JXB Advance Access originally published online on February 24, 2007
Journal of Experimental Botany 2007 58(6):1485-1495; doi:10.1093/jxb/erm010
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2007 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.This paper is available online free of all access charges (see http://jxb.oxfordjournals.org/open_access.html for further details)
RESEARCH PAPER |
Pseudomonas brassicacearum strain Am3 containing 1-aminocyclopropane-1-carboxylate deaminase can show both pathogenic and growth-promoting properties in its interaction with tomato

1All-Russia Research Institute for Agricultural Microbiology (ARRIAM), Podbelskogo Sh., 3, Pushkin-8, 196608, St-Petersburg, Russian Federation
2Department of Biological Sciences, University of Lancaster, Lancaster LA1 4YQ, UK
3Department of Biology, University of Waterloo, Waterloo, ON, Canada N2L 3G1
* To whom correspondence should be addressed. E-mail: belimov{at}rambler.ru
Received 13 November 2006; Revised 31 December 2006 Accepted 5 January 2007
| Abstract |
|---|
|
|
|---|
The role of bacterial 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity in the interaction between tomato (Lycopersicon esculentum=Solanum lycopersicum) and Pseudomonas brassicacearum was studied in different strains. The phytopathogenic strain 520-1 possesses ACC deaminase activity, an important trait of plant growth-promoting rhizobacteria (PGPR) that stimulates root growth. The ACC-utilizing PGPR strain Am3 increased in vitro root elongation and root biomass of soil-grown tomato cv. Ailsa Craig at low bacterial concentrations (106 cells ml1 in vitro and 106 cells g1 soil) but had negative effects on in vitro root elongation at higher bacterial concentrations. A mutant strain of Am3 (designated T8-1) that was engineered to be ACC deaminase deficient failed to promote tomato root growth in vitro and in soil. Although strains T8-1 and 520-1 inhibited root growth in vitro at higher bacterial concentrations (>106 cells ml1), they did not cause disease symptoms in vitro after seed inoculation, or in soil supplemented with bacteria. All the P. brassicacearum strains studied caused pith necrosis when stems or fruits were inoculated with a bacterial suspension, as did the causal organism of this disease (P. corrugata 176), but the non-pathogenic strain Pseudomonas sp. Dp2 did not. Strains Am3 and T8-1 were marked with antibiotic resistance and fluorescence to show that bacteria introduced to the nutrient solution or on seeds in vitro, or in soil were capable of colonizing the root surface, but were not detected inside root tissues. Both strains showed similar colonization ability either on root surfaces or in wounded stems. The results suggest that bacterial ACC deaminase of P. brassicacearum Am3 can promote growth in tomato by masking the phytopathogenic properties of this bacterium.
Key words: ACC deaminase, colonization, ethylene, GFP, PGPR, phytopathogen, plantbacteria interactions, Pseudomonas, rhizosphere, tomato
| Introduction |
|---|
|
|
|---|
A number of plant growth-promoting rhizobacteria (PGPR), belonging to various taxonomic groups including Pseudomonas, contain the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase, which hydrolyses ACC, the immediate precursor of the plant hormone ethylene (Honma and Shimomura, 1978; Glick et al., 1995; Belimov et al., 2001, 2005). These bacteria, occurring on the root surface, degrade ACC to ammonium and
-ketobutyrate for use as carbon and nitrogen sources. Since a dynamic equilibrium of ACC concentration exists between root, rhizosphere, and bacterium, bacterial uptake of rhizospheric ACC stimulates plant ACC efflux, decreases root ACC concentration and root ethylene evolution, and can increase root growth (Glick et al., 1998). The ability of ACC-utilizing PGPR to ameliorate plant growth inhibition caused by ethylene through a decrease in ACC content (Penrose et al., 2001) and ethylene production (Burd et al., 1998; Belimov et al., 2002; Mayak et al., 2004) has been demonstrated. Stimulation of root elongation and biomass production of different plant species by inoculations with PGPR having ACC deaminase activity has been repeatedly documented, particularly when the plants were subjected to stressful growth conditions (Hall et al., 1996; Glick et al., 1997; Burd et al., 1998; Belimov et al., 2001, 2005; Van Loon and Glick, 2004; Safronova et al., 2006). Pseudomonas brassicacearum has been described as a typical bacterium inhabiting the rhizoplane of Arabidopsis thaliana and Brassica napus, and phenotypically related to the phytopathogen Pseudomonas corrugata (Achouak et al., 2000). Contradictory data about the nature of the interaction between P. brassicacearum and plants have been reported. The strain P. brassicacearum 520-1 was described as a pathogen for tomato, causing chlorosis, browning, and necrotic lesions when plant wounds were infected (Sikorski et al., 2001). Endophytic strains of P. brassicacearum have been isolated from potato stem tissue infected with Erwinia carotovora (Reiter et al., 2003), but pathogenicity or plant growth-promoting activity of these isolates was not reported. On the other hand, several P. brassicacearum strains exhibited take-all disease suppression in wheat infected with Gaeumannomyces graminis and were suggested as potential biocontrol agents (Ross et al., 2000). Furthermore, P. brassicacearum strain Am3, which has ACC deaminase activity, promoted root elongation of Indian mustard (Brassica juncea) in vitro and increased root and shoot biomass of rape (B. napus) and pea (Pisum sativum) in pot trials (Belimov et al., 2001; Safronova et al., 2006). However, the presence of ACC deaminase in other P. brassicacearum strains and its effect on plant root development has not been studied.
