Skip Navigation



JXB Advance Access published online on November 17, 2007

Journal of Experimental Botany, doi:10.1093/jxb/erm249
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
58/14/3949    most recent
erm249v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Glaring, M. A.
Right arrow Articles by Baunsgaard, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glaring, M. A.
Right arrow Articles by Baunsgaard, L.
Agricola
Right arrow Articles by Glaring, M. A.
Right arrow Articles by Baunsgaard, L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2007 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. This paper is available online free of all access charges (see
http://jxb.oxfordjournals.org/open_access.html for further details)


RESEARCH PAPER

An extra-plastidial {alpha}-glucan, water dikinase from Arabidopsis phosphorylates amylopectin in vitro and is not necessary for transient starch degradation

Mikkel A. Glaring1,*, Agnieszka Zygadlo1 {dagger}, David Thorneycroft3, Alexander Schulz2, Steven M. Smith3,4, Andreas Blennow1 and Lone Baunsgaard1 {dagger}

1Plant Biochemistry Laboratory, Center for Molecular Plant Physiology (PlaCe), Department of Plant Biology, Faculty of Life Sciences, University of Copenhagen, 40 Thorvaldsensvej, 1871 Frederiksberg C, Copenhagen, Denmark
2Plant Physiology and Anatomy Laboratory, Department of Plant Biology, Faculty of Life Sciences, University of Copenhagen, Denmark
3Institute of Molecular Plant Sciences, University of Edinburgh, Edinburgh EH9 3JH, UK
4ARC Centre of Excellence in Plant Energy Biology, University of Western Australia, WA 6009, Australia

* To whom correspondence should be addressed. E-mail: mig{at}life.ku.dk

Received 18 July 2007; Revised 17 September 2007 Accepted 18 September 2007


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Starch phosphorylation catalysed by the {alpha}-glucan, water dikinases (GWD) has profound effects on starch degradation in plants. The Arabidopsis thaliana genome encodes three isoforms of GWD, two of which are localized in the chloroplast and are involved in the degradation of transient starch. The third isoform, termed AtGWD2 (At4g24450), was heterologously expressed and purified and shown to have a substrate preference similar to potato GWD. Analyses of AtGWD2 null mutants did not reveal any differences in growth or starch and sugar levels, when compared to the wild type. Subcellular localization studies in Arabidopsis leaves and in vitro chloroplast import assays indicated that AtGWD2 was not targeted to the chloroplasts. The AtGWD2 promoter showed a highly restricted pattern of activity, both spatially and temporally. High activity was observed in the companion cells of the phloem, with expression appearing just before the onset of senescence. Taken together, these data indicate that, although AtGWD2 is capable of phosphorylating {alpha}-glucans in vitro, it is not directly involved in transient starch degradation.

Key words: Arabidopsis, dikinase, GWD, phloem, starch degradation, starch phosphorylation


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In recent years, significant progress has been made in elucidating the enzymatic pathways responsible for the degradation of transient starch in Arabidopsis thaliana (Lloyd et al., 2005; Smith et al., 2005; Zeeman et al., 2007). Analysis of plants mutated in plastidic glucan phosphorylase has suggested that the phosphorolytic pathway of starch degradation is not required under normal growth conditions (Zeeman et al., 2004). Rather, hydrolytic breakdown of starch leads to the formation of maltose and glucose as primary products of degradation (Niittylä et al., 2004; Weise et al., 2004). The analysis of starch degradation is confounded by the multitude of isoforms of enzymes capable of degrading starch or related glucans. Few studies of starch metabolism in Arabidopsis have focused on the function of starch-degrading enzymes not directly involved in the metabolism of transient starch or its degradation products. Many of these enzymes show subcellular localizations not compatible with a plastidic localization of starch and suggest alternative locations of starch or starch-like molecules. The Arabidopsis genome encodes two {alpha}-amylases and six ß-amylases predicted to be localized outside the plastids (Lloyd et al., 2005). No in vivo substrate has so far been identified for any of these enzymes and there is little experimentally based information on their subcellular localization. Mutations in the extra-plastidial isoform of ß-amylase RAM1 (BAM5), which has been localized to the phloem (Wang et al., 1995), lead to a significant decrease in ß-amylase activity in Arabidopsis, but only minor changes in starch metabolism (Laby et al., 2001; Kaplan and Guy, 2005).

