RESEARCH PAPER |
Maize floral regulator protein INDETERMINATE1 is localized to developing leaves and is not altered by light or the sink/source transition

Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada N1G 2W1
To whom correspondence should be addressed. E-mail: jcolasan{at}uoguelph.ca
Received 17 August 2006; Revised 15 September 2006 Accepted 19 September 2006
| Abstract |
|---|
|
|
|---|
The INDETERMINATE1 gene, ID1, encodes a putative transcription factor that plays an important role in regulating the transition to flowering in maize. Mutant id1 plants have a prolonged vegetative growth phase and fail to make normal flowers. The ID1 gene, which encodes a nuclear-localized zinc finger protein, is expressed exclusively in immature leaves, suggesting that ID1 regulates a leaf-derived floral inductive signal. It is shown by western analysis with anti-ID1-specific antibody that ID1 co-localizes with ID1 mRNA in developing, immature leaves and, similarly, is absent in mature, photosynthetically active leaf blades, as well as the shoot apical meristem. Immunolocalization with anti-ID1 antibody shows that ID1 protein is detected in the nuclei of all cell types in immature leaves. Examination of plants grown in different day/night cycles revealed that ID1 gene expression and protein levels are largely unaffected by variations in light and dark, and that mRNA and protein levels do not follow a circadian pattern. The absence of ID1 expression in greening leaf tips coincides with the sink-to-source transition of developing leaves. It was found that ID1 levels are down-regulated in mature albino leaves similarly as in normal green leaves, suggesting that ID1 activity is controlled developmentally and is not affected by the sink/source status of the leaf or the inability of a mature leaf to engage in photosynthesis. The finding that ID1 expression is developmentally regulated and is unperturbed by external stimuli such as photoperiod supports the supposition that ID1 acts through the autonomous floral inductive pathway in maize.
Key words: Circadian cycle, floral regulator, long-distance signalling, maize, sink/source, transcription factor, zinc finger protein
| Introduction |
|---|
|
|
|---|
The switch from vegetative to reproductive growth marks an important change in the developmental programme of higher plants. This transition is manifested at the shoot apical meristem (SAM), a population of undifferentiated cells from which all vegetative and floral organs of the plant are derived. The floral transition represents a progression of meristem identity, i.e. from a leaf-producing vegetative meristem to a flower-producing reproductive meristem (McSteen et al., 2000). Molecular mechanisms underlying the floral inductive process have been discerned largely through analysis of flowering-time mutants in the model plant Arabidopsis (Simpson and Dean, 2002). Overall, genetic models and physiological studies have established that at least two major pathways operate to control flowering in higher plants, i.e. a pathway that integrates environmental signals, such as photoperiod, and an autonomous pathway that mediates signals based on endogenous cues, such as plant age or leaf number. For both pathways, inductive signals have been shown to originate in leaves and travel long distances through the phloem to the SAM to initiate flowering (reviewed in Bernier and Perilleux, 2005).
INDETERMINATE1 (ID1) is the only gene identified so far that has a key role in controlling the transition to reproductive growth in maize. Plants homozygous for the loss-of-function id1 mutation remain in a prolonged vegetative state and exhibit a delayed transition to flowering, occasionally forming inflorescences with vegetative characteristics (Colasanti et al., 1998). Expression analysis shows that ID1 mRNA is confined to immature leaf tissue and is not detected in the SAM. This suggests that ID1 may regulate a long-distance, leaf-derived florigenic signal (Colasanti and Sundaresan, 2000). The ID1 gene encodes a protein that is the founding member of a plant-specific zinc finger protein family (Colasanti et al., 2006). Members of this family contain four zinc fingers that make up the signature ID-domain (IDD) (Kozaki et al., 2004). Biochemical analysis of ID1 and other IDD proteins shows that two of the four zinc finger motifs have unique DNA-binding properties (Kozaki et al., 2004), suggesting that ID1 is a transcriptional regulator that controls the transition to flowering in maize.
Localization of the ID1 transcript to developing leaves suggests that the protein encoded by ID1 may either regulate the production or the transmission of the floral inductive signal. Alternatively, the ID1 protein itself may move through the phloem to the shoot apex to cause flowering. Although this latter scenario is less likely, recent reports of the intercellular movement of transcription factors suggests that this is a possibility (Kurata et al., 2005). Directly relevant to the identification of the floral stimulus, recent findings have revealed that the mRNA of the Arabidopsis flowering-time gene, FLOWERING LOCUS T (FT) may induce flowering by moving from its site of synthesis in the leaves to act at the shoot apex (Huang et al., 2005). Movement of the FT protein from leaf to apex via the phloem has also been proposed (Bernier and Perilleux, 2005; Corbesier and Coupland, 2005; Wigge et al., 2005). The induction of FT expression in the leaf vasculature is mediated directly by the transcriptional regulator CONSTANS (CO). CO activity is controlled by signals from the circadian clock that denote long-day photoperiods that are inductive for flowering in Arabidopsis (Hayama and Coupland, 2003). At present it is unclear whether an analogous system of floral regulation operates in all plants (Colasanti, 2005). Some components of the CO/FT system are in place in rice, but the functional extent of this similarity is not known at present.
Many components are believed to feed into pathways that activate the leaf floral stimulus. Past research has suggested possible connections between flowering time and the sink-to-source transition. Sachs and Hackett (1983) first postulated that diversion of sucrose to the SAM might be an important component of the floral stimulus. Studies of the long-day plant Sinapis alba have found that an increase in shoot apex sucrose content is correlated with the exposure to a florally inductive long day (Bodson, 1977; Bodson and Outlaw, 1985). This increase in sucrose in long days is reported to be delivered to the apex of S. alba from photosynthetic leaves, based on the measurements of phloem exudates in the stem below the apex (Lejeune et al., 1993). Therefore an increase in assimilate/sugar supply to the shoot apex might be important for floral induction. Virtually nothing is known about the molecular mechanisms that link physiological changes, such as the sink-to-source transition, and the transition to flowering. The down-regulation of ID1 transcription in leaf blade tips coincides with the sink-to-source transition, therefore suggesting a possible connection between assimilate partitioning and flowering.
