JXB Advance Access originally published online on March 9, 2007
Journal of Experimental Botany 2007 58(7):1729-1740; doi:10.1093/jxb/erm033
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2007 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.This paper is available online free of all access charges (see http://jxb.oxfordjournals.org/open_access.html for further details)
RESEARCH PAPER |
Comparing nitrate storage and remobilization in two rice cultivars that differ in their nitrogen use efficiency
1College of Resources and Environmental Sciences, Nanjing Agricultural University, Nanjing 210095, PR China
2Crop Performance and Improvement Division, Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK
* To whom correspondence should be addressed. E-mail: tony.miller{at}bbsrc.ac.uk or shenqirong{at}njau.edu.cn
Received 4 October 2006; Revised 2 January 2007 Accepted 25 January 2007
| Abstract |
|---|
|
|
|---|
Soil nitrogen (N) is available to rice crops as either nitrate or ammonium, but only nitrate can be accrued in cells and so factors that influence its storage and remobilization are important for N use efficiency (NUE). The hypothesis that the ability of rice crops to remobilize N storage pools is an indicator of NUE was tested. When two commonly grown Chinese rice cultivars, Nong Ken (NK) and Yang Dao (YD), were compared in soil and hydroponics, YD had significantly greater NUE for biomass production. The ability of each cultivar to remobilize nitrate storage pools 24 h after N supply withdrawal was compared. Although microelectrode measurements of the epidermal sub-cellular nitrate pools in leaves and roots showed similar patterns of vacuolar remobilization in both cultivars, whole-tissue analysis showed very little depletion of storage pools after 24 h. However, leaf epidermal cell cytosolic nitrate activities were significantly higher in YD when compared with NK. Before N starvation and growing in 10 mM nitrate, the xylem nitrate activity in YD was lower than that of NK. After 24 h of N starvation the xylem nitrate had decreased more in YD than in NK. Tissue analysis of stems showed that YD had accumulated significantly more nitrate than NK, and the remobilization pattern suggested that this store is important for both cultivars. Changes in nitrate reductase activity (NRA) and expression were measured. Growing in 10 mM nitrate, NRA was undetectable in roots of both cultivars, and the leaf total NRA of equivalent leaves was similar in NK and YD. When the N supply was withdrawn, after 24 h NRA in NK was reduced to 80% but no decrease was found in YD. The proportion of NRA in an active form in YD was significantly higher than that in NK under both nitrate supply and deprivation conditions. Checking NR gene expression showed that leaf expression of OsNia1 was faster to respond to nitrate deprivation than OsNia2 in both cultivars. These measurements are discussed in relation to cultivar differences and physiological markers for NUE in rice.
Key words: Cellular nitrate activities, nitrate reductase, nitrogen use efficiency, rice, vacuolar remobilization
| Introduction |
|---|
|
|
|---|
Ammonium is the main nitrogen (N) form available to rice roots growing under anaerobic paddy conditions, but in aerobic and upland soils nitrate is the main N source. Rice (Oryza sativa L.) grows well in both mixed and single source nitrate and ammonium supplies (Chanh et al., 1981; Youngdahl et al., 1982). In common with most plants, rice can accumulate nitrate but not ammonium within its tissues and this N store may be important for later growth and grain filling. For cultivation, rice is usually first grown in aerobic nursery soil beds where nitrate is the main form of available N. Later japonica rice seedlings are transplanted into flooded soil that is anaerobic and the plant is then chiefly supplied with ammonium as an N source. Rice of the indica type can be continuously grown in aerobic soils and therefore has access to nitrate that may be stored in the leaves. Both these types of rice can accumulate nitrate in the leaf when supplied with this N form (Fan et al., 2005) but it was felt necessary to test if japonica rice has a greater capacity to store, and subsequently remobilize, vacuolar stored nitrate. The term N use efficiency (NUE) can be defined in several different ways and it is likely to be regulated by many different genes (reviewed by Gallais and Hirel, 2004; Good et al., 2004). During grain filling the ability of a plant to remobilize leaf-stored N is an important factor for NUE in crops, and has been strongly implicated in quantitative trait locus (QTL) studies with cereals (Mickelson et al., 2003). However, much less is known about NUE during the earlier vegetative stages of cereal development when biomass is accumulating. Yet this growth stage is important because it occurs when rainfall is heavy and leaching losses are maximal. In cells, vacuolar nitrate may provide a store that maintains cellular assimilation and thereby optimizes N utilization. Remobilization of vacuolar nitrate stores can be measured by removing all N supply from a growing plant (van der Leij et al., 1998) and in this work this treatment has been used to test the response of two rice cultivars that differ in their NUE.
Leaf tissue or sap nitrate concentrations are used as indicators of a plant's N status and this fact is exploited by farmers when making decisions on fertilizer application rates (Schepers et al., 1992). Measurements of leaf tissue nitrate primarily determine nitrate stored in the vacuole. However, vacuolar nitrate accumulation within cereal leaf cells differs; the highest concentrations accumulate in epidermal cells (Fricke et al., 1994). Barley root epidermal and cortical cell vacuolar nitrate can be remobilized during times of N deficiency and this source can maintain cytosolic nitrate concentrations in the short term (van der Leij et al., 1998). Some recent papers have suggested that there is a close link between cytosolic nitrate activity and nitrate reductase activity (NRA). For example, in leaf cells of Arabidopsis (Cookson et al., 2005) and barley root cells (Fan et al., 2006), changes in cytosolic nitrate activity could be measured under conditions when cellular NRA was altered. As cytosolic nitrate activity is important for determining the thermodynamic gradients for transport to and from the vacuole (Miller and Smith, 1992; De Angeli et al., 2006) how NRA and mRNA expression changed during the remobilization of stored nitrate has also been examined.
