JXB Advance Access originally published online on June 25, 2008
Journal of Experimental Botany 2008 59(11):3027-3037; doi:10.1093/jxb/ern152
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH PAPER |
Phenylalanine ammonia lyase functions as a switch directly controlling the accumulation of calycosin and calycosin-7-O-β-D-glucoside in Astragalus membranaceus var. mongholicus plants
1Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, Institute of Biodiversity Science, Fudan University, Shanghai 200433, China
2Department of Genetics, School of Life Sciences, Anhui Agricultural University, 130 Changjiang Road, Hefei, Anhui 230061, China
3Plant Biology Division, Samuel Roberts Noble Foundation 2510 Sam Noble Parkway Ardmore, OK 73401, USA
4School of Pharmacy, Anhui College of Traditional Chinese Medicine, 45 Shihe Road, Hefei, Anhui 230031, China
* To whom correspondence should be addressed. E-mail: jkchen{at}fudan.edu.cn
Received 18 February 2008; Revised 18 April 2008 Accepted 8 May 2008
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Previously it had been shown that calycosin and calycosin-7-O-β-D-glucoside (CGs) accumulate in whole plants, mainly in leaves, of Astragalus membranaceus Bge. var. mongholicus (Bge.) Hsiao (A. mongholicus) plants in response to low temperature. In this work, it was demonstrated that the influences of different conditions on CGs biosynthesis, by examining the changes in CGs content, as well as the expression of related genes, including phenylalanine ammonia lyase (PAL1), cinnamic acid 4-hydroxylase (C4H), chalcone synthase (CHS), chalcone reductase (CHR), chalcone isomerase (CHI), isoflavone synthase (IFS), and isoflavone 3'-hydroxylase (I3'H). The seven gene mRNAs accumulated in leaves of A. mongholicus upon exposure to low temperature in a light-dependent manner, though they exhibited different expression patterns. Transcriptions of CHS, CHR, CHI, IFS, and I3'H of the calycosin-7-O-β-D-glucoside pathway were all up-regulated when plants were transferred from 16 °C to 2 °C or 25 °C or from 2 °C (kept for 24 h) to 25 °C. However, fluctuations in temperature influenced differently the transcriptions of PAL1 and C4H of the general phenylpropanoid pathway in leaves. Moreover, the amount of PAL1 expression changed sharply up and down, consistent with the variation of the content of CGs. PAL enzyme activity appears to be the limiting factor in determining the CGs levels. The inhibitor of PAL enzyme, L-
-aminooxy-β-phenylpropionic acid, almost entirely shut down CGs accumulation at low temperature. All these results confirmed that PAL1, as a smart gene switch, directly controls the accumulation of CGs in A. mongholicus plants, in a light-dependent manner, during low temperature treatment. Key words: Accumulation, enzyme inhibitor, gene switch, isoflavonoid, phenylalanine ammonia lyase
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
It is known that the levels of biologically active products vary widely in Chinese traditional medicinal herbs, depending on plant genotypes and environment where plants are grown. Environmental stress is known to cause many physiological, biochemical, and molecular changes in plant metabolism and to possibly alter the secondary metabolite production in plants (Zobayed et al., 2005).
The dried roots of Astragalus membranaceus Bge. var. mongholicus (Bge.) Hsiao (A. mongholicus) (family Leguminosae), known as ‘Huangqi’ in Chinese, is one of the most important Chinese traditional herbs. The root of the herb is collected in spring and autumn, and dried in the sun (Zheng, 2005). It is considered by consumers that the dried root reinforces ‘Qi’ (vital energy) and is often used as an antiperspirant, an immunostimulant, a diuretic, and a supplementary medicine during cancer therapy (Wagner et al., 1997; Zheng, 2005). Astragalus mongholicus grows mainly in the north, the north-east, and the north-west parts of China (Ma et al., 2000). As seen for many Chinese herbs, demand has resulted in large-scale cultivation of A. mongholicus but it remains largely unclear how cultural practices or environmental conditions affect accumulation of the secondary metabolites thought to be responsible for the medicinal qualities. Calycosin and calycosin-7-O-β-D-glucoside (CGs) are two major isoflavones related to the bioactivity of the herb. Calycosin-7-O-β-D-glucoside appears to be a potential natural anti-inflammatory or anti-osteoarthritis agent and may be used to effectively protect from proteoglycan degradation (Choi et al., 2005), and as a hyaluronidase inhibitory component (Lee et al., 2005). Calycosin protected endothelial cells from hypoxia-induced barrier impairment (Fan et al., 2003). It has been proposed that these two compounds could be used as ‘marker compounds’ for the chemical evaluation or product standardization of A. mongholicus (Nakamura et al., 1999). However, their content varies widely among different regions of China (Ma et al., 2002; Wu et al., 2005). Ma et al. (2002) found that A. mongholicus plants accumulated the highest content of calycosin-7-O-β-D-glucoside during September to October but the lowest in July.