The enzyme responsible for the initial attack on the granule has not been clearly identified, but contrary to previous beliefs, it has been determined that the endoamylolytic action of {alpha}-amylases is not solely responsible for this process (Kaplan and Guy, 2005; Yu et al., 2005). The production of maltose during the degradation of starch has implicated the ß-amylases in starch degradation. ß-amylases are exoamylases that produce maltose by successive cleavage from the non-reducing end. Furthermore, a recent report has provided evidence that the debranching enzyme (isoamylase) ISA3 acts directly at the granule surface in Arabidopsis (Delatte et al., 2006). This debranching activity presumably removes short branches from the granule surface enabling further degradation by the ß-amylases. Based on these results, it was suggested that ISA3 and ß-amylase act progressively to degrade the starch granule surface (Delatte et al., 2006). Suppression of a chloroplast-localized ß-amylase in Arabidopsis (BAM3), and the corresponding potato orthologue, leads to a starch-excess phenotype in leaves as a result of impaired starch degradation (Scheidig et al., 2002; Kaplan and Guy, 2005). Maltose produced by ß-amylase is exported from the chloroplast by the transporter MEX1 (Niittylä et al., 2004) and further metabolized in the cytosol by the glucanotransferase DPE2 (Chia et al., 2004; Lu and Sharkey, 2004). This process involves a recently identified cytosolic soluble heteroglycan (Fettke et al., 2005). This heteroglycan has been studied in DPE2 mutants and found to be indirectly involved in starch degradation partly by acting as a carbohydrate acceptor for the DPE2-catalysed transfer of glucose from maltose (Fettke et al., 2006).

Regardless of the mechanism of soluble glucan release from the starch granule, it is clear that it requires the activity of the {alpha}-glucan, water dikinases (GWD, Lorberth et al., 1998; Yu et al., 2001; Ritte et al., 2002). The GWDs are responsible for phosphorylating the glycosyl residues of starch, a process that takes place during both biosynthesis and degradation (Nielsen et al., 1994; Ritte et al., 2004). Repressing or eliminating the activity of potato GWD or the Arabidopsis orthologue AtGWD1/SEX1 (At1g10760), leads to a severely reduced phosphate content in starch and a starch-excess phenotype in leaves caused by a decreased rate of starch degradation (Lorberth et al., 1998; Yu et al., 2001). One homologue of AtGWD1 in Arabidopsis, termed AtGWD3 or PWD (At5g26570), is chloroplastic and involved in the phosphorylation of pre-phosphorylated glucans, an activity which is essential for the complete degradation of transient starch during the night (Baunsgaard et al., 2005; Kötting et al., 2005). Despite the essential role of starch-bound phosphate in starch degradation, the link between phosphorylation and degradation is not understood. It has been suggested that the activity of amylolytic enzymes might rely on direct interaction with phosphate groups or that the inclusion of phosphate affects the properties of amylopectin (Blennow et al., 2002; Ritte et al., 2002). A recent report has shown that GWD activity stimulates the breakdown of starch granules in vitro by plastidial ß-amylases, leading the authors to suggest that phosphorylation by GWD causes a partial unwinding of the amylopectin double helix, thereby facilitating a subsequent enzymatic attack (Edner et al., 2007).

