Skip Navigation



JXB Advance Access published online on May 24, 2007

Journal of Experimental Botany, doi:10.1093/jxb/erm090
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
58/8/2249    most recent
erm090v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Allnutt, G. V.
Right arrow Articles by Herbert, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Allnutt, G. V.
Right arrow Articles by Herbert, R. J.
Agricola
Right arrow Articles by Allnutt, G. V.
Right arrow Articles by Herbert, R. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2007]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

RESEARCH PAPER

A LEAFY-like gene in the long-day plant, Silene coeli-rosa is dramatically up-regulated in evoked shoot apical meristems but does not complement the Arabidopsis lfy mutant

Gemma Victoria Allnutt1,2, Hilary Joan Rogers2,*, Dennis Francis2 and Robert James Herbert1

1Department of Applied Sciences, Geography and Archaeology, University of Worcester, Henwick Grove, Worcester WR2 6AJ, UK
2School of Biosciences, Cardiff University, PO Box 915, Cardiff CF10 3TL, UK

* To whom correspondence should be addressed. E-mail: rogershj{at}cf.ac.uk

Received 6 December 2006; Revised 23 February 2007 Accepted 28 March 2007


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
A LEAFY-like gene was cloned in the long-day (LD) plant, Silene coeli-rosa (ScLFY). The open reading frame spans 1452 bp encoding a putative protein of 483 amino acids. Amino acid homology to other LFYs is 43–55%; conserved and variable regions were similar to others. However, an intron (808 bp) not found in others occurred close to the N-terminal of the C1 domain. Known features of transcription factors exhibited by ScLFY were an acidic domain in the central variable region, a proline-rich variable-region, and glutamate-rich regions. The proximal 5' untranslated region of ScLFY contains an 8 bp motif: CAACGGCC, which conforms to the Gibberellic Acid Regulatory Element (GARE), also found in the promoter of LFY in Arabidopsis. However, the 5' variable region of ScLFY is exceptionally long compared with other LFY genes. ScLFY failed to complement the Arabidopsis lfy mutant reflecting the substantial divergence of this gene. ScLFY was analysed during inductive and non-inductive treatments using RT-PCR. A clear up-regulation of ScLFY occurred in the apical meristem upon evocation of flowering, but it was barely detectable in non-inductive conditions. Thus, ScLFY is strongly up-regulated in evoked and young floral apices.

Key words: Flowering, LEAFY, long-day, meristem, Silene coeli-rosa, RT-PCR


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The transition from vegetative to floral growth is a remarkable developmental event involving both quantitative and qualitative changes in gene expression in both the leaves and shoot apical meristems (SAM) of the plant. In response to the arrival of the floral stimulus, the events that commit the shoot apical meristem (SAM) to become a flower are defined as floral evocation (Evans, 1971).

Studies on Arabidopsis thaliana and Antirrhinum majus have resulted in substantial progress in identifying meristem identity genes that are crucial to this phase change. The published data for SAMs of these species portray a pyramidal cascade of protein–DNA interactions with meristem identity genes at the top, and organ identity genes some way down (Araki, 2001). FLOWERING LOCUS T (FT) encodes an mRNA that is transported from leaf to apex (Huang et al., 2005). A consensus view is that FT is a component of the floral stimulus and it regulates a meristem identity gene, AP1, which together with LEAFY (LFY) and its homologue, FLORICAULA (FLO) in Antirrhinum (Coen et al., 1990; Schultz and Haughn, 1991; Weigel et al., 1992; Parcy et al., 2002) are key components of floral evocation (Aksenova et al., 2006). In Arabidopsis, TFL (TERMINAL FLOWER) expression is limited to the inflorescence meristem whereas up-regulation of LFY occurs in flower primordia; LFY and TFL act antagonistically (Liljegren et al., 1999).

In response to the arrival of the floral stimulus at the SAM, Arabidopsis LFY exhibits both quantitative and spatial changes in its expression pattern. During vegetative growth, there is a low level of LFY expression in the SAM sub-apical region and young primordia (Hempel et al., 1997). In florally induced plants, LFY is more highly expressed but becomes restricted to the peripheral zone of the SAM, and to flower primordia (Blázquez et al., 1997). Hence, LFY is expressed in the regions of the SAM that will initiate the next flower primordium. Further evidence for LFY's leading role, was the discovery that Aspen trees, transformed with LFY, flower precociously (Weigel and Nilsson, 1995). In Antirrhinum, FLO expression is more qualitative being localized to flower primordia but absent from vegetative SAMs (Bradley et al., 1996a). In Arabidopsis, promoter analyses suggest that LFY may also be important in co-ordinating photoperiodic and gibberellic acid (GA) signals. For example, deletion of an 8 bp motif within the LFY promoter, conforming to the GA responsive element consensus (GARE), eliminates responsiveness to GA in short days (Blázquez and Weigel, 2000).

Homologues to LFY have been identified in a very wide taxonomic range from ferns and gymnosperms through to both monocots and dicots (Frohlich and Parker, 2000). However, the expression pattern of LFY in these plants varies widely. For example in tobacco, NFL (Nicotiana FLO/LFY) is expressed in both vegetative and floral meristems, with no apparent up-regulation on floral induction even in Maryland Mammoth, the absolute short day variety (Kelly et al., 1995). By contrast, FLO expression in Antirrhinum is confined exclusively to the inflorescence and floral meristems (Bradley et al., 1996a). In only a small number of studies (Gocal et al., 2001; Veit et al., 2004) has the expression of a LEAFY gene been followed through photoperiodic induction in absolute photoperiodic species or varieties/ ecotypes. Here data are presented on a LFY-like gene (ScLFY) in the absolute LD plant, S. coeli-rosa. This plant requires 7 LD for 100% flowering; the terminal meristem forms the first flower (Miller and Lyndon, 1976). When 28-d-old plants are given this treatment and returned to short days (SD), sepals begin to appear 2 d later and a complete terminal flower is formed within the next 5 d (Lyndon, 1979; Donnison and Francis, 1993). Each LD comprises 8 h of high fluence rate light provided by fluorescent tubes (rich in red light) followed by a 16 h photoextension of low fluence rate light from tungsten bulbs (rich in far-red light). However, plants given 7 d of continuous red-rich light do not flower (Ormrod and Francis, 1987), while plants given 7 LD+48 h darkness do (Grose and Lyndon, 1984). Using these treatments, the extent to which ScLFY is linked to flowering has been investigated.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Plant material
S. coeli-rosa (L.) Godron (originally supplied by McNair Ltd., Seedsmen, Edinburgh and subsequently cultivated in the Cardiff School of Biosciences Research Garden) was grown at 20 °C under short day (SD) conditions of 8 h light (300–400 µmol m–2 s–1) provided by white fluorescent tubes (Silvania ‘Lifeline’, London) from 09.00 h to 17.00 h and 16 h darkness. Twenty-eight days following germination, plants that had just initiated their seventh pair of leaves were selected (Miller and Lyndon, 1976).