The biosynthetic pathway of isoflavonoids in legumes has been studied extensively (Liu et al., 2003). Recently a putative scheme of the biosynthesis of CGs in A. mongholicus was proposed (Fig. 1) (Pan et al., 2007). However, little is known about the biosynthesis of CGs and the molecular mechanisms of their accumulation in A. mongholicus plants. As a branch of the general phenylpropanoid pathway, the calycosin-7-O-β-D-glucoside biosynthesis starts with phenylalanine ammonia lyase (PAL), which is the enzyme catalysing the first core reaction in the general phenylpropanoid pathway, and removes the amine group from the phenylalanine and produces cinnamic acid (Yu and McGonigle, 2005). Cinnamate-4-hydroxylase (C4H), essential in the plant kingdom, adds a hydroxyl group to form p-coumarate, catalysing the second of the core reactions of the general phenylpropanoid pathway leading to the synthesis of lignins, suberins, flavonoids, isoflavonoids, and coumarins in plant tissues (Werck-Reichhart et al., 1993). The first committed step to the calycosin-7-O-β-D-glucoside branch from the general phenylpropanoid pathway is catalysed by the chalcone synthase (CHS) that co-acts with chalcone reductase (CHR) to form isoliquritigenin (Joung et al., 2003), which can be converted to the flavanone liquiritigenin by the enzyme of chalcone isomerase (CHI). An enzyme in isoflavonoid biosynthesis is isoflavone synthase (IFS), which catalyses a 2,3 aryl ring migration of flavanones to their corresponding isoflavones, followed by formation of a double bond between C-2 and C-3 by a dehydratase (Heller and Forkmann, 1994; Hakamatsuka et al., 1998). Hydroxylation reaction at the 3'-position of the B-ring was catalysed by isoflavone 3'-hydroxylase (I3'H).
|
Isoflavones belong to phenolic secondary metabolites, found mostly in legumes, and play key roles in many plant–microbe interactions by increasing disease resistance (Dixon and Paiva, 1995; Yu and McGonigle, 2005). Isoflavonoid accumulation is induced by different stress conditions, such as Fusarium solani (Lozovaya et al., 2004), yeast cell wall extracts (Kessmann et al., 1990), wounding, and exposure of light (Graham and Graham, 1996). Different tissues show a differential isoflavonoid accumulation pattern in the same stress conditions (Tsukamoto et al., 1995). Light is a primary signal in stimulating isoflavonoid accumulation, but it is a highly selective signal and the end products are distinctly different (Graham and Graham, 1996). It has been reported that isoflavonoid accumulation is correlated with phenylpropanoid pathway activity (Yu et al., 2003).
In contrast to understanding of the transcriptional regulation of anthocyanin biosynthesis, the transcriptional regulation of isoflavonoid biosynthesis is poorly understood (Yu and McGonigle, 2005). The key enzymes involved in isoflavonoid biosynthesis are different among plant species. IFS was often considered as a key metabolic entry point for the formation of all isoflavonoid compounds (Ralston et al., 2005). Yu et al. (2003) reported that CHI enzyme activity is still limiting daidzein production in soybean. PAL, CHS, and IFS are considered as the entry-point enzymes of major branches of the phenylpropanoid pathway; however, overexpression of these three enzymes separately fails to significantly alter isoflavone content (Yu and McGonigle, 2005). The fungal-induced transcriptional activation of key enzymes in isoflavonoid synthesis, such as IFS, isoflavone O-methyltransferase, and isoflavone reductase, has been reported, mainly in alfalfa (Yu and McGonigle, 2005). The cloning and expression of cDNAs encoding enzymes in the calycosin-7-O-β-D-glucoside pathway provides an opportunity to integrate present studies with previous studies on the phenylpropanoid pathway.
In previous studies, it was demonstrated that low temperature could increase CGs production in A. mongholicus plants (Pan et al., 2007). The accumulation of CGs in roots is mainly from leaves which are the main organs of CGs biosynthesis during low temperature treatment. In this report, the impact of varing temperatures and light conditions on CGs levels and transcript changes of relevant genes in A. mongholicus plants, under controlled growing conditions, have been examined. These studies, combined with inhibition study and PAL enzymatic activity, demonstrated that the PAL1 gene controls the synthesis of CGs and may be used as a molecular marker to evaluate the quality of A. mongholicus.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Plant material and treatments
Astragalus mongholicus plants were obtained as previously described (Pan et al., 2007) in controlled conditions at 16 °C with a light intensity (photon flux) of 150 µmol m–2 s–1 (Leyva et al., 1995; Philipps et al., 2006), and a photoperiod of 12 h light and 12 h dark. Seedlings were grown in pots containing a mixture of vermiculite, blankland, and perlite (9:3:0.5), and irrigated with water and mineral nutrient solution (Haughn and Somerville, 1986) once a week. In this study, the plants which were grown for 100 d and adapated in dark for 4 d at 16 °C were used for the most of experiments. A 2 °C cold stress appears to efficiently activate all metabolic processes that lead to CGs synthesis (Pan et al., 2007). In order to analyse the effects of different temperature treatments, plants were also transferred to 25 °C for different periods of time. Light and other conditions during different treatments were identical to the control condition at 16 °C. To analyse the effects of light, some plants were treated by low temperature in light or dark at the same time. In addition, further studies were carried out examining the effects of temperature variation on the accumulation of CGs and relevant gene expression. The plants treated with low temperature for 24 h were shifted to 25 °C for 9 d. The leaves of A. mongholicus plants were isolated for different treatment periods of 4, 8, 12, 24, 28, 32, 72, 168, 240 h and were pulverized to a fine powder in liquid nitrogen. These materials served as the source of total RNA and CGs extractions.