In this study, an anti-ID1-specific antibody is used to follow ID1 protein distribution within a developing maize plant and to compare the localization profile of ID1 protein with ID1 mRNA during development. Immunolocalization showed that ID1 protein is associated with all cell types in developing maize leaves, and not to any particular structure. Also northern and western analyses were used to ascertain whether ID1 protein accumulation is controlled at the transcriptional or post-translational levels under different light and dark conditions, as was found for the Arabidopsis CO protein (Valverde et al., 2004). Finally, ID1 transcript and ID1 protein levels were analysed in normal plants and albino mutants to determine whether there is a possible link between ID1 activity and the sink-to-source transition in leaves.
| Materials and methods |
|---|
|
|
|---|
Plant materials and growth conditions
Plants [normal (wild-type) B73 inbred plants and id1-m1 mutants backcrossed 10 times into a B73 background] were grown in Promix soil in growth chambers at 27 °C in the light and 23 °C in dark conditions. For daynight entrainment, B73 inbreds were kept in growth chambers for 3 weeks under a 14 h day/10 h night cycle and tissue samples collected every 4 h for up to 2 d. Three plants were collected at each time point and used for individual experiments. Seeds segregating lemon white (lw1) albino mutants and normal green siblings were germinated in Magenta boxes with MS media [4.4 g l1 Murashige and Skoog basal medium (Sigma), with or without sucrose, pH 5.7, 5.0 g agar]. Mature and immature leaf tissues were collected for RNA and nuclear protein extraction.
Genotyping of normal and id1 mutant maize plants
For genotyping plants segregating the id1-m1 mutant allele, genomic DNA was isolated from individual plants as described previously (Colasanti et al., 1998). Mutant and wild-type plants were identified by PCR with oligonucleotide primers specific for the ID1 gene (IdF: GAGCTCTGGGGGACTTGACTG and IdR: GGTTGCTTCAGAATCACCCACTGTTC) and for the Ds transposon responsible for the id1-m1 mutation (DsR: GCTTTCTTGCATGGGATGGGCCTC) used under the following amplification conditions: 94 °C/2 min, followed by 40 cycles of 94 °C/45 s, 62 °C/1 min, 72 °C/2.5 min.
Onion epidermal cell bombardment
A GUS:ID1 fusion construct was made by cloning the 1.46 kbp BamHI/XhoI fragment of the ID1 cDNA into BglII/SalI-cut plasmid pTEX3, a derivative of pRTL2-GUS. This puts all but the first 18 amino acids of the ID1 coding region in frame with the coding region of the ß-glucuronidase (GUS) gene. Epidermal layers of white onion (Allium cepa) were placed onto 1% water agar plates and bombarded with 1020 µg of purified recombinant plasmid precipitated onto gold particles (Bio-Rad, Hercules, CA, USA) at 70 kg cm2 with a PDS-100 helium biolistic particle delivery system (Bio-Rad). Bombarded tissue layers were incubated overnight at room temperature with 1 mg ml1 X-gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronide) in 100 mM sodium phosphate/0.1% Triton X-100 solution, pH 7.0. To stain nuclei, bombarded layers were incubated with 75 µg ml1 DAPI (4',6-diamidino-2-phenylindole) for 30 min and visualized under UV light.
RNA extraction and northern analysis
Total RNA and mRNA were extracted from maize tissues as described previously. For all northern blots, 1.0 µg of poly (A)+ mRNA was electrophoresed on 1.1% agarose gels in formaldehyde buffer and probed with various gene-specific probes as described (Colasanti et al., 1998).
Nuclear protein extraction and western analysis
Extracts of maize tissues enriched for nuclear proteins were prepared by a modification of the technique described by Steinmuller and Apel (1986) as described previously (Colasanti et al., 2006). The amount of protein in each sample was measured with a protein assay kit (Bio-Rad) and also run on 11% polyacrylamide gels stained with Coomassie blue.
Equal amounts (from 50 to 100 µg) of nuclear-enriched protein extracts or cytoplasmic fraction were suspended in Laemmli loading buffer (80 mM TRIS-HCl, pH 6.8, 2% SDS, 10% glycerol, 10% ß-mercaptoethanol, 0.02% bromophenol blue), heated at 95 °C for 5 min, and loaded onto duplicate 11% SDSpolyacrylamide gels. Proteins of one gel were transferred to PVDF (polyvinylidene fluoride) membrane (Bio-Rad) in Towbin buffer (25 mM TRIS base/glycine/10% methanol) with a Panther semi-dry electroblotter (Owl Scientific). The other gel was stained with Coomassie blue and destained in 7% acetic acid/25% ethanol (v/v). For each experiment, western blot and Coomassie blue gels were repeated a minimum of three times. For western blots, membranes were blocked in PBS-T buffer (phosphate buffered saline, pH 7.5, in 0.1% Tween-20) with 5% non-fat milk powder for 1 h at room temperature. Membranes were incubated with primary antibodies (1:1000 dilution for anti-ID1, 1:200 dilution for anti-KN1, 1:2000 for anti-CDC2) in PBS-T for 2 h at room temperature followed by horseradish peroxidase-conjugated goat anti-rabbit antibody at 1:10 000 dilution (Amersham Biosciences) for 2 h. Blots were washed in PBS-T and visualized by chemiluminescence using SuperSignal West Pico chemiluminescent substrate (Pierce) according to the manufacturer's instructions, and exposed to XAR5 film (Kodak-Scientific Imaging).