Experimental treatments
One batch of plants remained in non-inductive SD as the control treatment. Other batches of developmentally uniform 28-d-old plants (see above) were given up to 7 LD, where each LD comprised the same fluence rate and duration of light as in the 8 h SD daily light period, but with a 16 h photoextension of low fluence rate (10–15 µmol m–2 s–1) from incandescent bulbs (Phillips, London). Following 7 LD, some batches were returned to SD (7LD treatment), while others were given 2 d of darkness (2Da) and then returned to SD (7LD2Da) treatment; another batch was given 7 d of continuous fluorescent light before returning the plants to non-inductive SD (CL treatment). Following each of these treatments, plants were returned to SD until the plants were 56-d-old and their shoot apices dissected for evidence of flower formation. Note that for the molecular work detailed below, plants were sampled during these treatments (Fig. 1).


Figure 1
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Daily regimes used in the short-day (SD), long-day (LD), and continuous-light (CL) treatments. Daily, SD comprised 8 h fluorescent light, 16 h dark, LD 8 h fluorescent light, 16 h incandescent photoextension and CL, 24 h of continuous fluorescent light.

 
Isolation of the S. coeli-rosa LFY homologue
Degenerate PCR primers (G1201, CGGAATTCATGC/AGICAT/CTAT/CGTICATT/CGT/CTAT/CGC and G1204, TTGGATCCIT/CT/GIGTIGGIACA/GTACCAA/TAT), were originally designed from conserved regions of Antirrhinum and Arabidopsis LFY homologues (Pouteau et al., 1997). These primers were used to amplify a 233 bp product from S. coeli-rosa genomic DNA. 50 ng of caesium chloride-purified S. coeli-rosa genomic DNA was amplified with 3 U AmpliTaq Gold (Perkin Elmer, Beaconsfield, UK), 10 µM each primer in 10 mM TRIS–HCl, pH 8.3, 50 mM KCl, 0.2 mM dNTPs, 3 mM MgCl2 in a final reaction volume of 50 µl. PCR cycles were 1 cycle of 5 min at 94 °C, 35 cycles of 30 s at 94 °C; 1 min at 45 °C; and 1 min at 72 °C, and a final 10 min at 72 °C.

Sequencing confirmed a strong homology of this fragment to LFY genes from other species. Three rounds of RACE (5' RACE kit, Gibco BRL, Paisley, UK) using 36 d cDNA yielded three further overlapping PCR products of 306, 627, and 355 bp. Sequencing again confirmed their homology to LFY. Genome walking was used to complete the open reading frame sequence at both the 5' and 3' end (Universal Genome Walker kit and Advantage Genomic PCR kit from Clontech, Palo Alto, USA). PCR primers were designed (ORFF, ACGTGGATCCCCTTGCCTAAACTATTTCC and ORFR, GATCAAGCTTTTCTTAACCTTACAGACCA) and used to amplify the whole of the ORF from 36 d cDNA with Expand High Fidelity Taq polymerase (Roche, Basel, Switzerland). One cloned PCR product of the whole ORF was fully sequenced in both directions using primers spaced at approximately 300 bp intervals, and five further clones were partially sequenced. All cloning was into pGEMEasy T (Promega, Southampton, UK), all sequencing used an ABI377 or ABI3100 automated sequencer. Sequences were assembled and analysed using DNAStar (Lasergene, Madison, USA) and Clustal software.

Isolation of shoot apices
Shoots were cut just above the cotyledons, and the larger leaves removed by hand. Using a light dissecting microscope (Nikon SMZ-2T, Tokyo) and an oxidized tungsten needle, the apical domes above the youngest pair of leaf primordia were isolated (referred to from here on as apex/apices). Apices from each batch of plants were placed directly into 200 µl RNA extraction buffer (TRI-Reagent; Sigma, St Louis, Mo, USA). When all plants had been dissected the apices were stored at –70 °C, until required.

RNA extraction and cDNA synthesis
Apices were homogenized using Eppendorf homogenizers in the 200 µl TRI-reagent in which they were placed after dissection. After standing at room temperature for 10 min, the homogenate was extracted with 40 µl of chloroform and centrifuged for 15 min at 13 000 g. The extract was isopropanol precipitated at room temperature and RNA pellets were washed with 500 µl 70% ethanol, before resuspending in sterile, double-distilled water.

Prior to cDNA synthesis, each RNA sample was digested for 15 min at 37 °C, with 10 U DNase I RNase free (Boehringer Mannheim, Burgess Hill, West Sussex, UK), in a total volume of 100 µl containing, 10 µl DNase buffer (40 mM TRIS–HCl, pH 7.9, 10 mM NaCl, 6 mM MgCl2, 10 mM CaCl2), 1 µl with RNasin (40 U µl–1; Promega, Southampton, UK). TRI Reagent (200 µl) was added, and the RNA re-extracted, following the same protocol as above. Finally, the pellet was resuspended in diethylpyrocarbonate (DEPC) treated water.

Oligo(dT)15 (500 ng µl–1; Promega, Southampton, UK) (1 µl) was added to the RNA to be reverse transcribed in a total volume of 12 µl, heated to 70 °C for 10 min and chilled on ice. First-strand cDNA synthesis was performed in 50 mM TRIS–HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol (Gibco BRL, Paisley, UK), 0.5 mM of each dNTP (Gibco BRL, Paisley, UK) and 200 U Superscript II RNase H reverse transcriptase (Gibco BRL, Paisley, UK). After incubating for 50 min at 42 °C, the reaction was inactivated by heating at 70 °C for 15 min. The reaction was cooled on ice and stored at –70 °C until required.

Real time RT-PCR
Three plasmids were used to create standard curves: pScLFY contained 112 bp of the ScLFY open reading frame amplified using specific SFL primers, LFY3U, GGGGACATACCAAATAGAGA and LFY4L, CGCGTGGAGGCAGGCTTG, designed using the computer package DNAstar. pSTUB contained 325 bp of the ß-tubulin coding region amplified using POS6, TGAGYGGYGTSACSTGCT and NEG2, GTAGGANGAGTTCTTGTTCTG PCR primers. p18SIL contained a 354 bp fragment of the 18S rRNA genes from S. coeli-rosa amplified using PCR primers PVSIL1, CATGCTAATGTATTCAGAGCGTA and PVSIL3, CTGACACGGGGAGGTAGTGA. Each PCR product was cloned into pGEMT-Easy vector (Promega, Southampton, UK), to provide a better template for the standard curves, and the same PCR primers were used for the LightCycler reactions.