Isolation of total RNA and cDNA cloning
Liu et al. (2006) cloned the PAL1 gene (NCBI accession no. AY986506
[GenBank]
) from A. mongholicus plants. In previous studies (Pan et al., 2007), cDNA fragments encoding two other members of the PAL family (NCBI accession no. EF110924
[GenBank]
and EF110925
[GenBank]
), four members of the CHS family (NCBI accession nos DQ140415
[GenBank]
, EF110921
[GenBank]
, EF110922
[GenBank]
, and EF110923
[GenBank]
), IFS (NCBI accession no. DQ205408
[GenBank]
), and I3'H (NCBI accession no. DQ371298
[GenBank]
) had been cloned. In this study, the C4H, CHR, and CHI genes were isolated and cloned by PCR and sequenced. Total RNA isolation and PCR cloning procedures were as described previously (Pan et al., 2007). In detail, these three genes were amplified using the cDNA library as a template and the following degenerated primers: for C4H, forward primer: 5' C(C/T)CG(G/C) TAA(A/G/T/C)GAAGT(A/T/C)C(A/T)C 3' and the reverse primer :5' ACT(A/G)GCT(A/T/C)AGC (A/G/T/C) AT(G/C)CC 3'; for CHR, forward primer: 5' C(A/C)T(G/C)ATCTT(A/G)TT(A/G) TT(C/T)C(A/T)GC 3', and the reverse primer 5' CCTTGTT (G/C) (A/G)TA (C/T)A(A/C/G)CCA(C/T)C 3'; for CHI forward primer:5' TCAC(G/T) (G/T) (G/C) (A/G)AT(A/C)GG(A/T)GT(A/T/C)TA(C/T) TT 3', and the reverse primer 5' C(A/G/C)GC(A/T/C) (G/T) (A/C) (C/T)GA(A/G/T) (A/G) (G/C) (A/T)G(G/C) (C/T)TTGTT 3'. Touch down PCR was carried out according to the following protocol: 30 cycles (94 °C for 1 min; 58 °C decreasing to a final temperature of 43 °C at a rate of 0.5 °C per cycle for 1 min, and 72 °C for 1 min), followed by 10 times (94 °C for 1 min; 43 °C for 1 min, 72 °C for 1 min). The PCR products were cloned into a pMD18-T Vector (TaKaRa, Japan) and sequenced.
Analysis procedure of CHI in this study was described by Shimada et al. (2003) and Ralston et al. (2005). The deduced amino acid sequence of CHI was used for phylogenetic analysis. The sequence was aligned to two CHI types from different species using PAUP* 4.0 as the tree-building method.
Real-time PCR quantification
Real-time PCR procedures, the primers, and thermocycler conditions for PAL, CHS, IFS, I3'H, and 18S RNA (internal standard), and quantities of target gene were determined for each sample as previously described (Pan et al., 2007). The forward and reverse real-time PCR primers for PAL1, C4H, CHR, and CHI were as follows: for PAL1, forward primer: 5' GTGACTGGGTGATGAATAG 3' and the reverse primer: 5' TGCTGTGTGTGGTAGTGTAC 3'; for C4H, forward primer: 5' AGTCGTTTGGCTCAGAGT 3' and the reverse primer:5' AGTCCTTCGTTGCTT GTG 3'; for CHR, forward primer: 5' GCAGTGAATCAAGTGGAG 3' and the reverse primer: 5' TCAATGGTGAGAATGCTG 3'; and for CHI, forward primer: 5' CAGAGACATCATCAAAGGTC 3' and the reverse primer: 5' TTCAGCCTCACTGTGTATTC 3'. Thermocycler conditions were 30 s at 95 °C, 20 s at 68 °C (PAL1, CHR, and CHI) or 63 °C (C4H), and 20 s at 72 °C. Product sizes were 185 bp (PAL1), 185 bp (C4H), 100 bp (CHR), and 142 bp (CHI).
Measurement of CGs content
The extraction procedure, identification of CGs and the determination of their content were as described previously by Pan et al. (2007). A total of 0.5 g of dried powder was extracted with 60 ml methanol for 3 h. The extract was concentrated under a reduced pressure at a temperature below 40 °C and the volume was then adjusted to 5 ml. The solution was filtered through a 0.45 µm membrane and 20 µl of solution was injected into HPLC for analysis. The UV detection wavelength was set at 230 nm. Based on previous results, CGs was synthesized mainly in leaves, but can be transported to roots of A. mongholicus plants during low temperature treatment. In this paper, total content of CGs from leaves, stems, and roots was determined.
PAL enzymatic activity assay
PAL activity was determined according to McCallum and Walker (1990) with some modifications. Three grams of A. mongholicus leaves were homogenized in 5 ml extraction buffer, previously chilled to 4 °C, containing 0.2 mM borate buffer (pH 8.8), 5 mmol β-mercaptoethanol, 150 mg PVP, and 0.1% Triton-100. The homogenate was centrifuged at 12 000 g for 40 min at 4 °C, and the supernatant was used as a crude extract. The reaction mixture consisted of 400 µl of the crude extract, and was initiated by adding 10 µl of 20 mM L-phenylalanine. Incubation was performed at 40 °C for 3 h. The reaction was stopped by adding 40 µl of 6 N HCl and the tubes were centrifuged for 10 min at 10 000 g. All tests were repeated at least three times. One unit of PAL activity equals the increased amount of 0.01 by UV-light absorbance at 290 nm. The protein content in enzymatic extracts was determined according to Bradford (1976) using bovine serum albumin as a standard.