Sectioning and immunolocalization of wax-embedded tissues
Sections of immature leaves from a region 56 cm above the shoot apex (i.e. corresponding to region C in Fig. 2) and sections through the shoot meristem were dissected from V7-stage wild-type B73 and id1-m1/id1-m1 mutant plants and incubated in fixation buffer (3% paraformaldehyde in 50 mM PIPES, pH 7.0) under vacuum at 4 °C overnight immediately after collection. Tissues were washed three times with 50 mM PIPES (pH 7.0) for 10 min at room temperature and dehydrated through an ethanol series at room temperature for 1 h each followed by ethanol/tertiary-butyl alcohol (EtOH/TBA) infiltration at 4 °C and then 90%, 95%, and 100% EtOH sequentially for 1 h each, fresh 100% EtOH for 2 h and 1:1 100% EtOH/TBA for 2 h, then 1:3 100% EtOH/TBA overnight. Infiltration was continued next day, twice with 100% TBA for 2 h, followed by 1:1 TBA/paraffin oil for 2 h, and TBA in paraplast plus (Fisher Scientific) for 3 d at 60 °C. Lastly, 100% paraplast was used for infiltration and tissues were embedded into a mould with fresh paraplast. Trimmed tissues were cut into 10 µm sections with a Leica RM 2265 microtome and mounted onto charged slides (Probe-On Plus, Fisher Scientific).
|
For immunolocalization, immature leaf section slides were de-waxed by CitriSolv (Fisher Scientific) and subjected to an ethanol/water series of 100% to 20%. After immersion in PBS for 15 min, slides were blotted dry and incubated with proteinase K solution (Dakocytomation, Carpenteria, CA, USA) for 3 min and rinsed with PBS, followed by blocking solution (PBS+10 mg ml1 BSA). Treated slides were incubated in blocking solution for 2 h and rinsed three times in blocking solution for 10 min each, followed by incubation in alkaline phosphatase-linked anti-rabbit secondary antibody (Dakocytomation) diluted 1:2000 in blocking solution for 2 h in the dark. After rinsing in blocking solution, NBT+BCIP substrate (Dakocytomation) was applied to slides for 3 min in the dark for staining and washed three times with deionized water. Immunolabelled slides were dehydrated in an ethanol series and then CitriSolv and then mounted under glass coverslips sealed with nail varnish.
Sectioning and immunolocalization of LR white resin-embedded tissues
Sections of immature leaves were fixed as described above for wax embedding. After dehydration, tissues were infiltrated overnight in a series of ethanol/LR white resin (London Resin Company, UK) for 1 h each with increasing concentrations of resin; 2:1 100% ethanol/LR white resin, 1:1, 1:2, and finally 100% LR white resin. Next day infiltration was continued with 100% LR white resin for 3 d, and tissues were polymerized with fresh LR white resin at 60 °C for 2 h until hardened, put on wooden blocks, and sectioned into 3 µm sections by microtome and mounted on ProbeOn Plus slides.
For immunolabelling, slides with tissue sections were incubated in PBS for 5 min, blotted dry, placed in a humid chamber, and incubated with proteinase K solution (Dakocytomation) for 5 min and rinsed three times with PBS, followed by blocking solution (PBS+10 mg ml1 BSA). Slides were then incubated overnight in primary anti-ID1 antibody (1:150) in blocking solution at 4 °C, rinsed in blocking solution, and then incubated in 1:2000 alkaline phosphatase conjugated anti-rabbit secondary antibody (Dakocytomation) for 3 h in the dark at room temperature. After two rinses in blocking solution and then 10 mM TRIS-HCl, NBT+BCIP substrate system (Dakocytomation) was applied to the slides and incubated for 5 min in the dark. After three 3 min washes with deionized water slides were mounted in immersion oil and sealed with coverslips with nail varnish. Images of stained slides were taken with a Retiga 1300R digital camera mounted on a Leica DM LS2 microscope.
| Results |
|---|
|
|
|---|
ID1 protein is localized to nuclei of developing leaves
ID1 mRNA is confined to a specific region of developing leaves that includes a zone 12 cm above the shoot apex and extends to the distal leaf tip, but does not include greening leaf blade tips that have emerged from the whorl (Colasanti et al., 1998). An anti-ID1-specific anti-peptide antibody was used for western analysis to determine the distribution of ID1 protein in the developing maize shoot at different developmental stages. Western blots of samples enriched for nuclear proteins taken from plants at the floral transition stage showed that ID1 protein is concentrated in nuclei and is not detected in cytoplasmic extracts (Fig. 1A). This western analysis shows that, in agreement with previous northern expression analysis, ID1 protein is similarly detected in immature leaf tissue and is absent in mature leaves and the shoot apex. By comparison, the KNOTTED1 transcription factor protein was detected in nuclei of shoot apical region cells and the cell-cycle protein CDC2 (Colasanti et al., 1991) is present in both nuclei and cytoplasm, but at much lower levels in mature leaves, which have fewer actively dividing cells (Fig. 1A). Further evidence that ID1 is a nuclear protein was demonstrated by bombardment of onion epidermal cells with a plasmid containing the ß-glucuronidase (GUS) reporter gene fused in frame with the ID1 coding region, with expression driven by the cauliflower mosaic virus (CaMV) 35S promoter. As shown in Fig. 1B, the GUS:ID1 fusion protein localizes to nuclei and is not detected in cytoplasm of onion epidermal cells.
|
Next, a developmental profile of ID1 protein levels was created for maize plants during the vegetative growth phase, from soon after germination up to the floral transition. Nuclear proteins were extracted from immature and mature leaves of inbred B73 plants starting with plants at 3 d after germination (3 DAG) and at several developmental stages, until all leaves had been initiated (24 DAG) in plants with seven visible leaves (V7). Inbred B73 seedlings with seven visible leaves were dissected and found to be at, or near, the stage of transition to flowering (24 DAG/V7 in Fig. 2), i.e. a full complement of leaves is initiated, signifying the completion of the vegetative stage (Colasanti et al., 1998). Western analysis with anti-ID1 antibody showed that ID1 protein is detected in vegetative shoots as early as 3 DAG in the emerging coleoptile and nascent shoot (Fig. 2). At this early stage it was not possible to discern whether ID1 protein is present in the apical meristem, within the shoot as well as in immature leaves, because of the small size of this structure. At later stages it was possible to dissect the growing plant more finely and to determine relative ID1 protein levels in the shoot. As early as 6 DAG, when two true leaves had emerged, ID1 protein was detected only in a region of the shoot that contained immature leaves, but not in young green leaves (Fig. 2). The specific localization of ID1 protein to immature leaves was retained in V3- and V5-stage seedlings, as well as V7 plants at the floral transition stage (Fig. 2). Further, in these larger plants it was possible to show that ID1 protein is not detected in a 1 cm shoot region that contains the SAM (Ap in Fig. 2). The shoot region above the apex that contains the whorl of immature leaves was dissected into 2 cm sections from V3, V5, and V7 plants. Western analysis showed that ID1 protein levels are highest in the central region of the shoot. That is, in V3 plants the central B section had the greatest amounts of ID1 protein, whereas the 2 cm sections below and above it, A and C, respectively, had lower ID1 levels. This distribution pattern is maintained in V5 and V7 plants in that the central immature leaf sections had the highest levels of ID1 protein (Fig. 2). In all plants tested, ID1 protein was not detected in blades of green leaves that had emerged from the whorl. Therefore, similar to the expression pattern of ID1 mRNA, ID1 protein levels decrease and become undetectable as leaves emerge from the whorl and become photosynthetically active. ID1 protein was not detected in sheaths of mature leaves, roots, and inflorescences (data not shown). Overall, these results show that ID1 protein is present exclusively in immature leaf tissue at all stages of plant growth.