In order to study the relationship between NUE and key steps determining N distribution within the plant such as vacuolar storage and cytosolic nitrate activity these parameters were compared in two crop cultivars. Two rice cultivars were used for these measurements because this species shows large variation in NUE (Koutroubas and Ntanos, 2003; Peng et al., 2006). Rice cultivation is particularly wasteful as large amounts of applied N fertilizer are lost into the surrounding environment (Vlek and Byrnes, 1986). The rice cultivars used in this study have differing levels of N accumulation efficiency when grown in soil or hydroponics with either nitrate or ammonium. In an earlier study, two Chinese rice cultivars were shown to have differing nitrate uptake rates when supplied with 1 mM nitrate: Nong Ken (NK, japonica) taking up less than Yang Dao (YD, indica) (Fan et al., 2005). Furthermore, the pattern of nitrate transporter expression (OsNRT1.1 and OsNRT2.1) was different in the two cultivars (Fan et al., 2005). These cultivars were chosen for this further study, first to compare their NUE and then to measure how their physiological properties differ.
| Materials and methods |
|---|
|
|
|---|
Plant material
Rice seeds of the cultivars Nong Ken (NK, japonica) and Yang Dao (YD, indica) were surface sterilized in 3% (v/v) H2O2 for 10 min, then rinsed and and allowed to imbibe for 48 h in aerated distilled water maintained at 30 °C. After a further 24 h, germinated seeds were placed in 400 ml pots and cultivated in a 30 °C controlled-environment chamber, with a 15 h day and a relative humidity at 65±5%. Rice seedlings were grown in quarter-strength IRRI rice nutrient solution (pH 5.5) for 4 weeks arranged in a randomized block design. Nitrogen was supplied as Ca(NO3)2 at 0.5 mM for the first 2 weeks and then, unless stated otherwise, 5 mM was used for the final 2 weeks (in some experiments 0.5 mM or 1.25 mM was used). Other nutrients were added as follows: 2 mM K2SO4, 2 mM MgSO4, 1 mM CaCl2, 0.3 mM NaH2PO4, 40 µM Fe-EDTA, 9 µM MnCl2, 25 µM (NH4)6Mo7O24, 20 µM H3BO3, 1.5 µM ZnSO4, and 1.5 µM CuSO4. Diluted HCl and NaOH were added to maintain a pH of 5.5 and this was monitored daily using a hand-held pocket-size pH meter (model 868, Thermo Orion, USA). Nutrient solutions were replaced with fresh solution every 2 d.
Whole tissue N, nitrate, and NRA
The whole roots were used for tissue nitrate analysis. Mid-leaf sections, 4 cm long, were cut from the first two fully expanded leaves and used for nitrate, NRA, and gene expression analysis. For stem analysis, all the green tissue from the top of the root to the fourth leaf ligule was used. All this plant tissue was sampled 5 h into the light period. For nitrate analysis, the leaf or root tissue was frozen in liquid N and then 1 g of the tissue was finely ground using a pestle and mortar; the resulting powder was then extracted with 20 ml of deionized, distilled water. This mixture was boiled for 30 min and made up to 100 ml when it was cool. The mixture was filtered through a filter paper (Whatman no. 2, 9 cm) and, for the shoot material, before it was filtered 0.2 g of active carbon was added to eliminate the effect of the chlorophyll. Nitrate analysis of the supernatant was performed using a continuous-flow autoanalyser (model Autoanalyser 3, Bran & Luebbe, Germany). For total N analysis, 0.1 g of oven-dried and ground tissue samples was weighed into 100 ml Kjeldahl digestion flasks. To each flask was added 5 ml of concentrated H2SO4 and the flask was gently heated. When frothing had ceased, the heat was increased to 280 °C and then 30% H2O2 (v/v) was added to the flask intermittently until the digest cleared. After complete digestion the flask was allowed to cool and water was slowly added to make up the volume to 100 ml. A 5 ml sample was then analysed for total N using a continuous-flow autoanalyser (model Autoanalyser 3, Bran & Luebbe).
NRA was measured using a modified method based on that reported previously (Botrel and Kaiser, 1997). Frozen tissue samples (about 1.0 g) were ground to a fine powder using a chilled mortar and pestle in the presence of acid-washed sand. Samples were homogenized with 5 ml of extraction buffer. Extraction buffers contained 50 mM HEPES-KOH (pH 7.6), 10 mM cysteine, and 10 mM MgCl2 (for NRAact) or 5 mM EDTA (for NRAmax). The homogenates were centrifuged at 30 000 g for 15 min, and the supernatants were assayed for NADH-NRA (Botrel and Kaiser, 1997).
Comparison of N use between two rice cultivars
These experiments were conducted in soil in a controlled environment cabinet at 28 °C with a 16 h photoperiod with a photon flux density of 460490 µmol m2 s1. Soil was analysed and the basic composition was as follows: organic matter 28.9 mg g1, total N 1.2 mg g1, NH4+-N 1.2 mg kg1, NO3-N 7.4 mg kg1, pH (water:soil, 1:2.5) 6.1, and clay size (<2 µm). The soil was air dried and sieved (1 mm pore size), and urea (30 mg.N kg1) and K2HPO4 (93 mg kg1) were mixed into it. Each pot was filled with 600 g of soil, and three seedlings were planted in each. The pot was flooded with water to 1 cm depth 3 weeks after germination, and this was maintained at this level throughout the growth of the rice plants. Three replicate pots were used and all plant samples were harvested 4 h after the start of the light period. Tissue N analysis of the rice plants was then used to determine the amounts accumulated by the plant and then this was expressed relative to the whole plant dry biomass (see Koutroubas and Ntanos, 2003).
