 2007). This protein was named GRIP-related ARF1-binding domain-containing Arabidopsis protein 1 (GDAP1). GC3/GDAP1 and GC4 share 70% similarity and they may exist as a result of a gene duplication event (Latijnhouwers et al., 2005b). TMF and p115 (yeast orthologues of Sgm1p and Uso1p, respectively) both exist as single proteins and similarity searches only identified single proteins for each of them in the Arabidopsis genome. It is likely that the current group of eight putative Arabidopsis golgins is still incomplete. In fact, Patel et al. (2005) identified a novel Golgi-associated coiled-coil protein in tomato and tobacco called WAP1, which interacts with WPP domain-containing proteins and which may be a plant-specific golgin. The human genome harbours a large group of additional golgins, among which GM130, Bicaudal, and Golgin-45 are either absent in Arabidopsis or very poorly conserved and therefore not detected by conventional similarity-searching algorithms. These differences may reflect and become important in understanding the differences in the mammalian and plant Golgi apparatus.

The golgin AtGRIP had previously been proposed to locate to the trans-Golgi or TGN based on the observation that AtGRIP-GFP located to the opposite side of a ST-mRFP-labelled Golgi stack to the cis Golgi SNARE YFP-Memb11 (Latijnhouwers et al., 2005a). By contrast, GFP-AtCASP, GFP-GC1, GFP-GC2, GFP-GC3, and GFP-GC4 located to the same side of the Golgi as YFP-Memb11, suggesting that they are cis or medial Golgi proteins. It was decided to perform immuno-gold labelling of AtGRIP-GFP overexpressing tobacco leaves using an anti-GFP antibody to get a better, though not yet fully decisive, idea of its distribution. This resulted in the preferential labelling of the trans-Golgi reinforcing the idea that AtGRIP, like GRIP domain proteins in mammals and yeast, is a trans-Golgi or TGN golgin. Immuno-gold labelling of GFP-AtCASP and GFP-GC1 using the anti-GFP antiserum showed preferential labelling in the bulbous outer rims of cisternae. This pattern may explain why they are detected as rings when imaged under the confocal microscope. However, from these images it could not be assessed with certainty whether there was preferential labelling of cis or medial cisternae. Because GFP-GC2, GFP-GC3, and GFP-GC4 are also detected as ring structures, with YFP-Memb11 located in the centre of the rings, it is predicted that they too are located to cisternal rims.

The human TMF is a trans-Golgi protein and human p115 locates to the cis Golgi. Whether or not the putative Arabidopsis TMF and p115 homologues, GC5 and GC6, respectively, are in the same sub-Golgi compartment to their mammalian counterparts is the subject of our current investigations. In mammals, p115 binds the golgins giantin and GM130 to form a complex that may tether COPII or COPI vesicles to the Golgi (Sztul and Lupashin, 2006). Since both giantin and GM130 seem to be absent in Arabidopsis, identifying the function of GC6 and its interaction partners is extremely important for elucidating plant Golgi tethering processes. In many cells, expression of the GC6 constructs resulted in the formation of large aggregates. Whether these are protein aggregates due to overexpression of the construct or represent clumped Golgi due to the tethering nature of GC6 has still to be ascertained.

Small GTPases play key roles in all aspects of vesicle trafficking. The yeast two-hybrid and the in vitro binding assays detected a clear interaction between the C-terminus of GC5 and RabH1b and RabH1c. The interactions were independent of the nucleotide status of RabH1b and RabH1c, which is in agreement with the results for the interaction between human TMF and the human three Rab6 isoforms (Fridmann-Sirkis et al., 2004). Rab6 in mammalian cells is located to the trans Golgi or TGN. Since the interaction between TMF and Rab6 is conserved in plant cells, it seems likely that GC5 is localized to and involved in protein sorting in the trans Golgi or TGN.

In summary, this study has revealed considerable overlap between plants and other organisms with regard to golgin structure and localization, but has also highlighted several intriguing differences. Considering the major organizational differences between the static Golgi ribbons found in animal cells and the dispersed motile Golgi stacks in plants, there is a high probability that golgins are in part responsible for this structural diversity. Therefore, further characterization of the proteins presented in this paper, including their function in maintenance of the plant Golgi structure, will contribute to a better understanding of the organization of the plant Golgi apparatus.


    Supplementary data
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Supplementary data can be found at JXB online.

Fig. S1 shows the large fluorescent structures frequently observed on expression of GFP-GC6 the p115 homologue.