The objective of the current work was to determine the effects of different P. brassicacearum strains on tomato, a species for which P. brassicacearum was reported to be phytopathogenic (Sikorski et al., 2001). The role of ACC deaminase in plantbacteria interactions was examined by measuring in vitro ACC deaminase activity of the strains studied, and by creating a mutant of P. brassicacearum strain Am3 with decreased ACC deaminase activity.
| Materials and methods |
|---|
|
|
|---|
Characteristics of the bacterial strains
A list and description of strains used is given in Table 1. PGPR strains P. brassicacearum Am3, Pseudomonas sp. Dp2 (Belimov et al., 2001), and Variovorax paradoxus 5C-2 (Belimov et al., 2005) containing ACC deaminase, and Escherichia coli strain S17-1::pSUP5011 (Simon et al., 1983) were obtained from the ARRIAM Collection (St-Petersburg). Phytopathogenic strains P. brassicacearum 520-1 (Sikorski et al., 2001) and P. corrugata 176 (Bykova et al., 1991) were kindly provided by Dr W Wackernagel (University of Oldenburg, Germany) and Dr AM Lazarev (All-Russia Research Institute of Plant Protection, St-Petersburg), respectively. Strain Escherichia coli S17-1::pAG408 (Suarez et al., 1997) was kindly provided by Dr T Charles (University of Waterloo, Canada).
|
An ACC deaminase-deficient mutant of P. brassicacearum Am3 was obtained using Tn5 mutagenesis via conjugation with E. coli S17-1::pSUP5011. For this purpose, 0.1 ml aliquots of cell suspensions (109 cells ml1) of strain S17-1::pSUP5011 grown on LB agar, supplemented with 50 µg ml1 kanamycin, and strain Am3 grown on DF agar (Belimov et al., 2001), supplemented with 0.3 mg ml1 ACC as a nitrogen source (DFA medium), were spotted on LB agar plate and incubated overnight at 28 °C. Then bacteria were resuspended in sterile water, plated on DF agar supplemented with 50 µg ml1 kanamycin and 0.3 mg ml1 (NH4)2SO4 as a nitrogen source (DFN medium), and incubated for 24 h at 22 °C. Under these growth conditions recipient strain Am3 formed colonies characteristic of fluorescent pseudomonads, whereas growth of the donor E. coli strain was delayed by low temperature. The frequency of Kmr clones of Am3 (calculated as a ratio of the recombinant titre to the recipient) was 106, whereas the frequency of Am3 spontaneous Kmr mutants was lower than 109. Three hundred Kmr transconjugant clones were picked up on replica plates containing DFA (selection medium) and DFN (control medium) agar, incubated for 48 h at 28 °C, and the transconjugant T8-1 that lacked ability to grow on DFA medium was selected. The 16S rDNA gene of T8-1 was partially sequenced as described earlier (Belimov et al., 2005) and the sequence obtained (accession number AY916776) showed 99.8% homology with wild-type Am3, confirming that the isolated mutant T8-1 is a derivative of this strain. To ascertain whether Tn5-mob had been inserted into the isolate T8-1, PCR was performed to amplify the nptII gene (Chuang et al., 1999) using oligonucleotides CTCGACGTTGTCACTGAAGCGGGAAG (TNF) and AAAGCACGAGGAAGCGGTCAGCCCAT (TNR). Isolate T8-1 produced a short DNA fragment of 500 bp, indicating the presence of the Tn5-mob insert in the mutants, whereas the parental strain Am3, which does not harbour the nptII gene, showed no result (data not shown).
To monitor tomato root and tissue colonization by bacteria, the strains Am3 and T81 were marked with the gene encoding green fluorescent protein (GFP) of the jellyfish Aequorea victoria. For this purpose, the spontaneous mutants Am3R and T8-1R resistant to 20 µg ml1 rifampicin were obtained via incubation of bacteria on Bacto-Pseudomonas F (BPF) agar containing (g l1): peptone, 10; casein hydrolysate, 10; glycerol, 12.5; K2HPO4, 1.5; MgSO4, 1.5; agar, 15. Strains Am3R and T8-1R were conjugated with E. coli S17-1 carrying the promoter-probe gfp-based mini-transposon suicide delivery system pAG408 with kanamycin (30 µg ml1) and gentamycin (15 µg ml1) resistance as described by Suarez et al. (1997). Transconjugants named Am3RF and T8-1RF, having high and visible fluorescence intensity under UV light suggesting chromosomal integration downstream of strong promoters of the mini-transposon, were finally selected and used for further experiments.
Utilization of ACC
The ACC deaminase activity of the bacteria was determined by monitoring the amount of
-ketobutyrate (
KB) generated by enzymatic hydrolysis of ACC in cell-free extracts as described previously (Belimov et al., 2005).
In batch culture, strains P. brassicacearum Am3 and T8-1 were incubated for 22 d at 25 °C without shaking in flasks containing 50 ml of liquid SMY (Belimov et al., 2005) medium (l1): glucose, 1.2 g; KH2PO4, 0.4 g; K2HPO4, 2 g; MgSO4, 0.2 g; CaCl2, 0.1 g; FeSO4, 5 mg; H3BO3, 2 mg; ZnSO4, 5 mg; Na2MoO4, 1 mg; MnSO4, 3 mg; CoSO4, 1 mg; CuSO4, 1 mg; NiSO4, 1 mg; yeast extract, 50 mg; pH 6.4. The SMY medium was supplemented with 10 mM ACC or 5 mM (NH4)2SO4 such that the amounts of N were equal. Initial bacterial concentration in SMY medium was 105 cells ml1. Bacterial growth was determined daily by monitoring the optical density (OD) at 540 nm. The inoculated SMY medium without supplements was used as a blank to each strain.