Plants were harvested at 44, 51, and 58 d after germination; these plants were older than those grown in hydroponic culture.
Nitrate-selective microelectrodes
Double-barrelled nitrate-selective microelectrodes were prepared, calibrated, and used to record from root cells using the method described previously (Miller and Zhen, 1991; Zhen et al., 1991). For these microelectrode impalements a single primary root (not seminal) of intact rice plants was held in a Plexiglas chamber (volume 2.0 ml) and washed with a flowing solution (containing 5 mM MES, 0.5 mM CaCl2, and 0.05 mM KCl at pH 6.0) at a flow rate of 1 ml min1 as described previously (Walker et al., 1995). Nitrate was added as Ca(NO3)2 to the solution. The chamber was mounted on the stage of an Olympus microscope (model SZX9). Microelectrodes were prepared using filamented double-barrelled borosilicate glass as described previously (Zhen et al., 1991) mounted on a micromanipulator (model NMN-21, Narashige, Japan). All root microelectrode measurements were obtained from mature cells 12 cm from the root tip (Zhen et al., 1991). Both microelectrode reference barrels and reference electrodes were backfilled with 100 mM KCl. Only electrode recordings which gave identical calibration curves before and after the cell measurements were considered acceptable. For leaves, a different type of Plexiglas chamber was used with a sloping wall. In the middle of the wall there was a 2.5x1x0.5 cm hole and a tie to hold the tissue in place during the recording. This design was modified from a chamber described previously (Miller et al., 2001; Cookson et al., 2005). The electrophysiology solution covered half of the leaf area, and the site for impaling was just above the liquid surface. The chamber was placed on the stage of a dissecting microscope (model SZX9, Olympus, Japan) for the recordings and the plant was intact for the measurement but the leaf was placed in the chamber for at least 1 h before impalement. The photon flux density of photosynthetically active radiation at the leaf surface was around 300 µmol m2 s1, measured using the Photosynthetic Determination System, ZID310 (Harvard Centre for International Development, USA). The leaf was illuminated by the microscope light throughout the microelectrode recording and under these conditions, although a change in the membrane potential could be measured during light/dark transitions, no change in cytosolic nitrate could be detected (data not shown), confirming previously reported results for Arabidopsis leaf epidermal cells (Cookson et al., 2005). Only fully expanded cells of the upper leaf epidermis in the middle of the leaf were used for the nitrate microelectrode measurements. This was the same region of the leaf that was used for tissue nitrate and NRA assays (see above).
Xylem sap samples
Xylem nitrate concentration can vary with the time of day and the part of the plant which is sampled (Siebrecht et al., 2003) so care was taken to avoid these possible sources of error. The stems of 4-week-old rice seedlings were cut 5 cm below the uppermost leaf node (ligule). Sap samples exuding from this cut surface were collected from 1900 h to 0700 h (i.e. 12 h overnight) by absorption into a cotton wool pad (0.4 g) placed on the cut surface. The cotton wool was inside the base of a 25 ml centrifuge tube that was then inverted over the top of the plant. Parafilm was placed around the planttube interface to minimize evaporation of the sap sample. After 12 h exudation, the cotton wool containing the sap sample was placed in a 5 ml Gilson disposable tip and then extracted using a Beckmann centrifuge model JA-21 (12 096 g for 5 min) with the tip down in a 50 ml centrifuge tube. After this time of centrifugation, all the sap was extracted from the cotton wool (this was established by preliminary experiments; data not shown). Sap sample volumes ranged from approximately 1 ml to 0.4 ml. Nitrate-selective microelectrodes were used to measure the nitrate activity in these sap samples.
Semi-quantitative RT-PCR of OsNia1 and OsNia2
Semi-quantitative RT-PCR was used to evaluate the level of nitrate reductase gene expression in roots and leaves. Total RNA was isolated from rice tissue using TRIZOL reagent (Invitrogen). Two milligrams of total RNA from each source was reverse-transcribed using M-MLV reverse transcriptase (Promega, Madison, WI, USA) and oligo(dT) 30 primers (AAGCAGTGGTAACAACGCAGAGTAC(T)30N-1 (Promega, Madison, WI, USA). OsActin (ActF, 5'-TTATGGTTGGGATGGGACA-3'; ActR, 5'-AGCACGGCTTGAATAGCG-3') was a standard reference to normalize the quantity of total RNA used in each sample in the following cycle conditions: 95 °C for 2 min followed by 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, using a Bio-RAD cycler. The cycle number that corresponded to the linear phase of this PCR was identified as described previously (Orsel et al., 2002) and 25 cycles were used in subsequent PCRs for all treatments to identify variation in the cDNA product yield. The appropriate volume needed to standardize each treatment relative to that of the test treatment was determined empirically and used in all subsequent PCR. Two cytosolic nitrate reductase genes OsNia1 and OsNia2 were PCR amplified using the standardized volumes. The specific primer sets for OsNia1 (AK102363
[GenBank]
) encoding the NADH-specific NR (EC1.7.1.1 rice) and OsNia2 (AK102178
[GenBank]
) putatively encoding the NAD(P)H-bispecific NR (BlastX EC1.7.1.2 (formerly EC1.6.6.2) HvNia7 barley) were Nia1-F, 5'-CCAATTCTTTCATCGTGTTCT-3'; Nia1-R, 5'-CATGCAGCATTTCGTTTCT-3'; and Nia2-F, 5'-GGAGGACGGGTGGGAGTA-3'; Nia2-R, 5'-TTCAGAAGACGAGGCAGGAC-3', respectively. The PCR conditions were used for OsNia1, OsNia2, and OsActin. The approximate product sizes were 190 bp for OsNia1, 150 bp for OsNia2, and 290 bp for OsActin. Amplified fragments were analysed by electrophoresis on 1.5% agarose gels and visualized by staining with ethidium bromide. To check further that the amplified products were correct, fragments were then cloned in PMD18-T vector (TaKaRa) and sequenced. The nucleotide sequences were compared with those released sequences in GenBank using the BLAST program.