LightCycler PCR reactions, in a total volume of 9 µl contained 1 µl of the cDNA synthesis reaction or 1 µl of plasmid, 1 µl of x10 LightCycler DNA Master SYBR Green (Roche, Basel, Switzerland), containing Taq polymerase, dNTP mix, reaction buffer, SYBR Green I dye, and 10 mM MgCl2. MgCl2 was adjusted to a final 3 mM, and primer concentrations (Sigma-Genosys Poole, UK) were as below. PCR conditions were optimized separately for each primer pair: LFY3U/LFY4L: 55 °C anneal, 0.5 µM primers; POS6/NEG2: 60 °C anneal, 1.0 µM primers; PVSIL1/PVSIL3: 55 °C anneal, 1.0 µM primers. Reactions were performed in glass capillary tubes in a LightCycler real-time PCR machine (Roche, Basel, Switzerland). Cycling conditions were: one cycle of 30 s at 95 °C, 40 cycles of 95 °C at 0 s; 5 s at the optimal anneal temperature; 10 s at, 72 °C. The accumulation of SYBR Green fluorescence was monitored once per cycle. This is a measure of the amount of product at each cycle as each primer set was optimized for complete exclusion of non-specific PCR products and primer-dimer.

The absorbance of diluted plasmid DNA stocks was measured at 260 nm, in a 6000 series spectrophotometer (Cecil Instruments, Cambridge, UK). For each of the three plasmids, a standard curve was produced using serial dilutions of 1 ng µl–1 to 100 fg µl–1, and this was used to derive the target cDNA starting concentrations. Each cDNA sample was replicated three times, while plasmid standard and water controls were duplicated. Following the 40 cycles, a single melt cycle was carried out, for analysis of melting peaks. Fluorescence was monitored continuously as the temperature rose at 0.2 °C s–1 from 65 °C to 95 °C. PCR products were checked by agarose gel electrophoresis to confirm product size. RNA was extracted from between 40–60 apices from plants, and synthesized cDNA was used for real-time PCR. Levels of ScLFY were expressed on a per apex basis, and further normalized against the expression of ß-tubulin. Standard curves using known quantities of plasmid DNA containing the target gene (ScLFY) and the ß-tubulin standard were used to estimate the levels of starting cDNA (data not shown). PCR products were quantified via real-time measurements of fluorescence, and product size was further verified on ethidium bromide-stained agarose gels. The LightCycler results were processed into melting peaks and quantified using Labview software (National Instruments, Austin, Tx, USA).

In situ hybridization
Young apical buds (apical dome, 3–4 pairs of primordia any axillary buds therein) were sampled on days 28–37, and on days 40 and 44 of the inductive 7LD treatment and on days 30 and 37 of the non-inductive treatment. The dissected buds were immersed in 4% (v/v) paraformaldehyde (Sigma, St Louis, Mo, USA) in phosphate buffered saline (PBS) for 24 h at 4 °C. Subsequently, the apices were washed in PBS for 30 min and were then taken through a dehydration series of alcohol (50–70%) each containing 0.85% NaCl (30 min) and left overnight in 85% ethanol c. 0.85% NaCl. The apices were then taken through the remainder of a standard alcohol/Histoclear series before embedding in paraffin wax (Paramat extra, BDH, London, UK) using a Tissue Tek III Cryoconsole (London, UK). Longitudinal sections (10 µm) were cut through the shoot apical meristems (5030 Microtome, Bright Instrument Co, London, UK), laid onto poly-L-lysine (Sigma, St Louis, Mo, USA)-coated slides and stretched at 37 °C using standard methods. Prior to hybridization, paraffin wax was removed by two 10 min washes in Histoclear, rehydrated through an ethanol series, and deproteinated through a 10 min incubation with protease (type XXV, Sigma, St Louis, Mo, USA) followed by a 2 min glycine wash. Tissue was re-fixed by a 10 min incubation in 4% paraformaldehyde (phosphate buffered to pH 7). Slides were then washed with PBS and then treated with 0.2 M triethanolamine, followed by washes in PBS for 2 min, followed by 2 min in 0.85% NaCl. Slides were then taken through an ethanol series and stored at 4 °C in fresh 100% ethanol.

The 233 bp fragment of the S. coeli-rosa homologue to LFY (ScLFY) was cloned in both orientations into pGEMT-Easy to synthesize both sense and antisense strands. Sense and antisense ScLFY RNA probes were synthesized from ScLFY linearized with SalI. After digestion, the plasmid was phenol/chloroform extracted and ethanol precipitated before proceeding with the in vitro transcription. In vitro transcription was carried out at 37 °C for 2 h from 1 µg of the linearized plasmid with 1 mM ATP, CTP, and GTP, 0.65 mM UTP, 0.35 mM DIG-UTP (Boehringer, Mannheim, Burgess Hill, West Sussex, UK), 40 mM TRIS–HCl pH 8, 6 mM MgCl2, 10 mM DTT, 2 mM spermidine, and 40 units T7 DNA polymerase (Boehringer, Mannheim, Burgess Hill, West Sussex, UK) in a total volume of 20 µl. The addition of 75 µl of 1x MS (10 mM TRIS–HCl, pH 7.5, 10 mM MgCl2, 50 mM NaCl), 2 µl tRNA (100 mg ml–1; Sigma, St Louis, Mo, USA) and 1 µl DNase, RNase free (10 U µl–1; Boehringer, Mannheim, Burgess Hill, West Sussex, UK), and a further 10 min incubation at 37 °C, stopped the reaction and digested the plasmid template.

The probe was subjected to a mild alkali hydrolysis in 50 µl carbonate buffer (80 mM NaHCO3, 120 mM Na2CO3, pH 10.2) at 60 °C. Slides were hybridized and washed, and the immunodetection carried out essentially as described in Coen et al. (1990). Following immunodetection, the colour reaction was stopped by a 5 min wash in distilled water and then the slides were taken through an ethanol series, and back into distilled water. Following a 10 min stain in fluorescent brightener (Sigma, St Louis, Mo, USA) slides were washed briefly in distilled water and air dried. They were mounted with entellan mounting media (BDH, London, UK) and examined by bright field illumination using an Olympus BH2 light microscope.

Southern blots
S. coeli-rosa genomic DNA was extracted from young leaf material pooled from several plants (Saghai-Maroof et al., 1984) and further purified on caesium chloride gradients. DNA (10 µg) were digested with EcoRI or HindIII and electrophoresed through 0.8% agarose gels. After vacuum-assisted transfer to Magna charge nylon membrane (Osmonics, Minnesota, USA), blots were pre-hybridized and hybridized in 6x SSC, 0.1%, sodium pyrophosphate, 5% PEG, 5x Denhardt's 100 µg ml–1 denatured herring sperm DNA. A PCR product comprising 233 bp from the C2 conserved 3' region of ScLFY (amplified using primers G1201 and G1204 detailed above) was used as a probe. Probes were prepared by random priming (Fienberg and Vogelstein, 1983) using a Pharmacia (Sandwich, Kent, UK) kit; hybridization was at 60 °C. Blots were washed with 2x SSC, 0.1% SDS at 60 °C.