ID1 protein is localized to nuclei of all cell types in developing leaves
Immunolocalization with anti-ID1 antibody was used to determine the cellular location of ID1 protein within developing leaves. Transverse sections of shoots containing immature leaves rolled up inside were taken from B73 plants at or near the floral transition (i.e. with seven to eight visible leaves) in the central region with the highest levels of ID1 protein, approximately 6 cm above the shoot apex. Transverse sections were also taken from the SAM and included surrounding leaf primordia. Immunostaining showed that ID1 protein is localized to the nuclei of all cell types in developing leaves, including mesophyll, bundle sheath, and provascular cells, as well as epidermal cells (Fig. 3A, C). It was not clear whether ID1 protein levels are higher in any particular cell type, although immunolocalization of thinner leaf sections of LR white resin-embedded tissues suggest that ID1 protein may be more prevalent in regions surrounding immature small vascular bundles (Fig. 3C). However, this may be due to the higher concentration of nuclei in these regions. ID1 is detected in nuclei of both mesophyll and bundle sheath cells, further suggesting ID1 is equally distributed between both photosynthetic cell types in maize. Immunostaining of SAM sections largely concur with the western blot and previous mRNA studies in that the highest levels of ID1 protein and mRNA are found in immature, developing leaves. However, a very low level of protein was detected by immunostaining in the central region of the meristem (Fig. 3B). Similarly, contrary to what was found with western blots (Fig. 2), a low level of ID1 protein is detected in nuclei in cells of leaf primordia surrounding the apex. These possible differences between western blotting and immunolocalization are discussed below.
|
ID1 transcript and protein levels do not fluctuate with day/night cycles
An investigation was carried out to see if ID1 mRNA expression and ID1 protein levels are different in plants grown under different light and dark conditions, or if they follow a circadian pattern. For expression analysis, B73 plants were grown under typical long-day conditions of 14 h days and 10 h nights for a 3 week entrainment period until the V7 floral transition stage was reached (Fig. 4A). At this point half of the plants were transferred to constant light conditions and the rest were kept under the day/night cycle. Samples of immature leaf tissues (corresponding to shoot sections BD in Fig. 2) were taken at various time points for the next 24 h and mRNA was extracted from each plant for northern analysis. As shown in Fig. 4A, ID1 transcript levels exhibit slight fluctuations over this period but do not vary significantly or consistently. For example, comparison of ID1 mRNA levels at 18 h and 22 h in plants grown in continuous light and long day-grown plants show a slight decrease in ID1 transcript in the 18 h long-day plants; however, at 22 h the long-day plants have higher levels than continuous light-grown plants. For comparison, expression levels of several other genes were examined by stripping and reprobing the northern blots. The probes included an ID1 gene homologue from maize, ZmIDDveg7, which has a broader expression range than ID1 and is detected in most tissues (Colasanti et al., 2006). ZmIDDveg7 mRNA expression followed the same pattern as ID1 (Fig. 4A). Other control genes included the maize CDC2 cell cycle gene, which is expressed in tissues with actively dividing cells (Colasanti et al., 1991) and the HCF106 gene, which is expressed in leaf tissues (Martienssen et al., 1989). Overall, ID1 mRNA accumulation does not appear to be affected by light or dark conditions or fluctuate with a noticeable rhythmic pattern.
|
ID1 protein was then examined over the course of two long days (16 h day/8 h night) to ascertain whether its accumulation in growing plants varies due to light or dark conditions. For western analysis, nuclear proteins were extracted from immature leaf sections of B73 plants at the V7 floral transition stage every 4 h for 48 h. Each blot was repeated with three individual plants for each time point and protein loaded in parallel with Coomassie-stained gels to confirm equal amounts of protein were present. Similar to the results from the northern analysis, ID1 protein levels remained constant throughout the 48 h time period in plants grown in light/dark conditions. Therefore ID1 protein levels are relatively stable over the course of one day in both light and dark conditions. This further suggests that ID1 protein levels do not fluctuate with a circadian pattern. In addition, examination of ID1 protein levels in mature leaf tissues at each time point showed no ID1 protein detected (data not shown).
ID1 expression is not linked to the sink-to-source transition
The reduction in ID1 mRNA in distal ends of greening leaf blades coincides with the transition of the leaf from a sink to a source tissue. The basipetal maturation of expanding leaves results in the leaf tips becoming net carbon exporters, while the basal, less-developed portion of the leaf is a carbon sink (Turgeon, 1989). An examination was carried out to see if changes in ID1 levels in developing leaves are associated with the transition from sink to source or if ID1 levels are down-regulated as part of the normal leaf developmental programme. For this analysis, maize lemon white (lw1) albino mutants that lack chlorophyll and therefore are unable to synthesize sugars through photosynthesis were used (Neuffer et al., 1997). All tissues in albino plants such as lw1 mutants remain as carbon sinks, with sugars supplied by the breakdown of starch in the endosperm. Because of the large maize endosperm, such albino mutants are able to produce three or four expanded leaves before the nutrient supply is exhausted and the plant dies (Fig. 5A). Plants segregating lw1 albino mutants were germinated in Magenta boxes on MS media with or without sucrose, although the addition of sucrose did not extend the life span of albino plants (data not shown).