Application of inhibitors of PAL
The PAL inhibitor, L--aminooxy-β-phenylpropionic acid (AOPP) (Wako, Japan), was tested as in vivo inhibitors of secondary metabolism in A. mongholicus plants. Stock solutions of AOPP were prepared in 0.1% DMSO at 1000-fold the required concentration. Leaves of 100-d-old plants of uniform size were soaked in distilled water, 0.1% DMSO, or AOPP at concentrations of 100 µM or 200 µM at 16 °C for 1 h; the plants were then kept in dark to take up chemicals for 12 h. Some of them were transferred to 2 °C and harvested at 12 h, 1, 4, 7, and 10 d. The experiments were repeated three times.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Variations in CGs content in different conditions
To determine whether high temperature affects the levels of CGs or the rate of their accumulation, CGs content was measured over time for 100-d-old plants maintained at 25 °C. The 25 °C treatment resulted in a decrease in CGs content gradually by about 50% at day 10 (Fig. 2). These data suggest that a 25 °C stress appears to repress the CGs biosynthesis. This apparent inhibition can be relieved by shifting plants to 16 °C (data not shown).
|
Figure 2 also showed that the synthesis of CGs was only induced in a light-dependent manner in spite of low-temperature stress. When the 100-d-old plants at 16 °C were transferred to 2 °C without light, the content of CGs was constant during the first 1 d, and then decreased in the following low-temperature process.
Isolation of cDNA fragments of C4H, CHR, and CHI
cDNAs for C4H, CHR and CHI were cloned, sequenced, and analysed. The sizes of isolated cDNA fragments including C4H, CHR, and CHI were 764, 488, and 418 bp, respectively. The homology search was carried out using the BLAST program on the deduced amino acid sequences. C4H shared a similarity of >95% with the known genes of Glycyrrhiza echinata, CHR of >91% with Medicago sativa, CHI of 74% to Glycine max cDNA, respectively. The sequences have been deposited at the GenBank database under accession numbers of ABD17288
[GenBank]
(C4H), ABB00059
[GenBank]
(CHR), and ABA55017
[GenBank]
(CHI).
CHI genes are classified into two types which may play different roles in flavonoid metabolism, and their distributions are highly specific (Shimada et al., 2003). The type I CHI is responsible for the flavonoid pathway and the type II CHI for the isoflavonoid pathway (Yu and McGonigle, 2005). The results of the amino acid sequence alignment of CHIs (data not shown) showed that CHI in this study may be the type II which functions with the isoflavonoid pathway.
Accumulation of mRNA for calycosin-7-O-β-D-glucoside pathway genes during different temperature treatments
Total RNA was isolated from plant leaves and examined for changes in transcript abundance with real-time PCR using gene-specific primers. In previous studies, it had been found that 18S transcript levels remain relatively constant in leaf tissues of A. mongholicus. In this study, it was also verified, as described by Ali-Benali et al. (2005), that the levels of 18S in total RNA have only 1.36-fold variation at most. For each of the genes examined in this study, transcript levels remained constant when unstressed plants (16 °C) were monitored throughout the treatment period. PAL and CHS genes exist as multigene families in A. mongholicus. There are also at least three PAL homologues and four CHS homologues in the A. mongholicus database. Since different members of the PAL and CHS families may serve the same functions, total PAL and CHS transcript levels were measured. Meanwhile, to clarify the major member of the function, PAL1 expression levels were analysed further based on previous studies (Pan et al., 2007).
First examined were changes in transcript levels for genes whose products catalyse the first two reactions of the general phenylpropanoid pathway (PAL1 and C4H) and core reactions committed to calycosin-7-O-β-D-glucoside biosynthesis (CHS, CHR, CHI, IFS, and I3'H). As shown in Fig. 3, each transcript had a distinct profile with regard to the magnitude of increase and kinetics of accumulation during the period of low-temperature treatment. In leaves, the levels of CHR and IFS expression were very high at over 108 molecular numbers per microgram total RNA at 16 °C. By contrast, the amounts of PAL1 and CHS expression were relatively low at only about 105 molecular numbers per microgram total RNA, indicating that CHR and IFS were very important for maintaining normal metabolism.
|
After low-temperature treatment for 4 h, the amount of expression of all genes detected except CHS increased at different rates. The levels of expression of PAL1, CHR, CHI, and IFS increased rapidly and reached a peak within 4 h of low-temperature treatment. Although PAL is encoded by a family of three genes in A. mongholicus plants, the amount of PAL1 expression comprised 84–76% of total expression of PAL during the period from 4 h to 72 h after low-temperature treatment (data not shown). Moreover, the amount of expression of IFS and PAL1 increased rapidly by 116- and 51-fold, respectively, and the amount of expression of CHI, CHR, C4H, and I3'H increased by 8.8-, 4.9-, 2.3-, and 1.8-fold, respectively. However, CHI transcripts accumulated rapidly and transiently, and the expression of CHI descended to a lower level expression thereafter. In addition, previous studies had also shown that the total expression levels of the CHS genes, consisting of four copies, were relatively constant within 12 h after low-temperature treatment (Pan et al., 2007). In a word, the expression profiles can be grouped into three categories in terms of their responsiveness to low temperature. The transcripts of members of the first category, PAL1, CHR, CHI, and IFS, increased dramatically to a peak within 4 h of transferring plants to 2 °C. The second category consists of C4H and I3'H genes, whose expressions were affected gradually by low-temperature stress. By contrast, CHS constitutes the third category. No significant change in transcripts has been observed at the early stages after elicitation.
Figure 3 also showed the expression pattern of mRNA for calycosin-7-O-β-D-glucoside pathway genes when the plants were transferred from 16 °C to 25 °C. The expression profiles can be grouped into two categories in terms of their responsiveness to high temperature. PAL1 and C4H constitute the first category. The expression levels of these two genes decreased during high-temperature treatment. PAL1 and C4H were down-regulated within the first 32 h and 12 h, and recovered to control levels at 72 h and 24 h, respectively. By contrast, the expressions of CHS, CHR, CHI, IFS, and I3'H constitute the second category. Their expression levels increased dramatically and reached the maximum without exception at hour 4 during high-temperature treatment. Interestingly, the expression levels of these five genes were higher than that at 2 °C, although these genes were up-regulated at 2 °C.