Root elongation assay
The plant root elongation-promoting activity of the bacteria was determined using the modified root elongation assay of Belimov et al. (2001). Bacteria were grown for 48 h at 28 °C on BPF agar supplemented with antibiotics where necessary. Cells were collected and resuspended to 106, 107, and 108 cells ml1 in sterile nutrient solution (µM): 500, MgSO4; 500, K2HPO4; 200, KH2PO4; 500, CaCl2; 20, KNO3; 5, NaFeEDTA; 0.1, MnSO4; 0.1, ZnSO4; 0.1, H3BO3; 0.01, CoCl2; 0.01, CuSO4; 0.01, Na2MoO4; 0.01, NiCl2; 0.01, KJ. Five millilitres of the bacterial suspensions or sterile nutrient solution (uninoculated control) were added to filter paper (Whatman #1) in Petri dishes (diameter 90 mm). For treatments with chemical inhibitors of ethylene biosynthesis or action, the nutrient solution was supplemented with 0.1 µM aminoethoxyvinylglycine (AVG), 1 µM Ag2SO4, or 2 µM CoCl2 (final concentration). Tomato [Lycopersicon esculentum (=Solanum lycopersicum) Mill. cv. Ailsa Craig] seeds were surface-sterilized with 5% sodium hypochlorite solution for 15 min, washed carefully with sterile water and placed on wetted filter paper. The treated seeds were tested for surface sterility in a set of preliminary experiments via incubation on BPF agar for 5 d at 28 °C. After incubation of closed Petri dishes for 8 d at 25 °C in the dark, root length of seedlings was measured and root samples were taken for enumeration of bacteria and for microscopy as described below. The assay was repeated at least twice with four dishes (15 seeds per dish) for each treatment.
Agar culture
Tomato cv. Ailsa Craig root colonization by the GFP-tagged transconjugants P. brassicacearum Am3RF and T8-1RF was assayed using agar culture. Surface-sterilized seeds were germinated on filter paper wetted with bacterial suspensions (107 cells ml1) for 3 d as described above. Then germinated seeds having a root length of about 5 mm were transferred to Petri dishes (diameter 150 mm) containing 100 ml of the sterile nutrient solution (see above) solidified with 0.7% agarose. Four seeds per each Petri dish (three dishes for each treatment) were placed 2 cm from each other in a line located 3.5 cm from the box edge. The Petri dishes were installed at 45° to the horizontal to allow the roots to grow under the agarose layer and were incubated for 10 d in a greenhouse with a day/night cycle of 16 h/8 h at 25/16 °C and a photon flux density of 400 µmol quanta m2 s1. After incubation, colonization of roots by the bacteria was monitored microscopically and root samples were taken for enumeration of bacteria as described below.
Pot experiments
These were carried out in the ARRIAM greenhouse (St-Petersburg) under natural illumination and temperature in JuneAugust 2005 (experiments 1 and 2) and in July 2006 (experiment 3). Surface-sterilized tomato seeds were transferred to enamel pots containing 4 kg of unsterilized peat:sod-podzolic soil:dolomite (4:5:0.1, v/v/v) mixture having the following characteristics (mg kg1): total C, 58 000; total N, 6550; available P, 130; available K, 380; pHKCl, 6.5. The mixture was fertilized with (mg kg1): Ca(NO3)2, 250; KH2PO4, 125; KCl, 65; MgSO4, 50; ZnSO4, 1.5; MnSO4, 1.5; H3BO3, 5. In the course of the experiments the pots were watered daily to maintain 70% of the water holding capacity.
In experiment 1 with cv. Ailsa Craig, the soil mixture was irrigated up to 80% of water holding capacity with tap water, or with bacterial suspensions of P. brassicacearum strains Am3RF, T8-1RF, and 520-1 (inoculation resulted in a final concentration of 106 cells g1 soil) before planting. Roots of seedlings grown in inoculated and uninoculated soil were sampled 15 d after planting (DAP) for determination of bacterial root colonization (three replicas per determination with two to four seedlings each) and seven seedlings remained in each pot. Three seedlings per pot were taken for a second determination of bacterial root colonization (three replicas per determination with four seedlings each) 30 DAP. The remaining plants (16 plants per treatment) were harvested 38 DAP and dried at 40 °C until constant mass.
In experiments 2 (cv. Ailsa Craig) and 3 (cv. Ailsa Craig and cv. Moneymaker) plants grown in pots containing soil mixture irrigated with tap water were wound-infected by injecting 5 µl of bacterial suspensions of Am3RF, T8-1RF, and 520-1 (107 cells ml1 in sterile 0.85% NaCl solution) into the stem 28 and 35 DAP (experiment 2) and 17 DAP (experiment 3). In the same manner, injections with strains Dp2, 5C-2, and 176 were performed in experiment 3 only. Control plants were injected with sterile 0.85% NaCl solution. A syringe needle of 0.5 mm diameter was passed completely through the stem between the cotyledons and the first leaf and bacterial suspension injected into the stem as the needle was withdrawn. Plant shoots were harvested 26 d (six plants per treatment) and 54 d (nine plants per treatment) (experiment 2) or 37 d (eight plants per treatment) (experiment 3) after injection, weighed, and inspected for internal infection symptoms in the stems. Stem samples of uninfected control plants, and wound-infected plants having discoloration and necrotic lesions were aseptically taken with a sterile surgical blade for bacterial enumeration. Stem cross-sections were photographed using a digital camera (model EOS10D, Canon, Japan).
Tomato fruit infection bioassay
Unripe (green) tomato fruits of cv. Urozhainy having no visual disease symptoms or disorders were collected at the ARRIAM experimental field in August 2006. Fruits were surface-sterilized with 1% sodium hypochlorite solution for 5 min and washed carefully with sterile water. Then 10 µl of 0.85% NaCl solution (control) or bacterial suspensions of Am3, T8-1, 520-1, Dp2, 5C-2, and 176 (107 cells ml1) were injected into the central pith area in six fruits per treatment. After 10 d of incubation in the dark at room temperature, fruit cross-sections were inspected and photographed as described above.