Statistical analysis of data
Two-way ANOVA and the t-test were used to compare data for the two cultivars and for before and after N starvation using the Genstat software (GenStat 7th edition, Lawes Agricultural Trust, Rothamsted Research, UK).
| Results |
|---|
|
|
|---|
First it was confirmed that there are significant differences in N utilization efficiency by the two cultivars. For these measurements the plants were grown in soil that was later flooded according to the traditional method of rice cultivation (see Materials and methods). These measurements showed that throughout the period 4458 d the cultivar YD consistently showed significantly greater NUE for biomass accumulation when compared with NK (Fig. 1A). Similarly, in hydroponic culture, YD also showed greater NUE than NK at both 1 mM and 10 mM nitrate supply (Fig. 1B). In addition, biomass NUE for both cultivars significantly increased at 10 mM nitrate when compared with nitrate supplied at 1 mM. However, the increase in NUE at 10 mM over that at 1 mM was not significantly different between cultivars (Fig. 1B). Additional experiments comparing the two cultivars in hydroponic culture supplied with a mixed nitrate and ammonium supply (1.25 mM NH4NO3) also showed YD to be always better at N interception and use (data not shown).
|
The two rice cultivars were grown in hydroponic culture for 4 weeks in either a mixed N supply (5 mM NH4NO3) or in 10 mM nitrate [5 mM Ca(NO3)2] to compare biomass production. The root and shoot dry weights are shown in Fig. 2. The data showed that the seedlings produced similar amounts of root and whole plant biomass that were not significantly different when supplied with the same amounts of N, and this growth did not depend on the form of the nitrate supply, nitrate or ammonium (Fig. 2). However, in 10 mM nitrate NK shoots produced significantly less biomass than YD shoots growing in N supplied either as nitrate or mixed (P <0.05).
|
After growing the rice plants in 10 mM nitrate for 14 d all external N supply was withdrawn. Figure 3 shows the time course for changes in tissue nitrate during this N starvation and, during this 24 h period, the pattern of tissue nitrate remobilization was different in each cultivar. Tissue nitrate concentrations ranged from only 10 mM to 30 mM (Fig. 3). In roots of both cultivars there was little change in tissue nitrate, only the last measurement after 24 h starvation showed a small significant decrease in YD that was not measured in NK. In the leaves a more complicated pattern was found that showed no significant change at the end of this 24 h period in either cultivar. The pattern of these changes was complicated by the diurnal changes in tissue nitrate pools (Steingrover et al., 1986) and, for this reason, the light/dark periods are shown (Fig. 3). However, in the leaves and roots of NK, even after 24 h, there was no significant decrease in tissue nitrate. When the nitrate remobilization was looked at in more detail using microelectrodes in specific tissues a different pattern emerged.
|
To measure the nitrate status of individual cells, double-barrelled ion-selective microelectrodes were used in root and leaf cells of rice seedlings. Figure 4 shows an example of a microelectrode recording obtained from a root rhizodermal cell. In this measurement the tip first records a nitrate value of around 65 mM and the membrane potential was around 90 mV. After 15 min the nitrate value had slowly changed to a lower value of around 3 mM and the membrane potential had become more negative at 110 mV. This recording was unusual because the measurement was obtained from two different compartments of the same cell and these values correspond to the cytoplasmic and vacuolar compartments (Zhen et al., 1991). The change in compartmental location of the electrode tip occurred spontaneously without any adjustment of the micromanipulator. Later during the recording (20 min) the N supply was removed but this treatment did not change the nitrate activity reported in the cell (Fig. 4). Many measurements were obtained in this way for leaves and roots of the two rice cultivars. A summary of the mean vacuolar and cytosolic nitrate activities in root rhizodermal and leaf epidermal cells is shown in Fig. 5. There were no significant differences between the mean vacuolar nitrate activities of the two cultivars (Fig. 5A). These vacuolar nitrate activities in epidermal cells are generally higher than those concentrations measured in the whole tissue (comparing Figs 3 and 5A). In contrast, for leaf cells, in YD the mean cytosolic nitrate activity (5.9 mM) was significantly higher than that in NK (2.9 mM), but there were no significant differences between the cultivars in the root cell cytosolic nitrate activities (Fig. 5). Microelectrode measurements have shown previously that, in barley, the epidermal layer of root cells was mobilized faster than the cortical cells during N starvation (van der Leij et al., 1998). Figure 6 shows nitrate microelectrode measurements of the outer layer of cells in the leaf and root for the two cultivars for the 24 h after withdrawal of the external N supply. Cytosolic and vacuolar measurements were assigned according to the separation of the two populations at time t=0 and the values in Fig. 5. However, for NK leaf cells there was considerable spread of the data points, and vacuolar compartmental assignment was difficult for some of the lower values (Fig. 6C). In YD, leaf cell cytosolic nitrate was maintained at a significantly higher activity than that measured in other cell types during the remobilization period (Fig. 6D). All these cellular measurements show significant remobilization of epidermal vacuolar nitrate pools in roots and leaves of both cultivars. Lines with similar exponential shapes could be fitted through all the vacuolar nitrate measurements (Fig. 6), and equation parameters were compared (see Table 1) for the rates of nitrate remobilization in different tissues and cultivars. The parameter a obtained from these fits, like the mean vacuolar nitrate activities (Fig. 5A), reflects the size of vacuolar nitrate pools (between 40 mM and 55 mM) before starvation. While Fig. 5 showed no significant differences between cultivars and tissues before N supply withdrawal, the parameter a for YD roots was significantly different from the value for NK leaves (Table 1).