Fig. S2 demonstrated Golgi labelling with a GC6 construct with GFP inserted between amino acids 389 and 390.

Fig. S3 shows the alignments of the full-length proteins GC1 to GC6 with orthologues from other organisms.

Fig. S4 demonstrates cytoplasmic expression of N-terminal domain fusions of the golgins.


    Acknowledgements
 
We are grateful to Patrick Moreau (University of Bordeaux) for the YFP-Memb11 construct. Dr Mark Curtis and the University of Zürich are acknowledged for the pMDC vectors, Roger Y Tsien for making the mRFP construct available, and Federica Brandizzi for the creation of the ST-mRFP plants. The Scottish Executive Environment and Rural Affairs Department (SEERAD) and the Biotechnology and Biological Sciences Research Council (BBSRC grant P20269 [GenBank] ) are acknowledged for their financial support.


    Footnotes
 
* Present address: Department of Mathematics and Natural Sciences, University of Stavanger, Stavanger, 4036, Norway. Back

{dagger} Present address: IMPACT Confocal Microscope Facility, School of Biomedical Sciences, University of Edinburgh, George Square, Edinburgh EH8 9XD, UK. Back

{ddagger} Present address: Faculty of Health and Wellbeing, Sheffield Hallam University, Howard Street, Sheffield S1 1WB, UK. Back

Present address: Federal University of Viçosa, BIOAGRO, Viçosa – MG, 36571 000, Brazil. Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Supplementary data
 References
 
Ausubel F, Brent R, Kingston RE, Moore JG, Seidman JG, Smith JA, Struhl JG. Current protocols in molecular biology (1999) New York: John Wiley.

Batoko H, Zheng HQ, Hawes C, Moore I. A Rab1 GTPase is required for transport between the endoplasmic reticulum and Golgi apparatus and for normal Golgi movement in plants. The Plant Cell (2000) 12:2201–2218.[Abstract/Free Full Text]

Bednarek SY, Reynolds TL, Schroeder M, Grabowski R, Hengst L, Gallwitz D, Raikhel NV. A small GTP-binding protein from Arabidopsis thaliana functionally complements the yeast Ypt6 null mutant. Plant Physiology (1994) 104:591–596.[Abstract]

Boevink P, Oparka K, Santa Cruz S, Martin B, Betteridge A, Hawes C. Stacks on tracks: the plant Golgi apparatus traffics on an actin/ER network. The Plant Journal (1998) 15:441–447.[CrossRef][Web of Science][Medline]

Brandizzi F, Snapp EL, Roberts AG, Lippincott-Schwartz J, Hawes C. Membrane protein transport between the endoplasmic reticulum and the Golgi in tobacco leaves is energy-dependent but cytoskeleton-independent: evidence from selective photobleaching. The Plant Cell (2002) 14:1293–1309.[Abstract/Free Full Text]

Chatre L, Brandizzi F, Hocquellet A, Hawes C, Moreau P. Sec22 and Memb11 are v-SNAREs of the anterograde endoplasmic reticulum-Golgi pathway in tobacco leaf epidermal cells. Plant Physiology (2005) 139:1244–1254.[Abstract/Free Full Text]

Cserzo M, Wallin E, Simon I, von Heijne G, Elofsson A. Prediction of transmembrane alpha-helices in prokaryotic membrane proteins: the dense alignment surface method. Protein Engineering (1997) 10:673–676.[Abstract/Free Full Text]

Curtis MD, Grossniklaus U. A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiology (2003) 133:462–469.[Abstract/Free Full Text]

Diao A, Rahman D, Pappin DJ, Lucocq J, Lowe M. The coiled-coil membrane protein golgin-84 is a novel rab effector required for Golgi ribbon formation. Journal of Cell Biology (2003) 160:201–212.[Abstract/Free Full Text]

Fridmann-Sirkis Y, Siniossoglou S, Pelham HR. TMF is a golgin that binds Rab6 and influences Golgi morphology. BMC Cell Biology (2004) 5:18.[CrossRef][Medline]

Gietz RD, Schiestl RH, Willems AR, Woods RA. Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast (1995) 11:355–360.[CrossRef][Web of Science][Medline]

Gillingham AK, Munro S. Long coiled-coil proteins and membrane traffic. Biochimica et Biophysica Acta (2003) 1641:71–85.[Medline]