Enumeration of bacteria associated with roots or localized in infected tissues
Root tips (10 mm) of all seedlings from each Petri dish of filter paper culture were cut, pooled, and washed by plunging into sterile water 10 times to eliminate bacterial cells not attached to the roots. Root segments located 37 cm from the seeds of each Petri dish of agar culture were carefully removed from the medium and combined without any subsequent washing procedure. Roots from plants grown in soil were thoroughly shaken to remove adhering soil particles. Stem tissues were used for analysis immediately after sampling. The plant samples were homogenized in sterile tap water with a sterile mortar and pestle, the homogenates were serially diluted in 10-fold steps, and 50 µl aliquots were plated in two replicates on BPF agar supplemented with the required amounts of antibiotics where necessary (details in Tables 3, 4). In experiments with filter paper and agar cultures, no antibiotics were added to estimate the total amount of bacteria, to examine stability of transconjugants, and to check contamination of samples with extraneous microorganisms. To analyse the root samples taken from soil, the medium was additionally supplemented with 40 µg ml1 nystatin to prevent growth of fungi. Colony-forming units (CFU) were counted after incubation of plates for 4 d at 25 °C. Presence of GFP marker in the isolated colonies was verified under UV light.
|
|
Microscopy
The presence and distribution of GFP-tagged bacteria on roots taken from filter paper and agar cultures was monitored using a laser scanning confocal microscope (LEICA SP2A0BS; Leica, Germany). In filter paper culture, root segments located 3 cm from the root tip were visualized directly. In agar culture, root segments located 37 cm from the seeds were carefully taken along with the agarose layer and immediately placed between microscope slides and cover slips. Three roots per treatment were scanned in each of two independent experiments. Cross-sections of the infected tomato stem tissues (10 plants per treatment) and the roots of plants grown in the inoculated soil were examined using a light microscope Axiolab equipped with filter set #01 (Carl Zeiss, Germany). Microphotographs of typical colonization patterns of bacteria on roots and in the infected stem tissues were taken.
Statistical analysis
The data were processed by variance and correlation analysis using the software STATISTICA version 5.5 (StatSoft, Inc., USA). SE and LSD stand for standard error and Fisher's least significant difference test, respectively.
| Results |
|---|
|
|
|---|
Utilization of ACC
ACC deaminase activity of the mutant P. brassicacearum T8-1 was 37 times less than that of the wild-type Am3 (Table 1). During the first 15 d of incubation in batch culture, when ACC was the sole source of nitrogen, the T8-1 mutant also showed a low rate of ACC utilization (Fig. 1). Then the growth rate of T8-1 increased, probably as the selection pressure exerted by high ACC concentrations induced reverse mutations. The growth curves of T8-1 and Am3 in the presence of (NH4)2SO4 were identical, suggesting that there were no significant metabolic losses in T8-1 caused by transformation.
|
Strain P. brassicacearum 520-1 showed the highest ACC deaminase activity of all the strains studied, with V. paradoxus 5C-2 the lowest (Table 2). Rifampicin-resistant mutants Am3R and T8-1R had an ACC deaminase activity similar to that of wild-type strains, whereas the activity of GFP-tagged derivatives of these strains decreased slightly, probably due to a metabolic load caused by insertion and/or expression of pAG408.
|
Filter paper culture
All P. brassicacearum strains caused stepwise changes in tomato root elongation depending on the concentration of bacteria in the nutrient solution (Fig. 2). Pseudomonas brassicacearum Am3 stimulated (by 8%), had no effect, and inhibited (by 25%) root elongation in the presence of 106, 107, and 108 cells ml1, respectively. The mutant T8-1 had no effect on roots at 106 cells ml1 and significantly inhibited root elongation at higher bacterial concentrations. Significant (P <0.05) differences between treatments with wild-type Am3 and the mutant T8-1 occurred in the presence of 107 and 108 cells ml1. Pseudomonas brassicacearum 520-1 significantly inhibited root elongation at all bacterial concentrations used. Visual observations revealed no visible disease symptoms on the roots inoculated with P. brassicacearum strains, except a brownish root colour in the presence of Am3 and T8-1 at 108 cells ml1 and in the presence of 520-1 at 107 and especially at 108 cells ml1. Contrary to these observations, strains Pseudomonas sp. Dp2 and V. paradoxus 5C-2, applied as positive controls, significantly stimulated tomato root elongation irrespective of bacterial concentration.
|
Treatments with chemical inhibitors of ethylene biosynthesis (AVG and Co2+) and action (Ag+) also stimulated root elongation to a similar extent as strains Dp2 and 5C-2. Addition of Co2+ to the solution supplemented with bacteria (107 cells ml1) partially alleviated root length inhibition by strains T8-1 and 520-1, increased the stimulating effect of 5C-2, and tended to increase root length of seedlings in the presence of strains Am3 and Dp2.
There was no significant difference between the number of P. brassicacearum Am3 and T8-1 on tomato roots (Table 3). Similar numbers of bacteria on roots detected on BPF medium, with and without necessary antibiotics, confirmed a high stability of Tn5-mob and pAG408 inserted into the tagged strains, and suggested that genetic modifications had no effect on colonization ability of bacteria. No contamination of roots with extraneous microorganisms was detected. The attempt to visualize the bacteria on roots using laser scanning confocal microscopy was not successful because the root tissues had very high auto-fluorescence.