|
|
|
|
Also the xylem sap nitrate activities of the two rice cultivars were compared. These measurements showed significant differences between the two cultivars (Fig. 7A) with NK showing a higher value even after 24 h N starvation relative to YD. Comparing the sap volumes shows that YD produced more over the same time period but NK delivers a greater total amount of nitrate in the xylem (Fig. 7B, C). After 24 h of N starvation both cultivars showed increased sap volume (Fig. 7B) but the xylem nitrate content had decreased relatively more in YD than in NK (Fig. 7C; by 94% for YD, by 79% for NK). Two-way ANOVAs comparing the differences between nitrate content data (Fig. 7C) for the two cultivars were highly significant (P <0.01). Also N withdrawal had a huge effect on both varieties, but a greater effect on YD than NK. To compare and confirm this result, xylem sap nitrate was also measured in rice seedlings of the same age grown hydroponically in 2.5 mM nitrate, and the same pattern of differences between the two cultivars was observed (data not shown).
|
The expression pattern of NR and the activity of the enzyme was measured and compared in both cultivars before and after 24 h of N starvation. There was decreased expression of OsNia1 and OsNia2 in both YD and NK leaves after N starvation (Fig. 8A, B). In rice, like barley (Sueyoshi et al., 1995), the transcript levels of both genes were decreased, but for OsNia1 the effect was greater than for OsNia2 (Fig. 8A, B). Pooling the results in Fig. 8B, C for both cultivars showed there was only a strong correlation between OsNia1 transcript and NRAact (r=0.97, P <0.05). The activity of NR is regulated by reversible Mg-dependent phosphorylation, which has been shown to be responsible for the light-regulated fluctuations observed in its activity in leaf tissue (Tucker et al., 2004). Phosphorylation enables a 14-3-3 inhibitory protein to interact with the NR enzyme and suppress its activity (reviewed by Kaiser and Huber, 2001; Kaiser et al., 2002). Consequently, in the presence of MgCl2, only the NR that is active in vivo is measured, whereas in the absence of MgCl2 a measurement of the total activity is obtained. Before N starvation the total NRA (NRAmax, NRA-Mg2+ maximum) was similar in both YD and NK leaves (Fig. 8C). After 24 h N starvation NRAmax had significantly decreased by 80% in NK but not YD (P <0.01). A different pattern was observed for NRAact (NRA+Mg2+ active) in the two cultivars. Before N starvation NRAact was significantly greater in YD than NK leaves. In fact NRAact and NRAmax were not significantly different in YD but only 27% NR was active in NK leaves. After 24 h N starvation, NRAact was decreased in both YD and NK leaves. Following N withdrawal 44% NR was in the active form in YD while 29% of NR was active in NK leaves (see Fig. 8C).
|
As leaf tissue nitrate pools did not significantly decrease in either cultivar 24 h after the withdrawal of N supply, stem nitrate pools were also compared (see Fig. 9). Statistical analysis of these tissue measurements showed a significantly higher amount (Fig. 9A) and concentration (Fig. 9B) present in YD stems when compared with NK before removal of the N supply to the roots. The amount of stem nitrate in YD and NK decreased significantly after 24 h of N withdrawal (Fig. 9A), but only NK showed a significant decrease in stem nitrate concentration (Fig. 9B). These results suggest that there may be a difference between cultivars in the stem water content that is associated with the remobilization of vacuolar stored nitrate. However, the percentage water content was not significantly different between cultivars (data not shown).
|
| Discussion |
|---|
|
|
|---|
Nitrogen use efficiency is relatively low in a flooded rice crop because of N losses through denitrification, ammonia volatilization, run-off, and leaching (Vlek and Byres, 1986). Previous work has reported considerable variation in N utilization by field-grown rice, and this occurs for both grain and biomass production (Koutroubas and Ntanos, 2003, and references therein). It has been demonstrated in the present study that these two Chinese rice cultivars show significantly different levels of NUE for biomass production in both hydroponic and soil culture (Fig. 1). Biomass production was very similar under mixed N or nitrate only supply for both cultivars (Fig. 2), but YD consistently showed better NUE (Fig. 1). This effect on biomass production for these cultivars at lower N supply has been reported previously (Fan et al., 2005). The hypothesis that differences in the ability to remobilize stored nitrate may help explain the improved NUE shown by YD when judged against NK was tested. The higher grain-yielding japonica rice NK (Fan et al., 2005) showed poorer NUE for biomass production when compared with the indica rice YD. NUE for grain yield in these two cultivars has not been measured and this parameter has more obvious practical value for crops but it must subsume the term for biomass. Here the focus has been on biomass NUE because nitrate pools are more likely to be important for vegetative growth, and environmentally damaging leaching losses occur during this developmental stage. The difference in biomass NUE reported here probably reflects a distinction between these cultivars and is not a general feature of japonica and indica rice. In field experiments, when several different cultivars of japonica and indica rice were compared, the results showed no significant differences in NUE between the two types of rice for both grain yield and biomass production (Koutroubas and Ntanos, 2003).