Gillingham AK, Pfeifer AC, Munro S. CASP, the alternatively spliced product of the gene encoding the CCAAT-displacement protein transcription factor, is a Golgi membrane protein related to giantin. Molecular Biology of the Cell (2002) 13:3761–3774.[Abstract/Free Full Text]

Gillingham AK, Tong AH, Boone C, Munro S. The GTPase Arf1p and the ER to Golgi cargo receptor Erv14p cooperate to recruit the golgin Rud3p to the cis-Golgi. Journal of Cell Biology (2004) 167:281–292.[Abstract/Free Full Text]

Gilson PR, Vergara CE, Kjer-Nielsen L, Teasdale RD, Bacic A, Gleeson PA. Identification of a Golgi-localized GRIP domain protein from Arabidopsis thaliana. Planta (2004) 219:1050–1056.[CrossRef][Web of Science][Medline]

Haseloff J, Siemering KR, Prasher DC, Hodge S. Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proceedings of the National Academy of Sciences, USA (1997) 94:2122–2127.[Abstract/Free Full Text]

Hay JC, Chao DS, Kuo CS, Scheller RH. Protein interactions regulating vesicle transport between the endoplasmic reticulum and Golgi apparatus in mammalian cells. Cell (1997) 89:149–158.[CrossRef][Web of Science][Medline]

Hofmann K, Stoffel W. PROFILEGRAPH: an interactive graphical tool for protein sequence analysis. Computer Applied Bioscience (1992) 8:331–337.

Latijnhouwers M, Hawes C, Carvalho C, Oparka K, Gillingham AK, Boevink P. An Arabidopsis GRIP domain protein locates to the trans-Golgi and binds the small GTPase ARL1. The Plant Journal (2005a) 44:459–470.[CrossRef][Web of Science][Medline]

Latijnhouwers M, Hawes C, Carvalho C. Holding it all together? Candidate proteins for the plant Golgi matrix. Current Opinion in Plant Biology (2005b) 8:632–639.[CrossRef][Web of Science][Medline]

Malsam J, Satoh A, Pelletier L, Warren G. Golgin tethers define subpopulations of COPI vesicles. Science (2005) 307:1095–1098.[Abstract/Free Full Text]

Matheson LA, Hanton SL, Rossi M, Latijnhouwers M, Stefano G, Renna L, Brandizzi F. Multiple roles of ADP-ribosylation factor1 in plant cells include spatially regulated recruitment of coatomer and elements of the Golgi matrix. Plant Physiology (2007) 143:1615–1627.[Abstract/Free Full Text]

Mironov AA, Beznoussenko GV, Polishchuk RS, Trucco A. Intra-Golgi transport: A way to a new paradigm? Biochimica et Biophysica Acta. Molecular Cell Research (2005) 1744:340–350.

Misumi Y, Sohda M, Tashiro A, Sato H, Ikehara Y. An essential cytoplasmic domain for the Golgi localization of coiled-coil proteins with a COOH-terminal membrane anchor. Journal of Biological Chemistry (2001) 276:6867–6873.[Abstract/Free Full Text]

Panic B, Whyte JR, Munro S. The ARF-like GTPases Arl1p and Arl3p act in a pathway that interacts with vesicle-tethering factors at the Golgi apparatus. Current Biology (2003) 13:405–410.[CrossRef][Web of Science][Medline]

Patel S, Brkljacic J, Gindullis F, Rose A, Meier I. The plant nuclear envelope protein MAF1 has an additional location at the Golgi and binds to a novel Golgi-associated coiled-coil protein. Planta (2005) 222:1028–1040.[CrossRef][Web of Science][Medline]

Puthenveedu MA, Bachert C, Puri S, Lanni F, Linstedt AD. GM130 and GRASP65-dependent lateral cisternal fusion allows uniform Golgi-enzyme distribution. Nature Cell Biology (2006) 8:238–248.[CrossRef][Web of Science][Medline]

Renna L, Hanton SL, Stefano G, Bortolotti L, Misra V, Brandizzi F. Identification and characterization of AtCASP, a plant transmembrane Golgi matrix protein. Plant Molecular Biology (2005) 58:109–122.[CrossRef][Web of Science][Medline]

Rose A, Manikantan S, Schraegle SJ, Maloy MA, Stahlberg EA, Meier I. Genome-wide identification of Arabidopsis coiled-coil proteins and establishment of the ARABI-COIL database. Plant Physiology (2004) 134:927–939.[Abstract/Free Full Text]