Agar culture
Study with a microscope showed that distribution of the introduced bacteria on roots was relatively random. Single cells and small microcolonies presented along the root segments and dividing bacterial cells (pairs of cells) were often observed, suggesting that multiplication of the bacteria occurred and the bacteria were in an active physiological state (Fig. 3A, B). Few larger microcolonies were also observed on the root surface where the bacteria were localized in a mucilage layer, but no bacteria were observed inside root tissues (Fig. 3C). No visible differences were found between P. brassicacearum Am3RF and its mutant T8-1RF in their root colonization patterns. Study with a microscope and visual observations revealed no morphological changes or disease symptoms such as necrotic spots, browning, lesions, and other root tissue damage caused by inoculation with either Am3RF or T8-1RF. Enumeration of bacteria using the root homogenate serial dilution method showed that the root colonization capability of P. brassicacearum Am3RF and its mutant T8-1RF was similar and the GFP-tagged cells comprised all the introduced bacteria (Table 2). No contamination of roots with extraneous microorganisms was detected.
|
Pot experiments
Tomato plants grown in soil supplemented with P. brassicacearum Am3RF (experiment 1) had increased root biomass as compared with those plants grown in untreated soil and in soil inoculated with strains T8-1RF or 520-1 (Fig. 4). Inoculation with T8-1RF slightly decreased (11%) root biomass relative to control plants. Shoot growth was not affected by inoculations with T8-1RF or 520-1, whereas inoculation with Am3RF slightly increased (+14%) shoot biomass relative to control and a significant difference was evident as compared with T8-1RF. Visual observations revealed no disease symptoms on roots and shoots caused by any of the strains used. The introduced strains Am3RF and T8-1RF were detected at levels of several hundreds of cells per milligram root FW during the course of the experiment (Table 3). Visualization of GFP-tagged bacteria on roots using light microscopy revealed few cells per field of vision; however, no representative pictures were taken because of the relatively low number of cells on the roots and the high fluorescence level of root tissues and some soil particles (data not shown).
|
In experiment 2, all plants injected with suspensions of P. brassicacearum strains had necrotic brown lesions inside the stems localized in pith tissue above the injection point (Table 4; Fig. 3D). Longitudinal stem sections showed that lesion size increased during the course of the experiment and was maximal on plants wound-infected with strain 520-1 (Table 4). Injection with 520-1 decreased shoot biomass by 17%, whereas the effect of injections with Am3RF and T8-1RF on shoot weight was not significant. Leaves of the infected plants showed no chlorosis or other disease symptoms. The introduced strains Am3RF and T8-1RF were detected in necrotic brown lesions of stems by light microscopy (Fig. 3E, F). The bacteria formed numerous microcolonies located on plant cell walls. No bacteria were observed outside the lesions (data not shown), suggesting that bacterial proliferation and infection were restricted by the plant to the lesion zone. The number of each of the introduced strains inhabiting stem lesions was similar at both 26 d and 54 d after wound-infection and the number of strain 520-1 was about twice more than strains Am3RF and T8-1RF (Table 4).
In experiment 3, the number of infected plants having necrotic lesions inside the stems was maximal after infection with P. corrugata 176, whereas the negative control strain Pseudomonas sp. Dp2 induced no lesions, and only three plants with lesions were observed after infection with V. paradoxus 5C-2 (Table 4). Lesion dimensions were significantly less than in experiment 2, and no significant genotypic differences were observed between tomato cultivars or between lesion-inducing strains. Shoot biomass was not affected by bacterial inoculation. Bacterial numbers in the stem lesions were similar for all the pseudomonad strains, whereas the number of 5C-2 was about 20 times less (Table 4). No bacteria were found in the stem when strain Dp2 was injected.
Tomato fruit infection bioassay
All fruits infected with P. brassicacearun Am3, T8-1, and 520-1 and P. corrugata 176 had brown lesions in the central pith area, whereas no lesions were observed in control (0.85% NaCl sterile solution) fruit. Strains Dp2 and 5C-2 induced no lesions with the exception that only two fruits of each treatment had small, slightly brownish lesions (cross-sections of these fruits are shown in Fig. 3G). Visual changes in the colour of the gel area (from transparent to brownish) and seeds (from yellow-white to brown) were detected in the fruits infected with strain 176 only. Cross-sections of representative fruits are presented in Fig. 3G.
| Discussion |
|---|
|
|
|---|
Pseudomonas brassicacearum strain 520-1, a bacterium described previously as phytopathogenic for tomato (Sikorski et al., 2001), possesses ACC deaminase activity, an important mechanism of plant growth promotion by beneficial root-associated bacteria (Glick et al., 1998; Van Loon and Glick, 2004). This observation is in agreement with searches of the NCBI sequence database, where putative ACC deaminase genes were found in complete genome sequences of several phytopathogens such as Pseudomonas syringae pv. tomato DC3000 (NP793449), P. syringae pv. syringae B728a (ZP00124451), and E. carotovora subsp. atroseptica SCRI1043 (YP049633), although the ability of these strains to degrade ACC was not determined. Recently, Blaha et al. (2006) detected the ACC deaminase gene in a number of phytopathogenic Agrobacterium tumefaciens strains, in Burkholderia gladioli LMG2216, B. caryophylli LMG2155, and B. cepacia LMG1222, and showed that strain LMG1222 possessed ACC deaminase activity in vitro. Furthermore, it is shown here that an ACC deaminase-containing bacterium (P. brassicacearum Am3), characterized as a PGPR for pea, rape, and Indian mustard (Belimov et al., 2001; Safronova et al., 2006), is pathogenic for tomato.
The effects of P. brassicacearum strain Am3 (and particularly its ACC deaminase-deficient T8-1 mutant) resembled those of phytopathogenic strain 520-1 on in vitro root elongation in the presence of high bacterial concentrations (107 and 108 cells ml1) (Fig. 2). However, at low cell concentrations (106 cells ml1), strain Am3 stimulated root elongation in filter paper culture (Fig. 2) and increased biomass of plants grown in inoculated soil (Fig. 4). By contrast, P. brassicacearum strains 520-1 and T8-1 had no detectable effect on biomass of plants grown in inoculated soil. Pseudomonas brassicacearum Am3 (and T8-1) successfully colonized the root surface of both in vitro and in soil-grown plants (Table 3), in agreement with previous reports describing this species as a common rhizosphere bacterium (Achouak et al., 2004). However, it was not able to infect plant tissues when bacterial cells were present around the root surface of nutrient solution- or soil-grown plants.