When plants were exposed to 2 °C for 24 h and then shifted to 25 °C, the expression variations of each gene were similar to those described above (Fig. 4). Only PAL1 and C4H expression levels were down-regulated. Moreover, the amount of PAL1 expression declined rapidly and reached the levels of those plants which were grown at 25 °C within 4 h, whereas C4H declined gradually to the levels of the plants which were grown at 25 °C at 7 d at a relatively constant rate. By contrast, the expressions of CHS, CHR, CHI, IFS, and I3'H were up-regulated to a higher level than those at 2 °C, although their accumulation patterns were different.
|
Accumulation of mRNA of genes in the calycosin-7-O-β-D-glucoside pathway during low-temperature exposure in a light-dependent manner
Real-time PCR was performed to analyse the accumulation of each gene mRNA in plants grown at low-temperature with light and without light (Fig. 3). The amounts of seven structural gene mRNAs showed no corresponding accumulation during low-temperature exposure in the dark. The level of accumulation of these seven gene transcripts during low-temperature exposure was less in plants without light than in plants with light. All these results demonstrated that the cold-induced mRNA accumulation of genes in the CGs biosynthetic pathway is light dependent.
PAL enzymatic activity assay
Changes in PAL activity after the transfer of 100-d-old plants from 16 °C to 2 °C and 25 °C during the following 10 d of cultivation are shown in Fig. 5. No significant changes in PAL activity were observed in leaves at 16 °C during the treatment, whereas a significant decrease in PAL activity was initially observed after 24 h at 25 °C. On the contrary, PAL activity in chilled leaves increased dramatically to a peak level to 7.6-fold, compared with the unstressed plants (16 °C) at 12 h and declined thereafter to the control level after 7 d.
|
Effects of AOPP treatment on CGs levels
The content of CGs was monitored in AOPP-treated and untreated plants at low temperature. The concentrations of CGs were analysed with HPLC (Fig. 6). There was no significant difference in the content of CGs between ddH2O and 0.1% DMSO solution during the treatment. This indicated that 0.1% DMSO had no effect on the accumulation of CGs in A. mongholicus plants induced by low temperature. But inhibitor treatment caused a significant reduction in the accumulation of CGs in plants during low-temperature treatment. With an increasing concentration of AOPP, the inhibition of phenylpropanoid biosynthesis became proportionally efficient. Time-course studies showed that no significant change of the content of CGs was observed among all the plants analysed at 12 h (Fig. 6). The 200 µM AOPP significantly reduced the accumulation of CGs in A. mongholicus plants by >95% compared with AOPP-untreated plants at 2 °C on day 4. This strong inhibition of 200 µM AOPP lasted to day 10. Treatment with 100 µM AOPP decreased the content of CGs gradually. The content of CGs was reduced by 47% on day 4 and by 73 % on day 10, compared with AOPP-untreated plants at 2 °C. In addition, if roots only were incubated and treated with 100 µM or 200 µM AOPP for 10 d, there was no significant change in content of CGs (data not shown), which is consistent with previous results that leaves might be the main tissue of CGs biosynthesis during low-temperature treatment (Pan et al., 2007).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
CGs accumulates in plants in response to low temperatures (Pan et al., 2007). To elucidate how this accumulation is regulated, the cold-induced accumulation of seven gene mRNAs, which encode key regulatory enzymes of the calycosin-7-O-β-D-glucoside biosynthetic pathway, was analysed.
The 100-d-old plants were subjected for 10 d to different temperature treatments of 2, 16, and 25 °C before being harvested. Comparing global gene expression reports relevant to different stress, large amounts of experimental data for identification of corresponding expressions are obtained. Generally, an increase in expression levels of all seven biosynthetic genes in leaves coincided with the increase of CGs concentration during low-temperature stress. However, although all gene transcripts accumulated during cold stress, each transcript had a distinct pattern with respect to the magnitude of change and kinetics of accumulation in leaves of A. mongholicus plants. Genes encoding PAL1, CHR, CHI, and IFS were most rapidly activated to maximum levels within 4 h during low-temperature treatment, indicating that these four genes were most obviously induced by low temperature and their high efficient expression is very important for A. mongholicus plants to maintain the physiological function under low-temperature pressure. C4H and I3'H genes were also activated, but at a slower initial rate. Transcription of CHS genes was less rapid. These results indicated that ‘early’ and ‘late’ genes involved in CGs biosynthesis may undergo different regulation mechanisms. Kubasek et al. (1998) provided some evidence that flavonoid biosynthesis genes are controlled in different periods in stress conditions. These kinds of ‘early’ genes may be preferably considered as selectable gene markers.
The amounts of PAL1 and IFS gene expression sharply increase under cold-stress conditions. However, in non-stressed leaves, PAL1 expression is restricted to a low level, which is likely to be related to CGs continuously being deposited at a low level. By contrast, transcriptional analysis revealed that IFS transcripts appear to be present in significant amounts even at 16 °C, indicating that IFS is very important for maintaining all flavonoid metabolisms. The evidence provided here suggests that PAL1 plays a role in the accumulation of CGs in A. mongholicus plants, as well as in the rapid response to low temperature by relatively high expression. The profound increases in PAL1 transcripts may reflect a fundamental importance of PAL in catalysing the first steps in pathways dedicated to the synthesis of CGs.