A third GWD, named AtGWD2, with 50% homology to AtGWD1 has been identified in the Arabidopsis genome (Yu et al., 2001). AtGWD2 has a domain structure more similar to AtGWD1 than AtGWD3/PWD, but lacks an apparent chloroplast transit peptide, making it likely to be a cytosolic isoform of GWD. The putative extra-plastidial glucan phosphorylating activity raises some interesting questions about the function of AtGWD2 and prompted us to investigate the substrate preference of this enzyme and its involvement in transient starch metabolism.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Plant material and growth conditions
The mutant Atgwd2-1 was obtained by screening a T-DNA transformed Arabidopsis population from the University of Wisconsin Arabidopsis knockout facility (Krysan et al., 1999). Atgwd2-2 was obtained directly from the GABI-Kat program (line 257E09; www.gabi-kat.de; Rosso et al., 2003). The mutant Atgwd2-3 was obtained from the SALK T-DNA mutant population (line SALK_080260; Alonso et al., 2003) provided by the European Arabidopsis Stock Centre (NASC, http://arabidopsis.info). Homozygous mutants were isolated by PCR screening of isolated genomic DNA. Standard PCR conditions were used to amplify a section of DNA spanning the reported insertion site in AtGWD2 (insert test primers for Atgwd2-1; GWDb3: AGAACTCTCCAAGAGATCTGTGGGC, GWDb4r: ATCTCTCAGCCTCTTTCTCTCGCTC, Atgwd2-2; GWDb10: GAGACTAACTATGGCACTTGTGGGT, GWDb11r: CCATTGACAGCAAAGACATGATGACC, Atgwd2-3; GWDb1: TACAGACCTCATGATGTTCAGTGGG, GWD2-12r: GATATTGCTCTCCCTTCCTTCGACT). Positives were verified by PCR using the insert test primers and primers matching the T-DNA border. Total RNA was isolated and reverse transcribed using standard molecular biology methods. The absence of a functional AtGWD2 transcript was verified by PCR using the insert test primers and a positive control. The Arabidopsis thaliana ecotypes Columbia-0 and Wassilewskija and the Atgwd2 mutants were grown from seed in potting compost in growth chambers at 20 °C and 70% relative humidity with an 8 h photoperiod at a photon flux density of 120 µmol photons m–2 s–1.

Phylogenetic analysis
The phylogenetic tree was based on a previous version containing GWD sequences identified from higher plants (Baunsgaard et al., 2005). This tree was based on the alignment of the nucleotide binding domains corresponding to amino acids 1006–1194 of AtGWD3. The tree was expanded by the addition of a new citrus homologue of AtGWD2 identified in HarvEST (unigene #16433, http://harvest.ucr.edu) and two pairs of poplar sequences of which one from each pair is represented in the phylogenetic tree (GWD3 clade: genome scaffold LG_II: 22.012.650-22.013.216 and GWD1 clade: LG_VIII: 12.855.187-12.856.452; http://www.jgi.doe.gov/poplar). Furthermore, sequences from organisms other than higher plants were included in the analysis. Three GWD homologues from the green alga Chlamydomonas reinhardtii were identified from a previously published phylogenetic analysis of GWDs [Mikkelsen et al., 2004; accession nos Chlamydomonas a, BG857380; b, BF866067/AW661031; c, genome release version 3.0, scaffold 32, 64268–65561 (http://genome.jgi-psf.org/Chlre3)]. Two GWDs from the green alga Ostreococcus tauri were identified in GenBank [accession nos AY570708 (spr1a) and AY570720 (spr1b)]. GWD homologues from the apicomplexan parasites Cryptosporidium parvum (mRNA sequence, accession no. XM_626438) and Toxoplasma gondii (assembled from EST accession nos BU575407, BG658300, BG659286, CN194874, and genomic sequence) were also included. Other accession numbers were as follows. AtGWD1 clade: AtGWD1, NP_563877 [GenBank] ; rice, AK103463; maize, AY109804; wheat, CAC22583 [GenBank] ; barley, BU993123; citrus, AAM18228 [GenBank] ; grape, EE077235; potato, Q9AWA5; tomato, BE435569; soybean, AW133227/BI945390; Medicago, CAE84830 [GenBank] . AtGWD2 clade: AtGWD2, AAO42141 [GenBank] . AtGWD3 clade: AtGWD3, AY747068; maize, AY108492; rice, AK072331; Medicago, BM779840. The alignment and the phylogenetic tree were created using the MEGA3 software available at www.megasoftware.net (Kumar et al., 2004).

Glucan-bound phosphate content
Glucose-6-phosphate and glucose-3-phosphate contents were determined by acid hydrolysis of glucan substrates followed by high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) as previously described (Blennow et al., 1998). To minimize interference from incompletely hydrolysed glucans, samples were hydrolysed for 4 h. This minimizes, but does not eliminate, the content of maltose-6-phosphate which co-elutes with glucose-3-phosphate under the conditions used (Ritte et al., 2006). For the determination of C-6 to C-3 phosphorylation ratios, 0.5 ml fractions were collected and the incorporated label was measured by a liquid scintillation counter (1450 Microbeta, Perkin-Elmer).