|
Expression of ID1 was examined in immature and mature leaves of green and albino mutants, as well as four other maize zinc finger encoding genes of the IDD gene family (Colasanti et al., 2006) for comparison. Immature leaf samples included the shoot section from 1 cm to 5 cm above the shoot apex, a region found to have the highest levels of ID1 expression in plants at this stage (Fig. 2), and did not include outer sheath leaves. Mature leaf samples included the first three leaf blades of green or albino plants that had emerged from the whorl. As shown in Fig. 5B, ID1 mRNA is present in immature leaves of both green and albino seedlings, although expression is lower in albino plants. All other ZmIDD genes tested were expressed in both mature and immature leaf tissues (Fig. 5B). ZmIDDveg7 appears to be expressed equally in green and albino plants. The ID1 mRNA expression domain does not expand into the mature leaf blades of albino plants, and has the same expression pattern as in normal green plants, suggesting that down-regulation of ID1 expression in leaf tips is not associated with the source/sink status of the leaf.
To analyse the levels of ID1 protein in these plants, nuclear proteins were extracted from immature leaves and mature leaf tissues of both the albino mutants and green siblings as was done for northern analysis (Fig. 5C). Western analyses showed that ID1 protein is detected only in immature leaves but not in the mature leaf blades of either albino or green plants (Fig. 5C). Dissection showed no differences in the number of immature leaves within the whorls of albino and green plants grown with or without sucrose, showing that differences in protein levels are not due to different amounts of leaf tissue (data not shown). This suggests that ID1 protein is present in immature leaves of both green and albino plants, and that protein levels are not altered as the leaf makes the transition from sink to source tissue. It is interesting to note that immature leaves of albino plants grown in the absence of added sucrose (i.e. 0% sucrose) had very low or undetectable levels of ID1 proteins, whereas albino plants grown in the presence of sucrose in the media had similar amounts of ID1 protein as found in immature leaves of green plants (Fig. 5C) (see Discussion).
| Discussion |
|---|
|
|
|---|
ID1 protein co-localizes with ID1 mRNA in developing leaves
ID1 protein levels were examined throughout shoot development to determine whether they coincide with the expression pattern of ID1 mRNA. The rationale for undertaking this analysis was inspired by the possibility that some transcription regulators have the capacity to move from their site of synthesis to other plant cells and tissues (Jackson and Hake, 1997; Sessions et al., 2000; Kim et al., 2005). In most of these cases, transcription factor movement occurs over a short distance through a few cell layers. Although long-distance movement of transcription factor proteins has not been reported, movement of a functional KNOTTED-like homeobox gene fusion transcript from leaf to SAM through the phloem of a graft junction was reported in tomato (Kim et al., 2001). Directly relevant to long-distance floral inductive signals, a recent study provided compelling evidence that the transcript of Arabidopsis flowering-time gene FLOWERING LOCUS T (FT) moves from its site of synthesis in the leaf via the phloem to the shoot apex (Huang et al., 2005). At the apex it was shown that the product of the FT gene interacts with a bZIP transcription factor protein, FD, and together the FT/FD complex activates genes that cause the transition to flowering (Abe et al., 2005; Wigge et al., 2005). The possibility that FT protein itself moves from leaf to apex has also been proposed but it has not yet been shown experimentally (Bernier and Perilleux, 2005; Corbesier and Coupland, 2005). The small size of the FT protein (c. 20 kDa) makes it a possible candidate as a phloem-travelling signal, given that macromolecules of this size have been shown to move from source to sink via the assimilate stream (Imlau et al., 1999). Further, a recent report of FT protein present in Brassica phloem sap supports the possibility that this protein can move long distances (Giavalisco et al., 2006). These findings have led to the proposal that the FT transcript and/or protein is the elusive florigen that has been postulated to exist based on numerous physiological experiments (Zeevaart, 2006).
At present there is no evidence of a maize FT orthologue that is synthesized in leaves and acting at the shoot apex to cause flowering. ID1, the only gene known to control flowering in maize, is also expressed mainly in leaves. The location of the ID1 protein was analysed to determine if it might migrate from its point of synthesis in immature leaves. Through western analysis and immunolocalization it was found that the highest levels of ID1 protein are present in immature leaf tissue and therefore it co-localizes with ID1 transcript (Fig. 3), in agreement with previous northern analyses (Colasanti et al., 1998; Colasanti and Sundaresan, 2000). Immunolocalization analysis further showed that ID1 protein is present in the nuclei of all cell types in developing maize leaves. Although ID1 protein levels appear to be higher in cells of provascular tissues, this may be due to the clustering of cells with small vacuoles in this region of developing phloem tissue. Given that ID1 protein is detected in developing phloem tissues, it is conceivable that a small amount of ID1 protein could migrate from leaves to the shoot apex to regulate genes that cause flowering. Huang et al. (2005) reported that the level of FT mRNA at the apex was at least two orders of magnitude less than the amount of FT transcript in leaves. Very low levels of ID1 protein may be present at the shoot apex, as shown by immunolocalization (Fig. 3B), but the nature of this sort of analysis does not indicate whether ID1 protein is active in the meristem. However, the possibility that ID1 protein migrates through the phloem to function at the shoot apex seems less likely, given that genetic analysis of chimeric maize plants supports the hypothesis that ID1 acts in the leaves to regulate the production or transmission of a floral inductive signal (Colasanti et al., 1998). Localization of ID1 protein predominantly to leaf tissue supports this hypothesis, although functional analysis would be required to verify whether ID1 acts exclusively in leaves. Nevertheless, the movement of small amounts of functional ID1 protein from leaf to apex remains an intriguing possibility.