Disease symptoms (necrotic lesions) caused by P. brassicacearum were only evident when bacteria were injected into wounded plant tissues (stem or fruit). The area of damaged stem tissues was limited, and infiltrated bacteria were found in this area only (Table 4). Localization of bacteria in the pith might be associated with reduced resistance of this tissue to bacterial toxicity. Necrosis of tomato stem pith is a typical disease symptom induced by the phytopathogen P. corrugata (Sutra et al., 1997), a species closely related to P. brassicacearum (Achouak et al., 2000). Although bacteria were introduced to the plant stem using a similar technique to Sikorski et al. (2001), the response of tomato cv. Ailsa Craig and cv. Moneymaker in the present experiments was much less pronounced than the chlorosis, vascular browning, and necrotic lesions on leaflets reported in cv. Moneymaker (Sikorski et al., 2001). In particular, very small stem pith lesions induced by P. brassicacearum and P. corrugata were observed in experiment 3 on both cultivars. At present, much of the biology of tomato disease caused by P. corrugata is not well understood, but disease severity appears to be worse when temperature is low and humidity is high (Momol and Pernezny, 2006). Climatic data for St-Petersburg (http://www.pogoda.ru.net) showed that conditions (mean temperature and monthly precipitation) for disease development were more conducive in experiment 2 (17.8 °C; 85 mm month1) than experiment 3 (19.1 °C; 16 mm month1). Therefore, it is suggested that phytopathogenicity of P. brassicacearum depends on plant genotype and environmental conditions, and occurs particularly when bacteria invade (penetrate) wounded plant tissues, a property characteristic of opportunistic pathogenesis.
It is possible that the inhibition of root elongation in vitro and necrotic lesions observed in wound-infected tomato stems and fruits caused by P. brassicacearum strains Am3 and 520-1 were due to production of bacterial toxins. Various phytopathogenic Pseudomonas species produce a wide spectrum of phytotoxic compounds (Bender et al., 1999), and the phytotoxin coronatine from P. syringae inhibited root growth of Arabidopsis thaliana (Feys et al., 1994) and wheat (Sakai, 1980). Toxins produced by the phytopathogenic bacteria, including pseudomonads, increase ACC accumulation and ethylene evolution in infected plants (Pegg and Cronshaw, 1976; Dutta and Biggs, 1991; Kenyon and Turner, 1992). The ethylene-insensitive tomato mutant Never ripe (Nr) showed significant reduction in disease symptoms in response to different pathogens including P. syringae, suggesting that stress ethylene evolution can promote disease development (Lund et al., 1998). Analogously, the reduced ethylene biosynthesis in tomato plants transformed with bacterial ACC deaminase from Enterobacter cloacae UW4 decreased disease symptoms of Verticillum wilt (Robison et al., 2001). In agreement with these observations that decreasing plant ethylene sensitivity or biosynthesis can limit disease development, it is shown here that ACC deaminase activity of the phytopathogenic bacterium P. brassicacearum Am3 counteracted its phytotoxic effects. This hypothesis relies on previous observations that rhizosphere inoculation with ACC deaminase-containing bacteria decreases root ACC levels and ethylene evolution (Burd et al., 1998; Penrose et al., 2001; Belimov et al., 2002; Mayak et al., 2004). Indeed, the ACC deaminase-deficient mutant T8-1 decreased root elongation and biomass production in comparison with the wild-type Am3. Furthermore, the chemical inhibitor of ethylene biosynthesis Co2+ partially alleviated in vitro growth inhibition caused by the T8-1 mutant, but not by wild-type Am3. In this context, it should be noted also that P. brassicacearum Am3 does not produce ethylene and auxins (Belimov et al., 2001), although many pseudomonads produce ethylene or auxins that may promote infection (Weingart and Volksch, 1997) or inhibit root growth (Persello-Cartieaux et al., 2001), respectively.
Stimulation of tomato root elongation at a low cell concentration (106 cells ml1) and an increase in root biomass observed in soil culture suggest that, under certain growth conditions, the effect of ACC deaminase may overcome the toxic effects of P. brassicacearum Am3 on plants. By contrast, the effects of other PGPR (Pseudomonas sp. Dp2 and V. paradoxus 5C-2) were independent of bacterial concentration in the nutrient solution (Fig. 2). Pseudomonas brassicacearum Am3 was initially isolated as a PGPR that stimulated root elongation of Indian mustard and rape in the presence of a high cell concentration (5x107 cells ml1) and increased growth of the inoculated rape and pea plants in pot experiments (Belimov et al., 2001; Safronova et al., 2006). Here, experiments with tomato cultivar Ailsa Craig showed that a particular bacterial strain might exert either beneficial or deleterious effects on plant growth depending on plant species, concentration of bacteria, and growth conditions. This observation may be of crucial importance for investigations aimed at isolation, characterization, and further application of PGPR as biopreparations in agriculture that presupposes a large-scale release of bacteria to the environment.
Colonization of tomato roots and wound-infected stems by P. brassicacearum Am3 and its mutant T8-1 was similar, suggesting that (i) the difference between the effects of Am3 and T8-1 on plants was not related to the colonization ability of the strains, and (ii) lowering the ACC deaminase activity did not affect colonization and distribution of the bacteria associated with the plant. The latter observation suggests that the utilization of ACC as a nutrient substance gives the bacteria no advantages in colonization of rhizosphere or plant tissues. By contrast, it is likely that P. brassicacearum may use ACC deaminase as a tool for masking (swindling) their intention for infection via decreasing the stress induced by toxins and impeding plant recognition of an opportunistic pathogen, since ethylene is a key signal intermediate in the expression of induced systemic resistance in plants (Van Loon et al., 1998). Interestingly, E. cloacae (recently reclassified as P. putida by Hontzeas et al., 2005) strain UW4, but not its ACC deaminase minus mutant UW4/AcdS, caused down-regulation of stress-related genes encoding glycine-rich RNA-binding protein and ras-GTPase-activating protein in canola roots (Hontzeas et al., 2004).