Cellular nitrate pools
Whole tissue nitrate gives a measure of cortical (root) and mesophyll (leaf) cell vacuolar concentrations (Zhen et al., 1991; Cookson et al., 2005). Microelectrode measurements in epidermal cells gave higher vacuolar activities than those values measured in whole tissue, which is dominated by the cortical and mesophyll cells (comparing Figs 3 and 5A). Taken together these data suggest that nitrate is preferentially stored in the vacuoles of rice epidermal cells. Single cell micro-sampling methods in barley leaves have previously shown that nitrate was preferentially stored in the upper epidermis, and this pattern was independent of light supply and development (Fricke et al., 1994). These results suggest that nitrate accumulation in the upper leaf epidermis may be a more general feature of cereal crops.
Measuring whole tissue nitrate changes after 24 h of N starvation provided some evidence that the cultivar YD depleted root vacuolar nitrate pools faster than NK (Fig. 3), but more data beyond 24 h starvation are needed to check if this trend continues. As YD had better NUE than NK, the accessibility of vacuolar nitrate pools may be worthy of more investigation. In the epidermal layer of barley root cells, vacuolar stored nitrate was mobilized faster than that in the cortical cells (van der Leij et al., 1998), and in these roots the time course for remobilization of nitrate stored in cortical cell vacuoles was similar to that measured in the whole roots. Microelectrode measurements of vacuolar and cytosolic nitrate pools in the outer cell layers of leaves and roots showed significant differences in the rate of nitrate remobilization (b in Table 1) only between leaves and roots in YD (Fig. 6B, D) but not in NK or between cultivars (Fig. 6A, C). Interestingly, both before and after N supply withdrawal the steady-state cytosolic nitrate activity of YD leaf epidermal cells was significantly higher than that measured in equivalent cells of NK (Figs 5 and 6). These differences between leaf cells are not related to photosynthetic activity of the cells (Cookson et al., 2005) as epidermal cells of both cultivars have no green plastids. Furthermore, the cytosolic nitrate activities of both cultivars are not significantly different in root cells. As YD has better NUE than NK, a higher leaf epidermal cytosolic nitrate activity (Fig. 5B) may contribute to this trait in rice and may result from a different tissue distribution of NRA in leaves of the two cultivars (Cookson et al., 2005).
Nitrate reductase activity
The vacuole is the site of nitrate storage in cells (Miller and Smith, 1996; van der Leij et al., 1998; Kronzucker et al., 2000; Miller et al., 2001). In plant cells several different processes contribute to establish an equilibrium that determines the size of cytosolic and vacuolar nitrate pools, and the importance of these can be different in leaf and root cells. For example, in the Arabidopsis leaf mesophyll cell, cytosolic nitrate activity was very dependent on NRA (Cookson et al., 2005). In contrast, in a rice root, as NRA was not detectable the cytosolic nitrate pool was maintained by nitrate uptake across the plasma membrane, transport across the vacuole, and the nitrate translocation into xylem. Barley roots have measurable NRA (van der Leij et al., 1998) but in the root epidermal cells of both species the removal of the external nitrate supply has no short-term effect on cytosolic nitrate activity. These results suggest that the vacuole restores cytosolic nitrate activity in these cells and this is demonstrated by the decrease in this storage pool (remobilization) shown in Fig. 6.
In the leaf, NRA may be an important factor determining nitrate utilization by the rice plants. In both cultivars, withdrawal of N supply has decreased both nia transcripts and NRAact (Fig. 8AC), but YD consistently maintained a higher proportion of NRAact before and after N starvation (Fig. 8C). The higher cytosolic nitrate activity (Fig. 5B) and faster rates of leaf vacuolar nitrate remobilization (Fig. 6; Table 1) in YD may be important factors for maintaining NRAact and OsNia expression in this cultivar. In barley, the expression of both NADH and NAD(P)H NRA was suggested to be dependent on nitrate flux (Sueyoshi et al., 1995). Alternatively, the greater NRA in YD, relative to NK, will provide a stronger sink pulling nitrate from the epidermal cell vacuoles and xylem sap (Fig. 6D). Previous work studying the cause of diurnal changes in N metabolism of tobacco leaves suggested that an imbalance between nitrate reduction, uptake, and ammonium metabolism early in the light period gave rise to the changes in leaf metabolite pools including nitrate (Matt et al., 2001). Matt et al. (2001) suggested that the ability to increase NRA rapidly might be a selective advantage in a less-favourable environment. An ability to maintain nitrate assimilation during the withdrawal of N supply might be important for NUE. The fact that YD maintained higher NRAact even after N starvation provides support for this idea.
Xylem sap nitrate
The fact that the xylem sap nitrate concentration was higher in NK when compared with YD (Fig. 7A) might suggest a greater net transfer from root to shoot in NK. The nitrate concentration of xylem sap is often used as an indicator of the N status of a plant as there is good evidence that this parameter, like NRA, increases in a way that is directly dependent on the concentration of the external supply (Andrews, 1986). N starvation decreased the nitrate concentration of the xylem sap of both cultivars (Fig. 7A). During the first 24 h of N supply withdrawal there was some evidence that the roots of YD remobilized more nitrate than NK (Fig. 3). The measurements of xylem sap nitrate content during this N starvation period provide evidence for a larger relative decrease in delivery of nitrate to the shoot in YD when compared with NK (Fig. 7C). However, NK under both conditions was actually supplying more nitrate to the shoot than YD even after 24 h of N starvation. So where is this nitrate coming from as the external supply has been removed and there is no evidence of a significant decrease in leaf tissue nitrate for NK during this time? Leaf tissue nitrate measurements were made at the middle of a 4 cm section of the emerged leaf, as the stem store, including the younger parts of the leaf, is a possible source. Analysis of stem tissue showed that there was significantly more nitrate stored in this tissue in YD when compared with NK (Fig. 9) but both cultivars remobilize this nitrate source after 24 h of N starvation. This stem portion of the plant provides nitrate that maintains xylem delivery to the leaf in both cultivars. The two cultivars show differing relationships between nitrate contents of the xylem sap and stemNK has more nitrate in the xylem and less accumulation in the stem while YD shows the opposite pattern. These results suggest that there is little value in xylem sap analysis for comparing crop N status between cultivars. The different responses of stem and xylem sap nitrate during short-term N starvation shown by the two cultivars may suggest important relationships between these parameters and NUE that are worthy of further investigation.