Growth under varying light and dark conditions has no effect on ID1 transcript and ID1 protein levels
In many plants floral induction is controlled by environmental conditions that signal the best time for reproductive development. Genetic analysis of flowering-time mutants in Arabidopsis has identified several distinct floral induction pathways (Simpson and Dean, 2002). The photoperiod response pathway mediates signals from long-day conditions that greatly accelerate flowering in many ecotypes of this species. A key component of the photoperiod pathway is the CO gene, which encodes a zinc finger protein that promotes transcription of flowering time genes (Suarez-Lopez et al., 2001). The activity of CO is controlled at several levels. First, CO mRNA follows a basic endogenous circadian pattern (Suarez-Lopez et al., 2001). Secondly, CO activity is controlled by a post-translational degradation mechanism where CO protein is stable when synthesized in the light, but degraded by the proteasome in the dark cycle (Valverde et al., 2004). Therefore the levels of CO transcript and protein produced at specific times in the day are critical for transducing signals of the long-day photoperiod (Searle and Coupland, 2004). The patterns of ID1 expression were investigated further because there are several similarities between CO and the maize ID1 gene. First, both encode transcriptional regulators that are important for the transition to flowering. Secondly, CO and ID1 both act in leaf tissue to promote signals that are transmitted to the shoot apex to cause flowering. However, the similarities between CO and ID1 appear to be superficial. Examination of ID1 expression under various light regimes demonstrates that ID1 mRNA and ID1 protein levels, unlike CO mRNA and protein, remain relatively constant under different photoperiods and do not follow a circadian expression pattern.
The relative levels of ID1 during development, and under different light regimes, may be a reflection of the floral inductive pathway that is prominent in temperate maize. That is, whereas Arabidopsis is a facultative long-day plant that flowers more quickly under long days, maize grown in temperate regions, including the B73 inbred used in this study, is essentially day neutral and will flower at the same time, regardless of day length (Galinat and Naylor, 1951). Although Arabidopsis and maize both utilize autonomous floral inductive pathways, in temperate maize this pathway seems to be the fundamental determinant of flowering time, and most likely was a key factor in the northward migration of maize. The finding that ID1 expression is largely unperturbed by changes in light and dark supports our original supposition that ID1 mediates endogenous cues from an autonomous signalling pathway in maize (Colasanti and Sundaresan, 1996). In addition, the finding that ID1 is detected in immature leaves at all stages of growth, as early as 3 d after germination, provides further support that it may regulate an autonomous signal. Therefore an undiscovered internal signal, perhaps dependent upon plant size or leaf number, may be regulating the expression and activity of ID1, which in turn stimulates flowering.
ID1 expression follows a developmental pattern and is not affected by the sink-to-source transition
ID1 has a unique expression pattern that is unlike any other flowering-time gene or, indeed, any maize gene described so far. In this study it has been shown that, similar to ID1 transcript, ID1 protein is limited to developing leaves, providing further evidence to support the hypothesis that ID1 activates a leaf-derived floral inductive signal (Colasanti et al., 1998). It is interesting to note that the down-regulation of ID1 in the distal portions of leaves as they emerge from the whorl is strongly correlated with the sink-to-source transition. This transition, which is a key event in leaf formation, progresses in a basipetal pattern from leaf tip to leaf base. The sink-to-source transition can be visualized in leaves fed with 14CO2, i.e. labelled photosynthate is absent from leaf tips as they cease importing fixed carbon and begin actively to export it (Evert et al., 1996). Albino mutant plants were used to determine whether there is a functional correlation between ID1 accumulation and the ability of leaves to export assimilates. The finding that ID1 mRNA and ID1 protein levels are down-regulated in a similar pattern in albino and green leaf tips at the same stage of development shows that the conversion of a leaf to a net carbon exporter does not affect ID1 accumulation. Therefore the expression of ID1 is controlled developmentally and is not linked to leaf carbon status.
At the cellular level the sink-to-source transition in leaves is associated with a change in the structure of plasmodesmata between companion cells and sieve tube elements (Oparka et al., 1999). Such an alteration in intercellular permeability may determine the types or sizes of macromolecules that can flow from source to sink tissues. Given that ID1 may act by controlling the transmission of leaf-derived floral-inductive signals from leaf to apex, it seemed a good idea to test if there was a connection between ID1 accumulation and this particular change in leaf structure. However, expansion of ID1 transcript or protein into mature albino leaves that lack photosynthetic capability and thus do not export fixed carbon was not observed. Therefore ID1 activity is under the control of an unknown developmental signal. The inability of a leaf to export carbon, however, does not preclude developmental changes that are required for this export. Albino tobacco leaves, although incapable of photosynthesis and therefore unable to act as source tissue, cease importing carbon at the same time as normal green leaves (Turgeon, 1984). Therefore developmental changes associated with the sink-to-source transition occur in non-photosynthetic leaves, regardless of their ability to export assimilates (Turgeon, 2006). In maize, the export of assimilates out of source leaves appears to be associated with changes in plasmodesmata structure (Russin et al., 1996). Whether loss of ID1 activity alters the ability of leaves to export sucrose and other macromolecules, by affecting structural changes in intercellular connections, remains to be determined.
The interest in exploring a possible connection between ID1 activity and the sink-to-source transition is based on reports that sucrose movement to the shoot apex may play a role in transition to flowering (Corbesier et al., 1998; Ohto et al., 2001; Bernier and Perilleux, 2005). Examples include reports of delayed flowering in tobacco by decreasing the source strength of leaves (Tsai et al., 1997) and accelerating flowering in Arabidopsis by increasing sink strength of the shoot apex by ectopic expression of a cell wall invertase (Heyer et al., 2004). The present results do not provide evidence of ID1 controlling flowering by affecting carbon partitioning; however, a curious and unexpected finding was that levels of ID1 expression are affected by sucrose in albino plants. There is no explanation for this result; however, preliminary studies show that other sugars, including hexoses, have a similar effect (AYM Wong and J Colasanti, unpublished results). Experiments aimed at investigating this phenomenon are in progress.