In conclusion, the interactions between plants and Pseudomonas are very variable, since this genus has plant growth-promoting, saprophytic, deleterious, and phytopathogenic species and strains, and in many cases it is difficult to discriminate between beneficial and injurious individuals (Preston, 2004). The present data reinforce this view, as a single strain (P. brassicacearum Am3) can have growth-promoting, neutral, or phytopathogenic effects on growth of a single plant cultivar according to the dose and environmental conditions. The outcome of the P. brassicacearumtomato interaction is influenced by bacterial ACC deaminase activity, as decreasing this activity modified the root growth response of tomatoes to inoculation. Whether the coincidence of bacterial properties such as ACC degradation and phytopathogenicity is a casual circumstance or interdependent, and the role that ACC deaminase plays in pathogenesis require further study.
| Acknowledgements |
|---|
The authors are very grateful to Dr W Wackernagel for kindly supplying strain P. brassicacearum 520-1, to Dr TC Charles for supplying strain E. coli S17-1::pAG408, to Dr AM Lazarev for supplying strain P. corrugata 176, to Prof. BR Glick for valuable discussions, and to Mr J Dent and Mr AG Pinaev for valuable assistance in confocal laser scanning and fluorescence light microscopy, respectively. Our special thanks to Mr P Smith for technical assistance and to Mr AI Zhernakov for photography. NATO (LST CLG 978202), the Royal Society, and the Russian Foundation of Basic Research (03-04-48252-a, 06-04-49486-a) supported this work.
| Footnotes |
|---|
Present address: Department of Pathology and Laboratory Medicine, UCLA David Geffen School of Medicine (71-295 CHS), 650 Charles E. Young Drive South, Los Angeles, CA 90095, USA. | References |
|---|
|
|
|---|
Achouak W, Conrod S, Cohen V, Heulin T. (2004) Phenotypic variation of Pseudomonas brassicacearum as a plant root-colonization strategy. Molecular Plant Microbe Interactions 17 872879.[Web of Science][Medline]
Achouak W, Sutra L, Heulin T, Meyer J-M, Fromin N, Degraeve S, Christen R, Gardan L. (2000) Pseudomonas brassicacearum sp. nov, and Pseudomonas thivervalensis sp. nov, two root-associated bacteria isolated from Brassica napus and Arabidopsis thaliana. International Journal of Systematic and Evolutional Microbiology 50 918.
Belimov AA, Hontzeas N, Safronova VI, Demchinskaya SV, Piluzza G, Bullitta S, Glick BR. (2005) Cadmium-tolerant plant growth-promoting bacteria associated with the roots of Indian mustard (Brassica juncea L. Czern.). Soil Biology and Biochemistry 37 241250.[CrossRef]
Belimov AA, Safronova VI, Mimura T. (2002) Response of spring rape to inoculation with plant growth-promoting rhizobacteria containing 1-aminocyclopropane-1-carboxylate deaminase depends on nutrient status of the plant. Canadian Journal of Microbiology 48 189199.[CrossRef][Web of Science][Medline]
Belimov AA, Safronova VI, Sergeyeva TA, et al. (2001) Characterisation of plant growth-promoting rhizobacteria isolated from polluted soils and containing 1-aminocyclopropane-1-carboxylate deaminase. Canadian Journal of Microbiology 47 642652.[CrossRef][Web of Science][Medline]
Bender CL, Alarcon-Chaidez F, Gross DC. (1999) Pseudomonas syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiology and Molecular Biology Reviews 63 266292.
Blaha D, Prigent-Combaret C, Mirza MS, Moenne-Loccoz Y. (2006) Phylogeny of the 1-aminocyclopropane-1-carboxylic acid deaminase-encoding gene acdS in phytobeneficial and pathogenic Proteobacteria and relation with strain biogeography. FEMS Microbiology Ecology 56 455470.[CrossRef][Medline]
Burd GI, Dixon DG, Glick BR. (1998) A plant growth promoting bacterium that decreases nickel toxicity in seedlings. Applied and Environmental Microbiology 64 36633668.
Bykova GA, Kabashnaya LV, Gvozdyak RI. (1991) Wilting of tomato plants under greenhouse conditions of North-West Russia. In: Protection of agricultural crops against insects, diseases and weedsSt-Petersburg Agricultural State University Press pp. 6568 [In Russian].
Chuang DY, Kyeremeh AG, Gunji Y, Takahara Y, Ehara Y, Kikumoto T. (1999) Identification and cloning of an Erwinia carotovora subsp. carotovora bacteriocin regulator gene by insertional mutagenesis. Journal of Bacteriology 181 19531957.
Dutta S and Biggs RH. (1991) Regulation of ethylene biosynthesis in citrus leaves infected with Xanthomonas campestris pv. citri. Physiologia Plantarum 82 225230.[CrossRef]
Feys BJF, Benedetti CE, Penfold CN, Turner JG. (1994) Arabidopsis mutants selected for resistance to the phytotoxin coronatine are male sterile, insensitive to jasmonate, and resistant to a bacterial pathogen. The Plant Cell 6 751759.
Glick BR, Karaturovic DM, Newell PC. (1995) A novel procedure for rapid isolation of plant growth promoting pseudomonads. Canadian Journal of Microbiology 41 533536.[Web of Science]
Glick BR, Liu C, Ghosh S, Dumbroff EB. (1997) Early development of canola seedlings in the presence of the plant growth-promoting rhizobacterium Pseudomonas putida GR12-2. Soil Biology and Biochemistry 29 12331239.[CrossRef]
Glick BR, Penrose DM, Li J. (1998) A model for the lowering of plant ethylene concentrations by plant growth-promoting bacteria. Journal of Theoretical Biology 190 6368.[CrossRef][Web of Science][Medline]
Hall JA, Peirson D, Ghosh S, Glick BR. (1996) Root elongation in various agronomic crops by the plant growth promoting rhizobacterium Pseudomonas putida GR12-2. Israel Journal of Plant Sciences 44 3742.[Web of Science]
Honma M and Shimomura T. (1978) Metabolism of 1-aminocyclopropane-1-carboxylic acid. Agricultural Biology and Chemistry 42 18251831.