Rice shows a slower decrease in vacuolar and xylem nitrate during N starvation when compared with barley (Sueyoshi et al., 1995; van der Leij et al., 1998). Nonetheless, like barley, both rice cultivars showed a pattern of vacuolar nitrate remobilization to maintain the nitrate activity in the cytoplasm (Figs 3 and 6), but, in contrast to barley, less efflux of cytosolic nitrate into xylem when N starved. The fact that the lower NUE cultivar has higher xylem sap nitrate might suggest that NUE is negatively correlated with this parameter. This result may suggest that nitrate is accumulating in the xylem sap and that NK may not be so efficient at unloading; this build up might provide another negative feedback signal to leaf NRA.
| Conclusions |
|---|
|
|
|---|
Among Chinese rice cultivars there appears to be great scope for improving NUE (Peng et al., 2006). The two Chinese rice cultivars chosen for this study showed consistently significant differences in NUE for biomass accumulation in soil and hydroponics with both nitrate and mixed N supplies. Cellular nitrate pools are important for both tissue expansion and N storage during vegetative growth (McIntyre, 1997). This developmental stage is when the most environmentally damaging leaching losses from the crop occur (Peng et al., 2006). A comparison of nitrate physiology during the withdrawal of N supply was used to identify some differences between the two cultivars that are likely to be important for NUE. These cultivar differences for rice can be listed as follows.
- (i) Leaf epidermal cell cytosolic nitrate has a higher steady-state value and the ability to maintain NRAact during 24 h of N deprivation. These parameters may be linked as NRAact may depend on the cytosolic nitrate activity.
- (ii) Stem-stored nitrate provides an important supply for remobilization to support vegetative growth. Stem, rather than leaf, tissue nitrate measurements are likely to be an earlier measure of changes in crop N status. An ability to remobilize root cortex vacuolar-stored nitrate during N starvation may be important, although this occurs later than stem nitrate pools.
- (iii) An ability to store more nitrate in the stem can indicate lower concentrations in the xylem sap nitrate that may result in an optimization of supply to the leaf for better NUE. Xylem sap analysis is not appropriate for comparing crop N status or NUE between cultivars.
- (ii) Stem-stored nitrate provides an important supply for remobilization to support vegetative growth. Stem, rather than leaf, tissue nitrate measurements are likely to be an earlier measure of changes in crop N status. An ability to remobilize root cortex vacuolar-stored nitrate during N starvation may be important, although this occurs later than stem nitrate pools.
These points summarize some traits for comparing NUE between plants of the same species but may also be of more general relevance to all cereal crops.
| Acknowledgements |
|---|
This work was funded in China by the National Natural Science Foundation (grant number 30390082), the National Basic Research Program 973 (grant No. 2005CB120903), and a grant from Jiangsu Province (BK2004102). Rothamsted Research is grant-aided by the Biotechnology and Biological Sciences Research Council (BBSRC) of the UK. The authors wish to thank Stephen Powers at Rothamsted for statistical advice.
| References |
|---|
|
|
|---|
Andrews M. Nitrate and reduced-N concentrations in the xylem sap of Stellaria media, Xanthium strumarium and six legume species. Plant, Cell and Environment (1986) 9:605608.
Botrel A, Kaiser WM. Nitrate reductase activation state in barley roots in relation to the energy and carbohydrate status. Planta (1997) 201:496501.[CrossRef][Web of Science][Medline]
Chanh TT, Tstutsumi M, Hurihara K. Comparative study on the response of Indica and Japonica rice plants to ammonium and nitrate nitrogen. Soil Science and Plant Nutrition (1981) 27:8392.
Cookson SJ, Williams LE, Miller AJ. Lightdark changes in cytosolic nitrate pools depend on nitrate reductase activity in Arabidopsis leaf cells. Plant Physiology (2005) 138:10971105.
De Angeli A, Monachello D, Ephritikhine G, Frachisse JM, Gambale F, Barbier-Brygoo H. The nitrate/proton antiporter AtCLCa mediates nitrate accumualtion in plant vacuoles. Nature (2006) 442:939942.[CrossRef][Medline]
Fan XR, Gordon-Weeks R, Shen QR, Miller AJ. Glutamine transport and feedback regulation of cellular nitrate pools in barley roots. Journal of Experimental Botany (2006) 57:13331340.
Fan XR, Shen QR, Ma ZQ, Zhu HL, Yin XM, Miller AJ. A comparison of nitrate transport in four different rice (Oryza sativa L.) cultivars. Science in China, Series C Life Sciences (2005) 48:897911.[Web of Science]
Fricke W, Pritchard E, Leigh RA, Tomas AD. Cells of the upper and lower epidermis of barley (Hordeum vulgare L) leaves exhibit distinct patterns of vacuolar solutes. Plant Physiology (1994) 104:12011208.[Abstract]
Gallais A, Hirel B. An approach to the genetics of nitrogen use efficiency in maize. Journal of Experimental Botany (2004) 55:295306.