The role of ID1 in controlling flowering in maize
A unique feature of the ID1 gene is the restriction of its expression to immature leaves of developing maize plants (Colasanti et al., 1998). This finding, in combination with genetic analysis of chimeric maize plants, has led to speculation that the ID1 gene product is involved in regulating the production or transmission of a leaf-derived long-distance floral inductive signal (Colasanti and Sundaresan, 2000). In this study, the localization pattern of the ID1 gene product was examined at different developmental stages and under various growth conditions. Overall, several attributes of ID1 activity and regulation have been identified. First, ID1 protein is localized to nuclei of immature leaf cells, providing further proof that the ID1 zinc finger protein acts as a regulator of gene transcription. Secondly, ID1 protein co-localizes with ID1 transcript, and there is no clear indication that ID1 regulatory protein moves from its site of synthesis to function elsewhere in the plant, as was found for several other transcription factors. Thirdly, levels of ID1 transcript and its translation product are fairly constant, are not affected by different light treatments, and do not appear to be regulated by circadian cycles. Similarly ID1 localization to immature leaf tissue is not altered by changes in the sink/source status of a leaf.
Overall, the transition to flowering in higher plants is a complex process that involves inputs from several sources, including environmental signals such as photoperiod and temperature, and endogenous signals such as plant size and age. It has been proposed that the ID1 gene acts in an autonomous pathway to control flowering in day-neutral maize (Colasanti and Sundaresan, 1996; Colasanti, 2004). The present findings that ID1 expression is unperturbed by external stimuli such as photoperiod support this idea.
| Acknowledgements |
|---|
We thank Ryan Geil and Louise McNitt for technical assistance, James Tepperman (University of California, Berkeley) for providing plasmid pTEX3 and help with bombardment experiments, Harley Smith (University of California, Riverside) for anti-KN1 antibody, and David Hantz and Michael Mucci for plant-growth care. Also we thank Mimi Tanimoto and Shujun Yang for discussions and comments on the manuscript and John Greenwood for help with plant-anatomy identification. Seeds segregating maize lw1 albino mutants were supplied by the Maize Genetics Cooperation Stock Center (http://maizecoop.cropsci.uiuc.edu/). This research was supported by grants to JC from the Natural Sciences and Engineering Research Council of Canada, the Canadian Foundation for Innovation, the Ontario Ministry of Agriculture and Food, and the US National Science Foundation (MCB-9982714).
| Footnotes |
|---|
* Present address: Performance Plants Inc., 116 Barrie St, Suite 4600, Kingston, Ontario, Canada K7L 3N6.
| References |
|---|
|
|
|---|
Abe M, Kobayashi Y, Yamamoto S, Daimon Y, Yamaguchi A, Ikeda Y, Ichinoki H, Notaguchi M, Goto K, Araki T. (2005) FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 309 10521056.
Bernier G and Perilleux C. (2005) A physiological overview of the genetics of flowering time control. Plant Biotechnology Journal 3 316.
Bodson M. (1977) Changes in the carbohydrate content of the leaf and the apical bud of Sinapis during transition to flowering. Planta 135 1923.[CrossRef]
Bodson M and Outlaw WH Jr. (1985) Elevation in the sucrose content of the shoot apical meristem of Sinapis alba at floral evocation. Plant Physiology 79 420424.
Colasanti J. (2004) Floral induction. In Goodman RM (Ed.). Encyclopedia of plant and crop scienceNew York Marcel Dekker Vol. 1 pp. 452456.
Colasanti J. (2005) Decoding the floral stimulus: what's next? Flowering Newsletter 40 2426.
Colasanti J and Sundaresan V. (1996) Control of the transition to flowering. Current Opinion in Biotechnology 7 145149.[CrossRef]
Colasanti J and Sundaresan V. (2000) Florigen enters the molecular age: long-distance signals that cause plants to flower. Trends in Biochemical Sciences 25 236240.[CrossRef][Web of Science][Medline]
Colasanti J, Tremblay R, Wong AYM, Coneva V, Kozaki A, Mable BK. (2006) The maize INDETERMINATE1 flowering time regulator defines a highly conserved zinc finger protein family in higher plants. BMC Genomics 7 158.[CrossRef][Medline]
Colasanti J, Tyers M, Sundaresan V. (1991) Isolation and characterization of cDNA clones encoding a functional p34cdc2 homologue from Zea mays. Proceedings of the National Academy of Sciences, USA 88 33773381.
Colasanti J, Yuan Z, Sundaresan V. (1998) The indeterminate gene encodes a zinc finger protein and regulates a leaf-generated signal required for the transition to flowering in maize. Cell 93 593603.[CrossRef][Web of Science][Medline]
Corbesier L and Coupland G. (2005) Photoperiodic flowering of Arabidopsis: integrating genetic and physiological approaches to characterization of the floral stimulus. Plant, Cell and Environment 28 5466.[CrossRef]
Corbesier L, Lejeune P, Bernier G. (1998) The role of carbohydrates in the induction of flowering in Arabidopsis thaliana: comparison between the wild type and a starchless mutant. Planta (Berlin) 206 131137.
Evert RF, Russin WA, Bosabalidis AM. (1996) Anatomical and ultrastructural changes associated with sink-to-source transition in developing maize leaves. International Journal of Plant Sciences 157 247261.[CrossRef]
Galinat WC and Naylor AW. (1951) Relation of photoperiod to inflorescence proliferation in Zea mays L. American Journal of Botany 38 3847.[CrossRef][Web of Science]
Giavalisco P, Kapitza K, Kolasa A, Buhtz A, Kehr J. (2006) Towards the proteome of Brassica napus phloem sap. Proteomics 6 896909.[CrossRef][Web of Science][Medline]
Hayama R and Coupland G. (2003) Shedding light on the circadian clock and the photoperiodic control of flowering. Current Opinion in Plant Biology 6 1319.[CrossRef][Web of Science][Medline]
Heyer AG, Raap M, Schroeer B, Marty B, Willmitzer L. (2004) Cell wall invertase expression at the apical meristem alters floral, architectural, and reproductive traits in Arabidopsis thaliana. The Plant Journal 39 161169.[CrossRef][Web of Science][Medline]
Huang T, Bohlenius H, Eriksson S, Parcy F, Nilsson O. (2005) The mRNA of the Arabidopsis gene FT moves from leaf to shoot apex and induces flowering. Science 309 16941696.
Imlau A, Truernit E, Sauer N. (1999) Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. The Plant Cell 11 309322.