Expression of ScLFY in Arabidopsis
The ScLFY open reading frame including 110 bp of 5' UTR was excised from pGEMT-Easy using EcoRI and cloned into the EcoRI site of the pSOV vector (Mylne and Botella, 1998) downstream of the CaMV 35S promoter. The pSOV clone was transformed into Agrobacterium tumefaciens GV3101, and wild-type Arabidopsis plants transformed by the floral dip method (Clough and Bent, 1998). Transformed seeds were selected using 0.5% Kaspar® (15% glufosinate ammonium). PCR using primers NR6 (CCCGAATAGCAGCCTTAATACCA) and SLF5P (GCTTATTTGGCCCGTGGGCTTCTT) (40 cycles at Tm 55 °C) confirmed the presence of the transgene. RNA was extracted from the confirmed transgenic plants, and cDNA as described above. RT-PCR using primers LCLFYF (GTTCCTTYTGCCTCTCRA CACAA) and NF2 (GACTAGAAGGGAGATTAA) confirmed expression of the transgene (40 cycles at Tm 55 °C).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Isolation and structure of the S. coeli-rosa LFY homologue, ScLFY
A portion of the ScLFY gene was cloned using degenerate PCR primers. The whole open reading frame (ORF) was cloned by repeated rounds of RACE and genome walking, and the ORF was cloned as a single PCR product by RT-PCR using primers designed from the partial clones. The ORF of ScLFY spans 1452 bp and encodes a putative protein of 483 amino acids (the nucleotide sequence data reported here will appear in the EMBL, GenBank, and DDBJ Nucleotide Sequence Databases under Accession numbers: AJ311804 [GenBank] , AJ311805 [GenBank] , and AJ311806 [GenBank] ).

Comparison of the predicted amino acid sequence to putative LFY homologues from several other plant species (Fig. 2) reveals an overall homology at the amino acid level of 43–55% and a similar pattern of conserved and variable regions. Of the two conserved domains (Fig. 2), the C1 domain of ScLFY shows 57–88% homology to C1 regions of other LFY genes and the C2 domain shows 76–91% homology. The central variable region of ScLFY shows only 10–38% homology and is longer compared with other LFY proteins. Motifs, thought to be important in the function of LFY as a transcriptional activator, are also conserved. Almost all LFY proteins (except, for example, the Eucalyptus homologue) have a proline-rich variable amino-terminus, a common feature of transcription factors (Mermod et al., 1989; Schindler et al., 1992; Gerber et al., 1994). In ScLFY there are 8/89 prolines (9%) which is within the range of other LFY genes, for example, five proline residues in Pinus radiata NLY (9%), and 19 (48%) in the rice homologue. An acidic region is located in the central variable region of ScLFY, and in other LFY homologue proteins, except for the Gnetum parvifolium and the two pine homologues. In ScLFY, this region comprises 13/16 acidic amino acids (81%). Highly acidic regions are the basis of the transcriptional activation function of several transcriptional activators, for example, GAL4, GCN4, and the herpes simplex virus protein, VP16 (Hope and Struhl, 1986; Ma and Ptashne, 1987; Triezenberg et al., 1988). The basic domain found in other LFY proteins is also present but less well conserved in the predicted ScLFY protein, similar to the situation in pine and rice. Glutamine-rich regions are common in transcription factors (Courey and Tjian, 1988; Cho et al., 1999) and a glutamine-rich region of 16 amino acids containing 44% glutamine residues was present in ScLFY overlapping with the basic domain.


Figure 2
View larger version (62K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Alignment of predicted amino acid sequence of the S. coeli-rosa LFY homologue (ScLFY), with homologues from Antirrhinum (FLO, M55525), pea (UNI, AF010190), Arabidopsis (LFY, M91208), Populus (PTFL, U93196), cauliflower (BOFH, 718362), petunia (ALF, AF030171), tomato (FA, AF197934), tobacco genes (NFL1 and 2, U161172 and U16174), Eucalyptus (ELF, AF034806), rice (RFL, AB005620), Pinus radiata (NLY and PRFLL, U76757 and U92008), Gnetum parvifolium (GpLFY, AB022667.1), and Welwitschia mirabilis (WEL, AF109130). Shading indicates amino acids identical to the consensus amino acid sequence and the dashes indicate gaps included to obtain the best alignment. Conserved regions (C1 and C2) are shown by bars above the alignment. Variable region 1 (V1) lies upstream of C1 and variable region 2 (V2) lies between C1 and C2. Basic and acidic domains (A and B) and the glutamine-rich region (GR) are shown as brackets. Glycine repeats (G1 and G2), and the asparagine repeat (N) are indicated by arrows. The positions of the conserved Leucine residues proposed to form a leucine zipper are indicated by an asterisk. The position of the two conserved introns and the novel intron identified in ScLFY are indicated by a diamond.

 
However, there are some notable areas of divergence from the other LFY genes, which might suggest functional differences. The 5' variable region of ScLFY, predicted as 90 aa is exceptionally long compared with other LFY genes where this region ranges from 14 aa in Eucalyptus globulus (Southerton et al., 1998) to 61 in Pinus radiata (Mellerowicz et al., 1998). In addition, as a result of the genome walking to find the 5' end of the gene, an intron of 808 bp was revealed close to the N-terminal end of C1. The splice sites conform to the AG:GT consensus and the intron sequence is highly AT rich (70% compared with the ORF which is 53%), a critical feature for correct splicing in dicots (Goodall and Filipowicz, 1991). To our knowledge, a similarly placed intron has not been reported in any of the other LFY homologues to date. The V2 domain of ScLFY is also longer than in the LFY proteins from other species with longer stretches of glycine residues and an anomalous seven asparagine residue repeat.

A sequence of 540 bp upstream from the ScLFY ATG, was analysed for the presence of regulatory motifs. An 8 bp motif: CAACGGCC at –483 to –475, conforms completely to the Gibberellic Acid Regulatory Element (Gubler et al., 1995). This element is approximately 200 bp further upstream compared to the GARE element identified in the Arabidopsis and cottonwood LFY gene promoters (Blázquez and Weigel, 2000), and differs in two residues, both from T to C. Apart from this motif, there is little homology between the ScLFY upstream region and that from cottonwood or Arabidopsis.

Copy number of ScLFY
Southern blotting using a portion of the ScLFY cDNA revealed a 4.3 kb EcoRI fragment and two HindIII fragments of size 2.4 and 2.3 kb which hybridized to the probe (Fig. 3). This suggests that ScLFY is present as a single copy or at most two copies within the S. coeli-rosa genome. This is in agreement with other LFY genes, which are also present as single copies. Sequencing of six complete ORF RT-PCR cDNA clones and numerous partial clones revealed the presence of at least three variants with differences at seven amino positions of the sequence and occasional silent base changes. Six out of the seven amino acid variations were confirmed not to be due to PCR error as they were found in more than one independent PCR product. In the case of the seventh (an arginine/glutamine at position 246) the glutamine variant was found in at least two independent PCR products, while the arginine variant was only sequenced from one PCR product. However, arginine is found at this position in LFY genes of at least four other species (Arabidopsis, Populus, rice, and pea) hence there is a clear indication that this too is a genuine variant. Overall there were very high levels of sequence homology between the variants (95–99% at the DNA level, >99% at the amino acid level within the ORF). The high levels of homology within the ORF together with the gene copy number from the Southern blot data suggest that these variants represent different alleles of the ScLFY gene present in the population of plants used for nucleic acid extraction.