PAL1 and C4H mRNAs exhibited a completely different pattern from CHS, CHR, CHI, IFS, and I3'H in plants under different temperatures, and therefore these genes appeared to be controlled, partly at least, by different regulatory mechanisms. High temperature inhibited the gene expression of PAL1 and C4H, whereas expression of CHS, CHR, CHI, IFS, and I3'H of CGs biosynthesis is clearly distinct from that of the PAL1 and C4H genes. The five genes in the CGs biosynthesis pathway show higher expression than that in the control, while the CGs content declined at high temperature. Moreover, the amount of PAL1 transcripts became negligible immediately after the temperature change from 2 °C to 25 °C. These results suggest that the accumulation of CGs biosynthesis in A. mongholicus plants grown under the low-temperature condition might be correlated with lower expression levels of the PAL1 gene at high temperature. PAL1 exhibits a variable induction potential and these patterns re-appear during temperature changes associated with CGs accumulation.
Cold stress not only induces the genes of the general phenylpropanoid pathway, such as PAL1 and C4H, but also the genes of the calycosin-7-O-β-D-glucoside pathway, which lead to the accumulation of CGs. A high expression level of PAL1 is always associated with a high concentration of CGs in A. mongholicus plants and vice versa. C4H mRNA levels appeared to be up-regulated concordantly, although their expression was affected gradually by low-temperature stress. However, heat stress inhibits genes of the general phenylpropanoid pathway, but does not inhibit the genes of the calycosin-7-O-β-D-glucoside pathway. These results suggested that low temperature controls the accumulation of CGs through the general phenylpropanoid pathway and may play a role in controlling the expression of PAL1 and C4H in a manner distinct from the gene in the calycosin-7-O-β-D-glucoside pathway. As a general strategy, transcriptionally activating the upstream pathway may increase the flow of intermediates and provide more substrates.
The CGs levels were controlled by the PAL gene, as was also shown by the corresponding changes in PAL enzyme activity at the different temperatures. The results of the present study showed that enhanced expression of PAL gene transcript coordinated with increased PAL enzyme activity and induced the accumulation of CGs, which suggested that the increased CGs accumulation produced in cold-induced A. mongholicus plants may be attributable to increased expression of the PAL gene of CGs biosynthesis.
To investigate the direct effect of phenylpropanoid metabolism on CGs formation, AOPP a specific inhibitor of PAL, was applied. Concentrations of AOPP were chosen for treatments on the basis of previous studies (Kessmann et al., 1990; Peiser et al., 1998). As expected, in the absence of AOPP, the content of CGs of plants increased on day 4 during low-temperature treatment. This increase in the content of CGs was nearly suppressed by the addition of 200 µM AOPP. In A. mongholicus plants, the inhibition on flux through the general phenylpropanoid pathway results in no accumulation of CGs at low temperature, indicating that the CGs could originate from a preformed precursor, phenylalanine, in cold-stressed plants. These results also indicate that CGs formation is directly supported by a secondary metabolite produced from the general phenylpropanoid pathway, suggesting that the content of CGs can be controlled by AOPP without inhibition of primary metabolism. Previous studies have shown that treatment of elicited bean cultures with AOPP decreased the accumulation of medicarpin in cells (Kessmann et al., 1990). It has also been observed that the isoflavonoid phytoalexins are synthesized rapidly after infection due to the de novo activation of secondary metabolic pathways (Yu and McGonigle, 2005). PAL is a key enzyme for the biosynthesis of polyphenols (Ke and Saltveit, 1989), and is rapidly synthesized de novo with various stimuli (Hahlbrock and Scheel, 1989). This result supports the theory that synthesis of CGs was de novo after chilling.
The above results provided additional evidence that PAL1 may control the switch to CGs product accumulation by increased de novo mRNA in cold-induced A. mongholicus plants. The increased gene expression of PAL1 from de novo mRNA synthesis may account for the increased levels of CGs.
It is expected that light appears to be a requirement for the accumulation of CGs at low temperature. The present results indicate that low temperature alone failed to induce the genes encoding the CGs biosynthetic pathway enzyme mRNAs, but low-temperature exposure with light treatment induces the accumulation of these seven gene mRNAs. The accumulation of these seven mRNAs suggests that their response to light may be regulated through a common controlling mechanism, and indicated the presence of ‘cross talk’ between light- and low-temperature-controlling pathways (Wang et al., 2002). It has been reported that there are many cold-inducible genes that are induced only by low temperature in a light-dependent manner such as the CHS gene of Arabidopsis thaliana (Leyva et al., 1995), and the HvMC1 gene in barley (Philipps et al., 2006).