Jackson D and Hake S. (1997) Morphogenesis on the move: intercellular trafficking of regulatory proteins in plants. Current Opinion in Genetics and Development 7 495500.[CrossRef][Web of Science][Medline]
Kim JY, Rim Y, Wang L, Jackson D. (2005) A novel cell-to-cell trafficking assay indicates that the KNOX homeodomain is necessary and sufficient for intercellular protein and mRNA trafficking. Genes and Development 19 788793.
Kim M, Canio W, Kessler S, Sinha N. (2001) Developmental changes due to long-distance movement of a homeobox fusion transcript in tomato. Science 293 287289.
Kozaki A, Hake S, Colasanti J. (2004) The maize ID1 flowering time regulator is a zinc finger protein with novel DNA binding properties. Nucleic Acids Research 32 17101720.
Kurata T, Okada K, Wada T. (2005) Intercellular movement of transcription factors. Current Opinion in Plant Biology 8 600605.[CrossRef][Web of Science][Medline]
Lejeune P, Bernier G, Requier MC, Kinet JM. (1993) Sucrose increase during floral induction in the phloem sap collected at the apical part of the shoot of the long-day plant Sinapis alba L. Planta 190 7174.
Martienssen RA, Barkan A, Freeling M, Taylor W. (1989) Molecular cloning of a maize gene involved in photosynthetic membrane organization that is regulated by Robertson's Mutator. EMBO Journal 8 16331639.[Web of Science][Medline]
McSteen P, Laudencia-Chingcuanco D, Colasanti J. (2000) A floret by any other name: control of meristem identity in maize. Trends in Plant Science 5 6166.[CrossRef][Web of Science][Medline]
Neuffer MG, Coe EH, Wessler SR. (1997) Mutants of maizeCold Spring Harbor, NY Cold Spring Harbor Laboratory Press.
Ohto M, Onai K, Furukawa Y, Aoki E, Araki T, Nakamura K. (2001) Effects of sugar on vegetative development and floral transition in Arabidopsis. Plant Physiology 127 252261.
Oparka KJ, Roberts AG, Boevink P, Santa Cruz S, Roberts L, Pradel KS, Imlau A, Kotlizky G, Sauer N, Epel B. (1999) Simple, but not branched, plasmodesmata allow the nonspecific trafficking of proteins in developing tobacco leaves. Cell 97 743754.[CrossRef][Web of Science][Medline]
Russin WA, Evert RF, Vanderveer PJ, Sharkey TJ, Briggs SP. (1996) Modification of a specific class of plasmodesmata and loss of sucrose export ability in the sucrose export defective1 maize mutant. The Plant Cell 8 645658.[Abstract]
Sachs RM and Hackett WP. (1983) Sourcesink relationships and flowering. In Meudt WJ (Ed.). Strategies of plant reproducitonTotowa, NJ Allenheld-Osmun.
Searle I and Coupland G. (2004) Induction of flowering by seasonal changes in photoperiod. EMBO Journal 23 12171222.[CrossRef][Web of Science][Medline]
Sessions A, Yanofsky MF, Weigel D. (2000) Cellcell signaling and movement by the floral transcription factors LEAFY and APETALA1. Science 289 779781.
Simpson GG and Dean C. (2002) Flowering Arabidopsis, the rosetta stone of flowering time? Science 296 285289.
Steinmuller K and Apel K. (1986) A simple and efficient procedure for isolating plant chromatin which is suitable for studies of DNase I-sensitive domains and hypersensitive sites. Plant Molecular Biology 7 8794.
Suarez-Lopez P, Wheatley K, Robson F, Onouchi H, Valverde F, Coupland G. (2001) CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature 410 11161120.[CrossRef][Medline]
Tsai CH, Miller A, Spalding M, Rodermel S. (1997) Source strength regulates an early phase transition of tobacco shoot morphogenesis. Plant Physiology 115 907914.[Abstract]
Turgeon R. (1984) Termination of nutrient import and development of vein loading capacity in albino tobacco-leaves. Plant Physiology 76 4548.
Turgeon R. (1989) The sinksource transition in leaves. Annual Review of Plant Physiology and Plant Molecular Biology 40 119138.[CrossRef][Web of Science]
Turgeon R. (2006) Phloem loading: how leaves gain their independence. Bioscience 56 1524.[CrossRef][Web of Science]
Valverde F, Mouradov A, Soppe W, Ravenscroft D, Samach A, Coupland G. (2004) Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science 303 10031006.
Wigge PA, Kim MC, Jaeger KE, Busch W, Schmid M, Lohmann JU, Weigel D. (2005) Integration of spatial and temporal information during floral induction in Arabidopsis. Science 309 10561059.
Zeevaart JAD. (2006) Florigen coming of age after 70 years. The Plant Cell 18 17831789.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. Colasanti and V. Coneva Mechanisms of Floral Induction in Grasses: Something Borrowed, Something New Plant Physiology, January 1, 2009; 149(1): 56 - 62. [Full Text] [PDF] |
||||
![]() |
K. Matsubara, U. Yamanouchi, Z.-X. Wang, Y. Minobe, T. Izawa, and M. Yano Ehd2, a Rice Ortholog of the Maize INDETERMINATE1 Gene, Promotes Flowering by Up-Regulating Ehd1 Plant Physiology, November 1, 2008; 148(3): 1425 - 1435. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wu, C. You, C. Li, T. Long, G. Chen, M. E. Byrne, and Q. Zhang RID1, encoding a Cys2/His2-type zinc finger transcription factor, acts as a master switch from vegetative to floral development in rice PNAS, September 2, 2008; 105(35): 12915 - 12920. [Abstract] [Full Text] [PDF] |
||||
![]() |
Compiled by, F. Tooke, T. Chiurugwi, and N. Battey Flowering Newsletter bibliography for 2007 J. Exp. Bot., July 18, 2008; (2008) ern109v1. [Full Text] [PDF] |
||||
![]() |
V. Coneva, T. Zhu, and J. Colasanti Expression differences between normal and indeterminate1 maize suggest downstream targets of ID1, a floral transition regulator in maize J. Exp. Bot., October 10, 2007; (2007) erm217v1. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