Figure 3
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Southern blot of S. coeli-rosa genomic DNA digested with EcoRI and HindIII, probed using a portion of the ScLFY cDNA.

 
ScLFY is strongly up-regulated in florally induced SAMs or young flowers
Real-time RT-PCR was used to analyse the expression of ScLFY during floral induction and other selected treatments. This method was chosen due to the small quantities of material available for analysis and the low levels of expression of LFY in other species (Weigel et al., 1992; Franco-Zorilla et al., 1999). Furthermore, this approach allowed a quantitative comparison of ScLFY expression in the apex under different conditions. For these experiments, the sampling times were days 29, 30, 34, and 36 for the non-inductive SD treatment, day 28 through to day 36 of the 7LD inductive treatment and day 37 for both the inductive 7LD and 2 d darkness (7LD2Da) and non-inductive 7CL (7 d of continuous light) treatments (Table 1). The data are representative of replicate experiments (Allnutt, 2000).


View this table:
[in this window]
[in a new window]

 
Table 1. The number and type of days that constituted each treatment together with the percentage of plants that flowered in each treatment (n=>75)

 
The data, normalized in relation to ß-tubulin mRNA (Fig. 4), showed a dramatic up-regulation of ScLFY in the inductive treatments. ScLFY expression was very low to barely detectable, in the SD treatment (days 29, 30, 34, 36) and at day 28 of the LD treatment (Fig. 4). However, there was a progressive increase in ScLFY expression from day 33 reaching a highly significant 4-fold increase in ScLFY on day 36 when plants given 7 LD were returned to SD (7LD=100% of the plants are induced to flower). The 100% florally inductive 7LD+2Da treatment (Table 1) also resulted in a high level of ScLFY expression while in the non-inductive CL treatment, ScLFY expression was very low (Fig. 4).


Figure 4
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. Expression of ScLFY at various sampling times in the short-day (SD), 7 long-day (7LD), 7LD+2 d of darkness (7LD2Da), and continuous-light (CL) treatments using real-time PCR. The data are expressed as mean ±SE number of ScLFY mRNA copies relative to number of tubulin mRNA copies per apex. (n=3 PCR reactions using an average of 30–60 shoot apices).

 
Substantial spatial expression of ScLFY is limited to florally evoked and floral SAMs and to the newly initiated sepal primordia
The real-time PCR expression data are consistent in showing increased ScLFY expression during the later LDs of specific LD treatments, but very low expression in either the SD or CL non-inductive treatments (Fig. 4). In situ hybridization was therefore used to test whether spatial expression would be restricted to SAMs sampled from the inductive LD treatments. Mostly, ScLFY spatial expression was limited to SAMs that were evoked or about to make the first floral whorl (Fig. 5). For example, the earliest that substantial ScLFY expression was observed in the SAM was on day 35 (7LD) of the LD inductive treatment (Fig. 5A). In these SAMs, expression was mainly restricted to the peripheral zone in regions destined to form the first pair of sepals (Fig. 5A). However, expression on day 36 (7LD+1SD) was detectable throughout the SAM and in the tips of newly initiated sepal primordia (Fig. 5B). In vegetative SAMs sampled on day 30 (Fig. 5C) there is a faint hint of expression in the tips of the youngest primordia and in 3–4 cells of the tunica. However, ScLFY expression could not be detected in situ in vegetative SAMs sampled at any other times. Sense strand RNA control probes failed to generate a signal above that of background, indicating that the hybridization signal was specific to ScLFY mRNA (Allnutt, 2000).


Figure 5
View larger version (51K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. In situ hybridization of ScLFY to apices of plants exposed to the 7LD treatment and sampled on (A) day 35, (B) day 36, and (C) a vegetative SAM sampled on day 30. Arrows locate tips of leaf primordia (A) and sepals (B) Bar scale=100 µm.

 
Expression of ScLFY in wild-type Arabidopsis and in the lfy mutant background
To test whether expression of ScLFY in Arabidopsis affected flowering time, the ORF including 110 bp of upstream sequence driven by the CaMV 35S promoter was expressed in wild-type Arabidopsis. Fourteen transgenic lines were recovered which were positive by PCR using ScLFY-specific primers. Seeds from three lines (3, 12, and 13) which tested positive by RT-PCR for ScLFY expression and line 4, which was transformed but RT-PCR negative (Fig. 6) were sown and grown in both short days (8 h light) and long days (16 h light). Transgenic plants were phenotypically normal. Time to flowering was measured, but there was no significant difference between the transgenic and non-transgenic control (data not shown).


Figure 6
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. RT-PCR of Arabidopsis plants transformed with 35S: ScLFY using primers LCLFYF and NF2, showing expression of the transcript in leaves in lines 3, 12, and 13, while line 4 was negative by RT-PCR although it carried the ScLFY transgene.