CGs are useful chemical markers of the quality of A. mongholicus and the contents of CGs are closely correlated with the expression levels of the PAL1 gene. Therefore, the PAL1 gene may be utilized as a gene marker to monitor the variation in CGs content as well as to evaluate the quality of A. mongholicus. Meanwhile, CGs accumulated at the highest level at days 7–10 (Fig. 2), but the gene PAL1 mRNA level (Fig. 3) and its enzyme activity (Fig. 5) were gradually reduced back to the level of the control during the low-temperature treatment; therefore, it would be necessary and practical to find this kind of gene marker. The content of major secondary metabolites of Chinese traditional herbs often strongly affects the curative effect of products. To control the quality of traditional Chinese herbs, compound markers monitoring the content of secondary metabolites after harvest are usually used. The molecular mechanism of the accumulation of secondary metabolites in traditional Chinese herbs has not received much attention. Generally, the genetic factors of herbs determine the production of secondary metabolites of a plant, which is also affected by environmental factors. However, it is a complex process in which environmental factors influence the production of secondary metabolites. Understanding the molecular biology of their complicated biosynthetic pathways will lead to new opportunities for controlling the quality of herbs, especially for monitoring their growth processes. Gene markers monitoring the processes of accumulation of secondary metabolites may build a bridge between the production of secondary metabolites and environmental factors. Moreover, Chinese traditional medicinal herbs are now mostly prepared from cultivated plants due to the exhaustive exploitation of natural resources. Finding this kind of marker will be of value in improving our understanding of controlling secondary metabolic products and choosing appropriate environments for herb cultivation. The combination of the gene marker before harvest and the compound marker after harvest of herbs would be more useful to control the quality of herbs.
|
Acknowledgements |
|---|
This work was supported by the National Basic Research Program of China (973 Program, Grant no. 2007CB411607).
|
Abbreviations |
|---|
A. mongholicus, Astragalus membranaceus Bge. var. mongholicus (Bge.) Hsiao; AOPP, L-
-aminooxy-β-phenylpropionic acid; CGs, calycosin and calycosin-7-O-β-D-glucoside; C4H, cinnamic acid 4-hydroxylase; CHI, chalcone isomerase; CHR, chalcone reductase; CHS, chalcone synthase; IFS, isoflavone synthase; I3'H, isoflavone 3'-hydroxylase; PAL, phenylalanine ammonia lyase. |
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Ali-Benali MA, Alary R, Joudrier P, Gautier MF. Comparative expression of five Lea genes during wheat seed development and in response to abiotic stresses by real-time quantitative RT-PCR. Biochimica et Biophysica Acta – Gene Structure and Expression (2005) 1730:56–65.[CrossRef][Web of Science]
Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry (1976) 72:248–254.[CrossRef][Web of Science][Medline]
Choi S, Park SR, Heo TR. Inhibitory effect of astragali radix on matrix degradation in human articular cartilage. Journal of Microbiology and Biotechnology (2005) 15:1258–1266.[Web of Science]
Dixon RA, Paiva NL. Stress-induced phenylpropanoid metabolism. The Plant Cell (1995) 7:1085–1097.[CrossRef][Web of Science][Medline]
Fan Y, Wu DZ, Gong YQ, Zhou RY, Hu ZB. Effects of calycosin on the impairment of barrier function induced by hypoxia in human umbilical vein endothelial cells. European Journal of Pharmacology (2003) 481:33–40.[CrossRef][Web of Science][Medline]
Graham TL, Graham MY. Signaling in soybean phenylpropanoid responses: dissection of primary, secondary, and conditioning effects of light, wounding, and elicitor treatments. Plant Physiology (1996) 110:1123–1133.[Abstract]
Hahlbrock K, Scheel D. Physiology and molecular biology of phenylpropaniod metabolism. Annual Review of Plant Physiology and Plant Molecular Biology (1989) 40:347–369.[CrossRef][Web of Science]
Hakamatsuka T, Mori K, Ishida S, Ebizuka Y, Sankawa U. Purification of 2-hydroxyisoflavanone dehydratase from the cell cultures of Pueraria lobata. Phytochemistry (1998) 49:497–505.[CrossRef][Web of Science]
Haughn G, Somerville C. Sulfonylurea-resistant mutants of Arabidopsis thaliana. Molecular & General Genetics (1986) 204:430–434.[CrossRef][Web of Science]
Heller W, Forkmann G. Biosynthesis of flavonoids. In: The flavonoids: advances in research since 1986—Harborne JB, ed. (1994) London: Chapman and Hall. 499–535.
Joung JY, Kasthuri GM, Park JY, Kang WJ, Kim HS, Yoon BS, Joung H, Jeon JH. An overexpression of chalcone reductase of Pueraria montana var. lobata alters biosynthesis of anthocyanin and 5'-deoxyflavonoids in transgenic tobacco. Biochemical and Biophysical Research Communication (2003) 303:326–331.[CrossRef]
Ke D, Saltveit ME. Carbon dioxide-induced brown stain development as related to phenolic metabolism in iceberg lettuce. Journal of the American Society for Horticultural Science (1989) 114:789–794.
Kessmann H, Edwards R, Geno PW, Dixon RA. Stress responses in alfalfa Medicago sativa L.V. Consitutive and elicitor-induced accumulation of isoflavanoid conjugates in cell suspension cultures. Plant Physiology (1990) 94:227–232.