Expression, purification and substrate specificity of AtGWD2
AtGWD2 was expressed in Saccharomyces cerevisiae as a C-terminal fusion to a V5 epitope and polyhistidine tag (6xHis) and purified by affinity chromatography as previously described by Baunsgaard et al. (2005). The waxy maize amylopectin substrates were generated as described by Baunsgaard et al. (2005). Soluble starch from potato was obtained from Sigma-Aldrich (product number S 2004).

Autocatalytic phosphorylation and dikinase assays
For the determination of autocatalytic phosphorylation (autophosphorylation), a 10 µg sample of purified AtGWD2 was analysed as described by Mikkelsen et al. (2004). Dikinase activity assays were performed essentially as previously described by Mikkelsen et al. (2004). One microgram of purified AtGWD2 was incubated with 10 µM [ß-33P]ATP (150 000 dpm) and 5 mg ml–1 glucan substrate in a final volume of 100 µl (25 mM HEPES/KOH, pH 7.0, 10 mM NH4Cl, 10 mM MgCl2, 0.5 mM DTT, 0.2 mg ml–1 BSA). The reaction was incubated for 1 h at 30 °C and terminated by boiling. The polyglucan was precipitated with 1.8 ml 75% methanol/1% KCl and resuspended in 200 µl of water. This procedure was repeated four times and the final pellet was dissolved in 400 µl of water. Incorporation of labelled phosphate was determined by adding 3 ml scintillation liquid to the mixture and measuring the radioactivity with a liquid scintillation counter (1450 Microbeta, Perkin-Elmer). Initial enzyme kinetic studies using soluble potato starch as a substrate confirmed that the rate of phosphate incorporation was constant over the entire assay period and increased linearly with respect to enzyme concentration.

Expression analysis
For analysis of AtGWD2 expression, a 1207 bp promoter fragment (primers GWDb1: 5’ GAT GCA AAT TGT CTG CAG GGA AT; GWDFL: 5’ GGC AGC TAT TCA TAA AAA AGA GGT AAC A, including an attB1 and attB2 site, respectively) was cloned in front of an enhanced green fluorescent protein (eGFP)-ß-glucoronidase (GUS) fusion in the vector pKGWFS7 (Karimi et al., 2002) using the GATEWAYTM cloning technology (Invitrogen). The construct was transformed into Agrobacterium and introduced into Arabidopsis thaliana ecotype Columbia-0. After an initial screening of transgenic lines in the T1 and T2 generations, five lines were chosen for detailed analysis. GUS activity was determined by harvesting plant parts directly into an X-Gluc solution [1 mg ml–1 5-bromo-4-chloro-3-indolyl ß-D-glucuronide cyclohexylammonium salt (Duchefa Biochemie, The Netherlands), 10 mM titriplex III, 2 mM K3[Fe(CN)6] and 2 mM K4[Fe(CN)6] in a 0.1 M phosphate buffer pH 7.5], vacuum infiltrating for 30 min and incubating at 37 °C for 24 h. Stained material was subjected to a 20–50% ethanol series, fixed in FAA (50% ethanol, 5% formaldehyde, 10% acetic acid) for 30 min and subsequently destained with 70% ethanol before microscopy analysis.

GFP activity was investigated by confocal laser scanning microscopy as previously described by Baunsgaard et al. (2005). Staining for sieve-plates was performed by incubating thin strips of mature Arabidopsis leaves in a solution of analine blue for 30 min, followed by immediate inspection by confocal laser scanning microscopy (TCS SP2; Leica Microsystems, Wetzlar, Germany). A two-photon laser operating at 800 nm was used for excitation and emission was detected in the interval between 450 nm and 510 nm.