 
One transgenic line which was positive for ScLFY expression by RT-PCR was selected for crossing to the lfy mutant. A segregating population of lfy mutants was crossed to the ScLFY transgenic line using the transgenic line as the pollen parent. Seeds from six independent crosses were collected and selfed seeds from the same plants were also collected. The selfed seed was sown and four of the lines contained individuals with a clear lfy phenotype, confirming that the parent plant was heterozygous for the lfy mutation. To confirm that the ScLFY gene had been transferred, several plants from each cross were tested by PCR. Eleven plants from two independent crosses were confirmed positive for ScLFY. Thus the genotype of these plants is LFY/LFY, ScLFY/- or LFY/lfy, ScLFY/-. The 11 plants were allowed to self, seedlings (248) were grown to maturity and scored for lfy phenotype. Three of the 11 lines comprising 154 individuals contained a total of 38 lfy mutant plants. The phenotype of the lfy mutants was indistinguishable from lfy plants scored from the lfy segregant population. The predicted ratio of lfy phenotype to wild type for a line carrying the lfy mutation would be 25%, thus the 27% recorded here does not indicate a deviation from the expected ratio. Had the ScLFY gene complemented the lfy mutation, all progeny should have been wild type in phenotype or the phenotype of mutant plants may have been less severe. However, this was not observed. PCR amplification verified that the ScLFY gene was present in lfy mutant phenotypes, confirming that the ScLFY gene did not complement the lfy mutation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
A cDNA has been isolated from S. coeli-rosa apices that shows striking homology to the LFY gene from Arabidopsis (Schultz and Haughn, 1991) and homologues from other species (see Introduction). Analysis of the coding region reveals the expected conserved regions as well as regions found in genes that encode transcription factors. However, expression of ScLFY in wild-type Arabidopsis did not confer the expected reduced time to flowering which was found when LFY homologues from other species were expressed in Arabidopsis (e.g. apple, Wada et al., 2002; poplar, Rottmann et al., 2000). Likewise, expression of ScLFY in the Arabidopsis lfy mutant background failed to complement the mutation. This type of rigorous functional test of LFY homologues has been performed for only a few LFY genes (e.g. several species from the mustard family, Yoon and Baum, 2004; tropical pine, Dornelas and Rodriguez, 2005) while for others (e.g. tobacco, Ahearn et al., 2001; maize, Bomblies et al., 2003; vine, Carmona et al., 2002; Chenopodium rubrum, Veit et al., 2004), this experiment has not been done to our knowledge. In other cases, for example, the rice gene, RFL, expression of the homologue in Arabidopsis did not produce the expected phenotype (Kyozuka et al., 1998) or as in the case of the Lolium LFY gene only partially complemented the Arabidopsis lfy mutant (Gocal et al., 2001). Hence, do all LFY homologues complement the Arabidopsis mutant or interact fully with the endogenous transcription machinery to alter the timing of flowering? To our knowledge, this is the first report of a LFY-like gene that neither induces a phenotype when expressed under the 35S promoter in Arabidopsis, nor complements the Arabidopsis lfy phenotype. Thus, our results suggest substantial divergence between the S. coeli-rosa gene and Arabidopsis LFY. Although the predicted ORF of ScLFY was 56% homologous to Arabidopsis LFY, there are three features which are substantially divergent from other LFY genes: the 5' variable region and the V2 domain of ScLFY are exceptionally long, and there is an additional intron close to the N-terminal end of region C1. Possibly, one or more of these features contribute to the failure of ScLFY to behave like other LFY homologues when expressed in Arabidopsis. Another possibility is that ScLFY is not a direct homologue of LFY and that S. coeli-rosa contains other genes more closely related to LFY. However, Southern blotting revealed that ScLFY is a single copy gene (or, at most, present in two copies). Hence if other LFY-like genes exist in the S. coeli-rosa genome they must be significantly divergent from the gene described here. Several variants of ScLFY showing high homology to each other were identified during sequencing of independent clones. However, given the results of the Southern blotting these cannot be independent loci and must have been derived from alleles within the plant population. As noted by Donnison (1992) S. coeli-rosa is strongly protandrous making it an obligate out-breeder. Given that in almost all other species studied LFY exists as a single gene (Frohlich and Parker, 2000), ScLFY is most likely the LFY homologue in S. coeli-rosa, but it is too divergent to complement the Arabidopsis lfy mutant or affect flowering time when expressed in wild-type Arabidopsis. Note, in our study, ScLFY expression in S. coeli-rosa is confined to evoked apices and to the sepal whorl.

Expression of ScLFY was investigated in two ways. Firstly, real-time PCR explored the expression of this gene in response to day length treatments. Data showed a clear up-regulation of ScLFY starting at day 33 (days 28–33=5LD). In the work reported here, 5 LD (=80% flowering) is the threshold inductive treatment (Allnutt, 2000). Note that an increase in ScLFY expression and flowering were suppressed in the non-inductive CL treatment, but ScLFY was expressed strongly in the 7LD and 7LD2Da inductive treatments. Note also that the latter treatment suppresses growth of the SAM transiently, but not flowering (Grose and Lyndon, 1984). Hence the up-regulation of ScLFY fits extremely well with those conditions that induce flowering. Moreover, it was confirmed that this species is incapable of flowering in short days (SD) or continuous fluorescent LD (Lyndon, 1985; Donnison and Francis, 1993).

The clear up-regulation of ScLFY in induced S. coeli-rosa, contrasts with the expression of LFY homologues in other species such as the obligate photoperiodic SD plant, N. tabacum cv. Maryland Mammoth where there is apparently no difference in levels of NFL in vegetative compared with floral SAMs (Kelly et al., 1995). In the facultative LD plant, Antirrhinum, FLO transcription is absolutely correlated with floral induction and is completely absent in vegetative meristems even when measured by RT-PCR (Bradley et al., 1996b). However, in the facultative LD plant Arabidopsis, LFY is expressed at low levels in leaf primordia during the vegetative phase and its expression is up-regulated by florally inductive LD (Blázquez et al., 1997). This was quantified as a 2-fold increase in LFY promoter::GUS activity between 9 d and 20 d after transfer to LD (Blázquez et al., 1997) whereas in SD there was a more gradual rise in activity. Following 8 weeks of SD, LFY RNA was detected in flower primordia (Blázquez et al., 1997). However, in S. coeli-rosa in non-inductive SD, the level of ScLFY expression shown by both real-time PCR and in situ was extremely low but underwent a 4–10-fold increase in expression in plants given florally inductive LD treatments. Thus ScLFY's expression pattern lies somewhere between that in Antirrhinum and Arabidopsis.

Spatial studies of ScLFY expression also revealed some interesting differences to other LFY homologues. Strong in situ hybridization was first detectable on day 35 (7LD) where it was restricted to the peripheral zone of the meristem. However, in SAMs sampled 1 d later, the tips of the two developing sepal primordia were also stained and the hybridization spread to the whole of the SAM. Only faint hybridization was detected in vegetative meristems. This pattern of hybridization is most similar to Antirrhinum where FLO expression is first observed in induced plants on the margins and adaxial layers of emerging primordia at the apex (Coen and Meyerowitz, 1991; Bradley et al., 1996b). This is different from Arabidopsis (Blázquez et al., 1997) where expression is throughout the dome and increases in intensity with development (Weigel et al., 1992). Also, floral morphogenesis is entirely different in S. coeli-rosa compared with Arabidopsis. In S. coeli-rosa, the terminal evoked apical meristem switches to a terminal floral meristem that initiates the floral whorls. Loss of apical dominance then enables secondary shoot meristems to switch to secondary flowers resulting in a monochasial cyme (Lyndon, 1985). However, in Arabidopsis, floral morphogenesis begins when the vegetative apical meristem switches to an inflorescence meristem that, in turn, initiates secondary inflorescences that form flower primordia. Eventually, both primary and secondary inflorescences terminate in terminal flowers (Schultz and Haughn, 1991). That ScLFY is strongly expressed in the evoked meristem whilst LFY expression increases temporally as more flower primordia form, is entirely consistent with these divergent morphogenetic responses. We suggest that while ScLFY commits the vegetative apical meristem to become floral, LFY (together with AP1 and CAL) commits inflorescence primordia to form flowers.

In Arabidopsis, LFY may play an important role in integrating florally inductive signals. An 8 bp motif (CAACTGTC) was identified in the LFY promoter which conforms to the Myb transcription factor consensus binding sequence YAACKGHH (Urao et al., 1995), subsequently identified in GA responsive elements (GARE) (Gubler et al., 1995). This motif is a requirement for GA regulation of LFY expression (Blázquez and Weigel, 2000). Although the GARE sequence identified in the ScLFY 5' region is further upstream compared with cottonwood and Arabidopsis, its presence may suggest GA-regulated ScLFY expression. Note, however, that exogenous application of GA3 to S. coeli-rosa in SD could not induce flowering (Miller and Lyndon, 1977) although the plants began to show an internodal lengthening, that was characteristic of a GA-growth effect (RF Lyndon, unpublished data). However when applied during induction, GA could induce an acceleration of flower bud appearance, but only when GA was supplied during induction, whereas IAA and ABA had a general negative effect on flower number (Taylor, 1975). In our view, therefore, endogenous GA regulation of flowering in conjunction with other signalling requirements cannot be excluded. In summary, a S. coeli-rosa gene identified with degenerate LFY PCR primers, was only highly expressed in shoot apical meristems of S. coeli-rosa plants committed to form flowers. If it is not a functional LFY, the data argue strongly for a LFY-like meristem identity gene.