Hontzeas N, Richardson AO, Belimov A, Safronova V, Abu-Omar MM, Glick BR. (2005) Evidence for horizontal transfer of 1-aminocyclopropane-1-carboxylate deaminase genes. Applied and Environmental Microbiology 71 75567558.
Hontzeas N, Saleh SS, Glick BR. (2004) Changes in gene expression in canola roots induced by ACC-deaminase-containing plant-growth-promoting bacteria. Molecular Plant Microbe Interactions 17 865871.[Web of Science][Medline]
Kenyon JS and Turner JG. (1992) The stimulation of ethylene synthesis in Nicotiana tabacum by the phytotoxin coronatine. Plant Physiology 100 219224.
Lund ST, Stall RE, Klee HJ. (1998) Ethylene regulates the susceptible response to pathogen infection in tomato. The Plant Cell 10 371382.
Mayak S, Tirosh T, Glick BR. (2004) Plant growth-promoting bacteria that confer resistance to water stress in tomatoes and peppers. Plant Science 166 525530.[CrossRef][Web of Science]
Momol T and Pernezny K. (2006) 2006 Florida plant disease management guide: tomato University of Florida IFAS (http://edis.ifas.ufl.edu/pdffiles/PG/PG05990.pdf).
Pegg GF and Cronshaw DK. (1976) The relationship of in vitro and in vivo ethylene production in Pseudomonas solanacearum infection of tomato. Physiological and Molecular Plant Pathology 9 145154.
Penrose DM, Moffatt BA, Glick BR. (2001) Determination of 1-aminocyclopropane-1-carboxylic acid (ACC) to assess the effects of ACC deaminase-containing bacteria on roots of canola seedlings. Canadian Journal of Microbiology 47 7780.[Medline]
Persello-Cartieaux F, David P, Sarrobert C, Thibaud MC, Achouak W, Robaglia C, Nussaume L. (2001) Utilization of mutants to analyze the interaction between Arabidopsis thaliana and its naturally root-associated Pseudomonas. Planta 212 190198.[CrossRef][Web of Science][Medline]
Preston GM. (2004) Plant perceptions of growth-promoting Pseudomonas. Philosophical Transactions of the Royal Society. B. Biological Sciences 359 907918.[CrossRef][Medline]
Reiter B, Wermbter N, Gyamfi S, Schwab H, Sessitch A. (2003) Endophytic Pseudomonas spp. populations of pathogen-infected potato plants analysed by 16S rDNA- and 16S rDNA-based denaturating gradient gel electrophoresis. Plant and Soil 257 397405.[CrossRef][Web of Science]
Robison MM, Shah S, Tamot B, Pauls KP, Moffatt BA, Glick BR. (2001) Reduced symptoms of Verticillum wilt in transgenic tomato expressing a bacterial ACC deaminase. Molecular Plant Phytology 2 135145.[CrossRef]
Ross IL, Alami Y, Harvey PR, Achouak W, Ryder MH. (2000) Genetic diversity and biological control activity of novel species of closely related pseudomonads isolated from wheat field soils in South Australia. Applied and Environmental Microbiology 66 16091616.
Safronova VI, Stepanok VV, Engqvist GL, Alekseyev YV, Belimov AA. (2006) Root-associated bacteria containing 1-aminocyclopropane-1-carboxylate deaminase improve growth and nutrient uptake by pea genotypes cultivated in cadmium supplemented soil. Biology and Fertility of Soils 42 267272.[CrossRef][Web of Science]
Sakai R. (1980) Comparison of physiological activities between coronatine and indole-3-acetic acid to some plant tissues. Annals of the Phytopathological Society of Japan 46 499503.
Sikorski J, Jahr H, Wackernagel W. (2001) The structure of a local population of phytopathogenic Pseudomonas brassicacearum from agricultural soil indicates development under purifying selection pressure. Environmental Microbiology 3 176186.[CrossRef][Medline]
Simon R, Prifer U, Pühler A. (1983) A broad range mobilization system for in vitro genetic engineering: transposon mutagenesis in Gram-negative bacteria. Biotechnology 1 784791.[CrossRef]
Suarez A, Guttler A, Stratz M, Staendner LH, Timmis KN, Guzman CA. (1997) Green fluorescent protein-based reporter systems for genetic analysis of bacteria including monocopy applications. Gene 196 6974.[CrossRef][Web of Science][Medline]
Sutra L, Siverio F, Lopez MM, Hunault G, Bollet C, Gardan L. (1997) Taxonomy of Pseudomonas strains isolated from tomato pith necrosis: emended description of Pseudomonas corrugata and proposal of three unnamed fluorescent Pseudomonas genomospecies. International Journal of Systematic Bacteriology 47 10201033.
Van Loon LC, Bakker AHM, Pieterse CMJ. (1998) Systemic resistance induced by rhizosphere bacteria. Annual Review of Phytopathology 36 453483.[CrossRef][Web of Science][Medline]
Van Loon LC and Glick BR. (2004) Increased plant fitness by rhizobacteria. In Sandermann H (Ed.). Molecular ecotoxicology of plants, Ecological StudiesBerlin/Heidelberg Springer-Verlag Vol. 170 pp. 177205.
Weingart H and Volksch B. (1997) Ethylene production by Pseudomonas syringae pathovars in vitro and in planta. Applied and Environmental Microbiology 63 156161.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
F. Jiang and W. Hartung Long-distance signalling of abscisic acid (ABA): the factors regulating the intensity of the ABA signal J. Exp. Bot., January 1, 2008; 59(1): 37 - 43. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