Rutherford S, Moore I. The Arabidopsis Rab GTPase family: another enigma variation. Current Opinion in Plant Biology (2002) 5:518–528.[CrossRef][Web of Science][Medline]

Saint-Jore CM, Evins J, Batoko H, Brandizzi F, Moore I, Hawes C. Redistribution of membrane proteins between the Golgi apparatus and endoplasmic reticulum in plants is reversible and not dependent on cytoskeletal networks. The Plant Journal (2002) 29:661–678.[CrossRef][Web of Science][Medline]

Sapperstein SK, Walter DM, Grosvenor AR, Heuser JE, Waters MG. p115 is a general vesicular transport factor related to the yeast endoplasmic reticulum to Golgi transport factor Uso1p. Proceedings of the National Academy of Sciences, USA (1995) 92:522–526.[Abstract/Free Full Text]

Seemann J, Jokitalo E, Pypaert M, Warren G. Matrix proteins can generate the higher order architecture of the Golgi apparatus. Nature (2000) 407:1022–1026.[CrossRef][Medline]

Setty SR, Shin ME, Yoshino A, Marks MS, Burd CG. Golgi recruitment of GRIP domain proteins by Arf-like GTPase 1 is regulated by Arf-like GTPase 3. Current Biology (2003) 13:401–404.[CrossRef][Web of Science][Medline]

Short B, Haas A, Barr FA. Golgins and GTPases, giving identity and structure to the Golgi apparatus. Biochimica et Biophysica Acta (2005) 1744:383–395.[Medline]

Shorter J, Watson R, Giannakou ME, Clarke M, Warren G, Barr FA. GRASP55, a second mammalian GRASP protein involved in the stacking of Golgi cisternae in a cell-free system. EMBO Journal (1999) 18:4949–4960.[CrossRef][Web of Science][Medline]

Siniossoglou S, Pelham HR. An effector of Ypt6p binds the SNARE Tlg1p and mediates selective fusion of vesicles with late Golgi membranes. EMBO Journal (2001) 20:5991–5998.[CrossRef][Web of Science][Medline]

Smith DB, Johnson KS. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene (1988) 67:31–40.[CrossRef][Web of Science][Medline]

Sohda M, Misumi Y, Yoshimura S, Nakamura N, Fusano T, Sakisaka S, Ogata S, Fujimoto J, Kiyokawa N, Ikehara Y. Depletion of vesicle-tethering factor p115 causes mini-stacked Golgi fragments with delayed protein transport. Biochemical and Biophysical Research Communications (2005) 338:1268–1274.[CrossRef][Web of Science][Medline]

Sonnichsen B, Lowe M, Levine T, Jamsa E, Dirac-Svejstrup B, Warren G. A role for giantin in docking COPI vesicles to Golgi membranes. Journal of Cell Biology (1998) 140:1013–1021.[Abstract/Free Full Text]

Stefano G, Renna L, Hanton SL, Chatre L, Haas TA, Brandizzi F. ARL1 plays a role in the binding of the GRIP domain of a peripheral matrix protein to the Golgi apparatus in plant cells. Plant Molecular Biology (2006) 61:431–449.[CrossRef][Web of Science][Medline]

Sztul E, Lupashin V. Role of tethering factors in secretory membrane traffic. American Journal of Physiology-Cell Physiology (2006) 290:C11–C26.

Xu J, Scheres B. Dissection of Arabidopsis ADP-RYBOSYLATION FACTOR 1 function in epidermal cell polarity. The Plant Cell (2005) 17:525–536.[Abstract/Free Full Text]

Wang YZ, Seemann J, Pypaert M, Shorter J, Warren G. A direct role for GRASP65 as a mitotically regulated Golgi stacking factor. EMBO Journal (2003) 22:3279–3290.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Exp BotHome page
J. N. Johansen, C.-M. Chow, I. Moore, and C. Hawes
AtRAB-H1b and AtRAB-H1c GTPases, homologues of the yeast Ypt6, target reporter proteins to the Golgi when expressed in Nicotiana tabacum and Arabidopsis thaliana
J. Exp. Bot., May 26, 2009; (2009) erp153v2.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Latijnhouwers, M.
Right arrow Articles by Carvalho, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Latijnhouwers, M.
Right arrow Articles by Carvalho, C. M.
Agricola
Right arrow Articles by Latijnhouwers, M.
Right arrow Articles by Carvalho, C. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?