    Acknowledgements
 
GA thanks the University of Worcester and Cardiff University for a studentship and we thank Gareth Lewis for sequencing and Dr NH Battey, University of Reading, UK, for providing PCR primers and assistance with in situ hybridization methodology.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Ahearn KP, Johnson HA, Weigel D, Wagner DR. NFL1, a Nicotiana tabacum LEAFY-like gene, controls meristem initiation and floral structure. Plant and Cell Physiology (2001) 42:1130–1139.[Abstract/Free Full Text]

Aksenova NP, Milyaeva EL, Romanov GA. Florigen goes molecular: seventy years of the hormonal theory of flowering regulation. Russian Journal of Plant Physiology (2006) 53:401–406.[CrossRef][Web of Science]

Allnutt G. Characterization of a LEAFY homologue, a gene regulating floral meristem identity, from the model long day plant, Silene coeli-rosa (2000) PhD thesis: University of Wales.

Araki T. Transition from vegetative to reproductive phase. Current Opinion in Plant Biology (2001) 4:63–68.[CrossRef][Web of Science][Medline]

Blázquez M, Soowal L, Lee I, Weigel D. LEAFY expression and flower initiation in Arabidopsis. Development (1997) 124:3835–3844.[Abstract]

Blázquez M, Weigel D. Integration of floral inductive signals in Arabidopsis. Nature (2000) 404:889–892.[CrossRef][Medline]

Bomblies K, Wang R-L, Ambrose BA, Schmidt RJ, Meeley RB, Doebley J. Duplicate FLORICAULA/LEAFY homologs zfl1 and zfl2 control inflorescence architecture and flower patterning in maize. Development (2003) 130:2385–2395.[Abstract/Free Full Text]

Bradley D, Carpenter R, Copsey L, Vincent C, Rothstein S, Coen E. Control of inflorescence architecture in Antirrhinum. Nature (1996a) 379:791–797.[CrossRef][Medline]

Bradley D, Vincent C, Carpenter R, Coen E. Pathways for inflorescence and floral induction in Antirrhinum. Development (1996b) 122:1535–1544.[Abstract]

Carmona MJ, Cubas P, Martínez-Zapater JM. VFL, the grapevine FLORICAULA/LEAFY ortholog, is expressed in meristematic regions independently of their fate. Plant Physiology (2002) 130:68–77.[Abstract/Free Full Text]

Cho S, Jang S, Chae S, Min Chung K, Moon Y, An G, Jang S. Analysis of the C-terminal region of Arabidopsis thaliana APETALATA1 as a transcription activation domain. Plant Molecular Biology (1999) 40:419–429.[CrossRef][Web of Science][Medline]

Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant Journal (1998) 16:735–743.[CrossRef][Web of Science][Medline]

Coen E, Meyerowitz E. The war of the whorls: genetic interactions controlling flower development. Nature (1991) 353:31–37.[CrossRef][Medline]

Coen E, Romero J, Doyle S, Elliot R, Murphy G, Carpenter R. FLORICAULA: a homeotic gene required for flower development in Antirrhinum majus. Cell (1990) 63:1311–1322.[CrossRef][Web of Science][Medline]

Courey A, Tjian R. Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation domain. Cell (1988) 55:887–898.[CrossRef][Web of Science][Medline]

Donnison IS. Floral determination in the long day plant. In: Silene coeli-rosa (1992) PhD thesis: University of Wales.

Donnison IS, Francis D. Determination of floral organ type in cultured Silene shoot apices. Physiologia Plantarum (1993) 89:315–322.[CrossRef]

Dornelas MC, Rodriguez APM. A FLORICAULA/LEAFY gene homolog is preferentially expressed in developing female cones of the tropical pine Pinus caribaea var. caribaea. Genetics and Molecular Biology (2005) 28:299–307.[Web of Science]

Evans LT. Flower induction and the florigen concept. Annual Review of Plant Physiology (1971) 22:365–394.

Fienberg AP, Vogelstein B. A technique for radiolabelling DNA restriction fragments to high specific activity. Analytical Biochemistry (1983) 132:6–13.[CrossRef][Web of Science][Medline]

Franco-Zorrilla J, Fernandez-Calvin B, Madueno F, Cruz-Alvarez M, Salinas J, Martinez-Zapater J. Identification of genes specifically expressed in cauliflower reproductive meristems: molecular characterization of BoREM. Plant Molecular Biology (1999) 39:427–436.[CrossRef][Web of Science][Medline]

Frohlich MW, Parker DS. The mostly male theory of flower evolutionary origins: from genes to fossils Systematic Botany (2000) 25:155–171.

Gerber H, Seipel K, Georgiev O, Hofferer M, Hug M, Rusconi S, Schaffner W. Transcriptional activation modulated by homopolymeric glutamine and proline stretches. Science (1994) 263:808–811.[Abstract/Free Full Text]

Gocal GFW, King RW, Blundell CA, Schwartz OM, Andersen CH, Weigel D. Evolution of floral meristem identity genes. Analysis of Lolium temulentum genes related to APETALA1 and LEAFY of Arabidopsis. Plant Physiology (2001) 125:1788–1801.[Abstract/Free Full Text]

Goodall GJ, Filipowicz W. Different effects of intron nucleotide composition and secondary structure on pre-messenger-RNA splicing in monocot and dicot plants. EMBO Journal (1991) 10:2635–2644.[Web of Science][Medline]

Grose S, Lyndon RF. Inhibition of growth and synchronized cell division in the shoot apex in relation to flowering in Silene. Planta (1984) 161:289–294.[CrossRef][Web of Science]

Gubler F, Kalla R, Roberts JK, Jacobsen JV. Gibberellin-regulated expression of a Myb gene in barley aleurone cells: evidence for Myb transactivation of a high-pl alpha-amylase gene promoter. The Plant Cell (1995) 7:1879–1891.[Abstract]

Hempel F, Weigel D, Mandel M, Ditta G, Zambryski P, Feldman L, Yanofsky M. Floral determination and expression of floral regulatory genes in Arabidopsis. Development (1997) 124:3845–3853.[Abstract]

Hope I, Struhl K. Functional dissection of a eukaryotic transcriptional activator protein, GCN4 of yeast. Cell (1986) 46:885–894.[CrossRef][Web of Science][Medline]