Good AG, Shrawat AK, Muench DG. Can less yield more? Is reducing nutrient input into the environment compatible with maintaining crop production? Trends in Plant Science (2004) 9:13601385.
Kaiser WM, Huber SC. Post-translational regulation of nitrate reductase: mechanism, physiological relevance and environmental triggers. Journal of Experimental Botany (2001) 52:19811989.
Kaiser WM, Weiner H, Kandlbinder A, Tsai C-B, Rockel P, Sonoda M, Planchet E. Modulation of nitrate reductase: some new insights. Journal of Experimental Botany (2002) 53:875882.
Koutroubas SD, Ntanos DA. Genotypic differences for grain yield and nitrogen utilization in Indica and Japonica rice under Mediterranean conditions. Field Crop Research (2003) 83:251260.[CrossRef]
Kronzucker HJ, Glass ADM, Siddiqi MY, Kirk GJD. Comparative kinetic analysis of ammonium and nitrate acquisition by tropical lowland rice: implications for rice cultivation and yield potential. New Phytologist (2000) 145:471476.[CrossRef][Web of Science]
Matt P, Geiger M, Walch-Liu P, Engels C, Krapp A, Stitt M. The immediate cause of the diurnal changes of nitrogen metabolism in leaves of nitrate-replete tobacco: a major imbalance between the rate of nitrate reduction and the rates of nitrate and ammonium uptake metabolism during the first part of the light period. Plant, Cell and Environment (2001) 24:177190.[CrossRef]
McIntyre GI. The role of nitrate in the osmotic and nutritional control of plant development. Australian Journal of Plant Physiology (1997) 24:103118.[Web of Science]
Mickelson S, See D, Meyer FD, Garner JP, Foster CR, Blake TK, Fischer AM. Mapping of QTL associated with nitrogen storage and remobilization in barley (Hordeum vulgare L.) leaves. Journal of Experimental Botany (2003) 54:801812.
Miller AJ, Cookson SJ, Smith S, Wells DM. The use of microelectrodes to investigate compartmentation and transport of metabolized inorganic ions in plants. Journal of Experimental Botany (2001) 52:541549.
Miller AJ, Smith SJ. The mechanism of nitrate transport across the tonoplast of barley root cells. Planta (1992) 187:554557.[Web of Science]
Miller AJ, Smith SJ. Nitrate transport and compartmentation in cereal root cells. Journal of Experimental Botany (1996) 47:843854.
Miller AJ, Zhen RG. Measurement of intracellular nitrate concentrations in Chara using nitrate selective microelectrodes. Planta (1991) 184:4752.[Web of Science]
Orsel M, Krapp A, Daniel-Vedele F. Analysis of the NRT2 nitrate transporter family in Arabidopsis: structure and gene expression. Plant Physiology (2002) 129:886896.
Peng S, Buresh RJ, Huang J, Yang J, Zou Y, Zhong X, Wang G, Zhang F. Strategies for overcoming low agronomic nitrogen use efficiency in irrigated rice systems in China. Field Crops Research (2006) 96:3747.[CrossRef][Web of Science]
Schepers JS, Francis DD, Vigil M, Below FE. Comparison of corn leaf nitrogen concentration and chlorophyll meter readings. Communications in Soil Science and Plant Analysis (1992) 23:21732187.[Web of Science]
Siebrecht S, Herdel K, Schurr U, Tischner R. Nutrient translocation in the xylem of poplar: diurnal variations and spatial distribution along the shoot axis. Planta (2003) 217:783793.[CrossRef][Web of Science][Medline]
Steingrover E, Ratering P, Siesling J. Daily changes in uptake, reduction and storage of nitrate in spinach grown at low light intensity. Physiologia Plantarum (1986) 66:550556.[CrossRef]
Sueyoshi K, Kleinhofs A, Warner RL. Expression of NADH-specific and NAD(P)H-bispecific nitrate reductase genes in response to nitrate in barley. Plant Physiology (1995) 107:13031311.[Abstract]
Tucker DE, Allen DJ, Ort DR. Control of nitrate reductase by circadian and diurnal rhythms in tomato. Planta (2004) 219:277285.[CrossRef][Web of Science][Medline]
van der Leij M, Smith SJ, Miller AJ. Remobilization of vacuole stored nitrate in barley root cells. Planta (1998) 205:6472.[CrossRef][Web of Science]
Vlek PLG, Byrnes BH. The efficiency and loss of fertilizer N in lowland rice. Fertilizer Research (1986) 9:131147.[CrossRef][Web of Science]
Walker DJ, Smith SJ, Miller AJ. Simultaneous measurement of intracellular pH and K+ or NO3 in barley root cells using triple-barrelled, ion-selective microelectrodes. Plant Physiology (1995) 108:743751.[Abstract]
Youngdahl LJ, Pacheco R, Street JJ, Vlek PLG. The kinetics of ammonium and nitrate uptake by young rice plants. Plant and Soil (1982) 69:225232.[CrossRef][Web of Science]
Zhen RG, Koyro HW, Leigh RA, Tomos AD, Miller AJ. Compartmental nitrate concentrations in barley root cells measured with nitrate selective microelectrodes and by single cell sap sampling. Planta (1991) 185:356361.[Web of Science]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. J. Miller and S. J. Smith Cytosolic Nitrate Ion Homeostasis: Could it Have a Role in Sensing Nitrogen Status? Ann. Bot., March 1, 2008; 101(4): 485 - 489. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Miller, X. Fan, Q. Shen, and S. J. Smith Amino acids and nitrate as signals for the regulation of nitrogen acquisition J. Exp. Bot., January 1, 2008; 59(1): 111 - 119. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