Kubasek WL, Ausubel FM, Shirley BW. A light-independent developmental mechanism potentiates flavonoid gene expression in Arabidopsis seedlings. Plant Molecular Biology (1998) 37:217–223.[CrossRef][Web of Science][Medline]
Lee YM, Choi SI, Lee JW, Jung SM, Park SM, Heo TR. Isolation of hyaluronidase inhibitory component from the roots of Astraglus membranaceus Bunge Astragali radix. Food Science and Biotechnology (2005) 14:263–267.[Web of Science]
Leyva A, Jarillo JA, Salinas J, Martinezzapater JM. Low-temperature induces the accumulation of phenylalanine ammonia-lyase and chalcone synthase messenger-RNAs of Arabidopsis thaliana in a light-dependent manner. Plant Physiology (1995) 108:39–46.[Abstract]
Liu CJ, Huhman D, Sumner LW, Dixon RA. Regiospecific hydroxylation of isoflavones by cytochrome P450 81E enzymes from Medicago truncatula. The Plant Journal (2003) 36:471–484.[CrossRef][Web of Science][Medline]
Liu RR, Xu SH, Li JL, Hu YL, Lin ZP. Expression profile of a PAL gene from Astragalus membranaceus var. mongholicus and its crucial role in flux into flavonoid biosynthesis. Plant Cell Reports (2006) 25:705–710.[CrossRef][Web of Science][Medline]
Lozovaya VV, Lygin AV, Zernova OV, Li S, Hartman GL, Widholm JM. Isoflavonoid accumulation in soybean hairy roots upon treatment with Fusarium solani. Plant Physiology and Biochemistry. (2004) 42:671–679.[CrossRef][Web of Science][Medline]
McCallum JA, Walker JRL. Phenolic biosynthesis during grain development in wheat changes in phenylalanine ammonia lyase activity and soluble phenolic content. Journal of Cereal Science (1990) 11:35–49.[Web of Science]
Ma XQ, Duan JA, Zhu DY, Dong TTX, Tsim KWK. Species identification of Radix Astragali (Huangqi) by DNA sequence of its 5S-rRNA spacer domain. Phytochemistry (2000) 54:363–368.[CrossRef][Web of Science][Medline]
Ma XQ, Shi Q, Duan JA, Dong TTX, Tsim KWK. Chemical analysis of Radix Astragali Huangqi in China: a comparison with its adulterants and seasonal variations. Journal of Agricultural and Food Chemistry (2002) 50:4861–4866.[CrossRef][Web of Science][Medline]
Nakamura T, Hashimoto A, Nishi H, Kokusenya Y. Investigation on the marker substances of crude drugs in formulations. I. Marker substances for the identification of Astragali Radix in kampo and drinkable preparations. Yakugaku Zasshi (1999) 119:391–400.[Web of Science][Medline]
Pan HY, Fang CM, Zhou TS, Wang QZ, Chen JK. Accumulation of calycosin and its 7-O-β-D-glucoside and related gene expression in seedlings of Astragalus membranaceus Bge. var. mongholicus Bge. Hsiao induced by low temperature stress. Plant Cell Reports (2007) 26:1111–1120.[CrossRef][Web of Science][Medline]
Peiser G, Lopez-Galvez G, Cantwell M, Saltveit ME. Phenylalanine ammonia lyase inhibitors control browning of cut lettuce. Postharvest Biology and Technology (1998) 14:171–177.[CrossRef][Web of Science]
Philipps G, Drzewiecki C, Barth O, Zschiesche W, Humbeck K. Light-dependent expression of the cold-regulated gene HvMC1 in barley (Hordeum vulgare l.). Journal of Thermal Biology (2006) 31:473–482.[CrossRef][Web of Science]
Ralston L, Subramanian S, Matsuno M, Yu O. Partial reconstruction of flavonoid and isoflavonoid biosynthesis in yeast using soybean type I and type II chalcone isomerases. Plant Physiology (2005) 137:1375–1388.
Shimada N, Aoki T, Sato S, Nakamura Y, Tabata S, Ayabe S. A cluster of genes encodes the two types of chalcone isomerase involved in the biosynthesis of general flavonoids and legume-specific 5-deoxyisoflavonoids in Lotus japonicus. Plant Physiology (2003) 131:941–951.
Tsukamoto C, Shimada S, Igita K, Kudou S, Kokubun M, Okubo K, Kitamura K. Factors affecting isoflavone content in soybean seeds – changes in isoflavones, saponins, and composition of fatty-acids at different temperatures during seed development. Journal of Agricultural and Food Chemistry (1995) 43:1184–1192.[CrossRef][Web of Science]
Wagner H, Bauer R, Xiao PG, Chen JM, Michler G. Radix Astragali Huang Qi. Chinese Drug Monographs and Analysis (1997) 1:1–17.
Wang KLC, Li H, Ecker JR. Ethylene biosynthesis and signaling networks. The Plant Cell (2002) 14:S131–S151.
Werck-Reichhart D, Batard Y, Kochs G, Lesot A, Durst F. Monospecific polyclonal antibodies directed against purified cinnamate 4-hydroxylase from Helianthus tuberosus: immunopurification, immunoquantitation, and interspecies cross-reactivity. Plant Physiology (1993) 102:1291–1298.[Abstract]
Wu T, Bligh SWA, Gu LH, Wang ZT, Liu HP, Cheng XM, Branford-White CJ, Hu ZB. Simultaneous determination of six isoflavonoids in commercial Radix Astragali by HPLC-UV. Fitoterapia (2005) 76:157–165.[CrossRef][Web of Science][Medline]
Yu O, McGonigle B. Metabolic engineering of isoflavone biosynthesis. Advances in Agronomy (2005) 86:147–190.[CrossRef][Web of Science]
Yu O, Shi J, Hession AO, Maxwell CA, McGonigle B, Odell JT. Metabolic engineering to increase isoflavone biosynthesis in soybean seed. Phytochemistry (2003) 63:753–763.[CrossRef][Web of Science][Medline]
Zheng XY. Pharmacopoeia of the Peoples Republic of China (2005) Vol. 1, Chinese edn. Beijing: Chemical Industry Press. 212–213.
Zobayed SMA, Afreen F, Kozai T. Temperature stress can alter the photosynthetic efficiency and secondary metabolite concentrations in St. John's wort. Plant Physiology and Biochemistry (2005) 43:977–984.[CrossRef][Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||