Huang T, Böhlenius H, Eriksson S, Parcy F, Nilsson O. The mRNA of the Arabidopsis gene FT moves from leaf to shoot apex and induces flowering. Science (2005) 309:1694–1696.[Abstract/Free Full Text]

Kelly A, Bonnlander M, Meeks-Wagner D. NFL, the tobacco homologue of FLORICAULA and LEAFY, is transcriptionally expressed in both vegetative and floral meristems. The Plant Cell (1995) 7:225–234.[Abstract]

Kyozuka J, Konishi S, Nemoto K, Izawa T, Shimamoto K. Down regulation of RFL, the FLO/LFY homologue of rice, accompanied with panicle branch initiation. Proceedings of the National Academy of Sciences, USA (1998) 95:1979–1982.[Abstract/Free Full Text]

Liljegren S, Gustafson-Brown C, Pinyopich A, Ditta G, Yanofsky M. Interactions among APETALA1, LEAFY, and TERMINAL FLOWER1 specify meristem fate. The Plant Cell (1999) 11:1007–1018.[Abstract/Free Full Text]

Lyndon RF. A modification of flowering and phyllotaxis in Silene. Annals of Botany (1979) 43:553–558.[Abstract/Free Full Text]

Lyndon RF. Silene coeli-rosa. In: A handbook of flowering—Halevy A, ed. (1985) Vol. IV. Florida: CRC, Boca Raton. 313–319.

Ma J, Ptashne M. Deletion analysis of GAL4 defines 2 transcriptional activating segments. Cell (1987) 48:847–853.[CrossRef][Web of Science][Medline]

Mellerowicz EJ, Horgan K, Walden A, Coker A Walter C. PRFLL: a Pinus radiata homologue of FLORICAULA and LEAFY is expressed in buds containing vegetative shoot and undifferentiated male cone primordia. Planta (1998) 206:619–629.[CrossRef][Web of Science][Medline]

Mermod N, O'Neill E, Kelly T, Tjian R. The proline-rich transcriptional activator of CTF/NF-I is distinct from the replication and DNA binding domain. Cell (1989) 58:741–753.[CrossRef][Web of Science][Medline]

Miller MB, Lyndon RF. Rates of growth and cell division in the shoot apex of Silene during the transition to flowering. Journal of Experimental Botany (1976) 27:1142–1148.[Abstract/Free Full Text]

Miller MB, Lyndon RF. Changes in RNA levels in shoot apex of Silene during transition to flowering. Planta (1977) 136:167–172.[CrossRef][Web of Science]

Mylne J, Botella JR. Binary vectors for sense and antisense expression of Arabidopsis ESTs. Plant Molecular Biology Reporter (1998) 16:257–262.[CrossRef][Web of Science]

Ormrod JC, Francis D. Effects of interpolated dark periods during the first long day of floral induction on the cell cycle in the shoot apex of Silene coeli-rosa. Physiologia Plantarum (1987) 71:372–378.[CrossRef]

Parcy F, Bomblies K, Weigel D. Interaction of LEAFY, AGAMOUS and TERMINAL FLOWER1 in maintaining floral meristem identity in Arabidopsis. Development (2002) 129:2519–2527.[Web of Science][Medline]

Pouteau S, Nicholls D, Tooke F, Coen E, Battey N. The induction and maintenance of flowering in Impatiens. Development (1997) 124:3343–3351.[Abstract]

Rottmann W, Meilan R, Sheppard L, Brunner A, Skiner J, Caiping M, Cheng S, Jouanin L, Pilate G, Strauss S. Diverse effects of overexpression of LEAFY and PTFL, a poplar (Populus) homologue of LEAFY/FLORICAULA, in transgenic poplar and Arabidopsis. The Plant Journal (2000) 22:235–245.[CrossRef][Web of Science][Medline]

Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW. Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proceedings of the National Academy of Sciences, USA (1984) 81:8014–8018.[Abstract/Free Full Text]

Schindler U, Terzaghi W, Beckman H, Kadesch T, Cashmore A. DNA binding site preferences and transcriptional activation properties of the Arabidopsis transcription factor GBF1. EMBO Journal (1992) 11:1275–1289.[Web of Science][Medline]

Schultz E, Haughn G. LEAFY, a homeotic gene that regulates inflorescence development in Arabidopsis. The Plant Cell (1991) 3:771–781.[Abstract/Free Full Text]

Southerton SG, Strauss SH, Olive MR, Harcourt RL, Decroocq V, Zhu X, Llewellyn DJ, Peacock WJ, Dennis ES. Eucalyptus has a functional equivalent of the Arabidopsis floral meristem identity gene LEAFY. Plant Molecular Biology (1998) 37:897–910.[CrossRef][Web of Science][Medline]

Taylor SMJ. Factors controlling the flowering of Viscaria candidia (1975) PhD thesis: University of London.

Trienzenberg S, Kingsbury R, McKnight S. Functional dissection of VP16, the trans-activator of herpes simplex virus immediate early gene expression. Genes and Development (1988) 2:718–729.[Abstract/Free Full Text]

Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K. An Arabidopsis myb homologue is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. The Plant Cell (1993) 5:1529–1539.[Abstract]

Veit J, Wagner E, Albrechtová JTP. Isolation of a FLORICAULA/LEAFY putative orthologue from Chenopodium rubrum and its expression during photoperiodic flower induction. Plant Physiology and Biochemistry (2004) 42:573–578.[CrossRef][Web of Science][Medline]

Wada M, Cao Q, Kotoda N, Soejima J, Masuda T. Apple has two orthologues of FLORICAULA/LEAFY involved in flowering. Plant Molecular Biology (2002) 49:567–577.[CrossRef][Web of Science][Medline]

Weigel D, Nilsson O. A developmental switch sufficient for flower initiation in diverse plants. Nature (1995) 377:495–500.[CrossRef][Medline]

Weigel D, Alvarez J, Smyth D, Yanofsky M, Meyerowitz EM. LFY controls floral meristem identity in Arabidopsis. Cell (1992) 69:843–859.[CrossRef][Web of Science][Medline]

Yoon H-S, Baum DA. Transgenic study of parallelism in plant morphological evolution. Proceedings of the National Academy of Sciences, USA (2004) 101:6524–6529.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Bot.Home page
P. J. Rudall, M. V. Remizowa, G. Prenner, C. J. Prychid, R. E. Tuckett, and D. D. Sokoloff
Nonflowers near the base of extant angiosperms? Spatiotemporal arrangement of organs in reproductive units of Hydatellaceae and its bearing on the origin of the flower
Am. J. Botany, January 1, 2009; 96(1): 67 - 82.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
Compiled by, F. Tooke, T. Chiurugwi, and N. Battey
Flowering Newsletter bibliography for 2007
J. Exp. Bot., July 18, 2008; (2008) ern109v1.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
58/8/2249    most recent
erm090v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Allnutt, G. V.
Right arrow Articles by Herbert, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Allnutt, G. V.
Right arrow Articles by Herbert, R. J.
Agricola
Right arrow Articles by Allnutt, G. V.
Right arrow Articles by Herbert, R. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?