Subcellular localization
The entire ORF of AtGWD2 as well as a fragment containing the 158 N-terminal amino acids was fused to enhanced GFP (eGFP) behind the constitutive 35S promoter in the binary vector pK7FWG2 (Karimi et al., 2002) using the GATEWAYTM cloning technology (Invitrogen). The constructs were introduced into Arabidopsis thaliana ecotype Columbia-0. For tobacco transient expression, fragments of AtGWD2 were PCR amplified using uracil-containing primers and cloned into the vector pPS48uYFP using an improved USERTM (uracil-specific excision reagent, New England Biolabs) cloning procedure (Nour-Eldin et al., 2006). The transit peptide of AtGWD1 was fused to AtGWD2 by simultaneous cloning of both fragments. The constructs were transformed into Agrobacterium and transiently expressed by infiltration in Nicotiana benthamiana as previously described by Voinnet et al. (2003). All constructs were analysed by a confocal laser scanning microscope (TCS SP2; Leica Microsystems, Wetzlar, Germany) equipped with a 20x/0.70 or 63x/1.20 PL APO water immersion objective. A 488 nm laser line was used for excitation and emission was detected between 510 nm and 535 nm for GFP fluorescence, 520 nm and 550 nm for YFP fluorescence, and 650 nm and 750 nm for chlorophyll autofluorescence.

In vitro import assays
Constructs containing AtGWD2 alone and AtGWD2 fused to the predicted transit peptide of AtGWD1 were cloned in the vector pGEM-4Z (Promega GmbH, Mannheim, Germany) and transcribed in vitro using SP6 RNA polymerase. Products were translated in vitro in the presence of [3H]leucine using a Rabbit Reticulocyte Lysate system (Promega GmbH, Mannheim, Germany) according to the manufacturer's instructions. Intact chloroplasts were isolated from pea seedlings (Pisum sativum, var. Kelvedon Wonder) and in vitro import assays were carried out as reported by Robinson and Mant (2002). Samples were analysed by SDS-PAGE and autoradiography.

Electron microscopy
Inflorescence segments were cut from Arabidopsis wild-type Columbia-0 and the mutant Atgwd2-2. Fixation, staining, and image acquisition was performed as previously described by Schulz et al. (1998).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The AtGWD2 homologue
A cDNA encoding AtGWD2 was obtained from the RIKEN Arabidopsis full-length (RAFL) cDNA collection (GenBank accession no. BT004118). This clone included the entire 1278 amino acids open reading frame (ORF) plus 5’ and 3’ untranslated regions. It is encoded by a 7.4 kb locus on chromosome 4 divided into 32 exons (At4g24450). The ORF includes the conserved phosphohistidine and nucleotide binding domains in the C-terminal end and the tandem repeated starch binding domains in the N-terminal end, similar to those present in AtGWD1 and potato GWD (Yu et al., 2001; Mikkelsen et al., 2006). The starch binding domain from potato GWD has been shown to bind to granular starch in vitro and this type of domain appears to be specific for enzymes involved in plastidial starch metabolism (Mikkelsen et al., 2006). Alignment of the conserved tryptophanes in the starch binding domains (Mikkelsen et al., 2006) showed that AtGWD2 lacks 78 amino acids in the N-terminal, when compared to AtGWD1. This truncation covers the entire predicted transit peptide of AtGWD1. Prediction of putative subcellular location by Predotar (http://urgi.versailles.inra.fr/predotar; Small et al., 2004) and TargetP (www.cbs.dtu.dk/services/TargetP; Emanuelsson et al., 2000) did not indicate the presence of a transit peptide. Together these observations suggest that AtGWD2 is a non-plastidic paralogue of AtGWD1.

Available sequence databases were analysed in an effort to identify putative orthologues of AtGWD2 in other plants. Numerous homologous sequences were identified among ESTs and genomic survey sequences from Brassica napus, Brassica rapa, and Brassica oleracea, although none of these sequences (either singly or assembled) covered the entire nucleotide binding domain used in previous phylogenetic studies of GWDs (Baunsgaard et al., 2005). The sequence identity to AtGWD2 was generally high, usually around 70–90% at both the nucleotide and protein levels depending on the sequence region. An EST clone from the bark of Poncirus trifoliata was identified in GenBank (accession nos CV711759 and CV711760). The clone belongs to a unigene cluster assembled from four sequences from Poncirus trifoliata (2), Citrus clementina (1), and Citrus sinensis (1) in the HarvEST project (http://harvest.ucr.edu). The sequence matches the 475 C-terminal amino acids of AtGWD2 and shows 68% identity and 82% similarity at the protein level. Intriguingly, this clone is the only indication of the existence of GWD2 orthologues outside the Brassicaceae family, to which Arabidopsis belongs. The poplar genome contained four GWD homologues, represented as pairs of closely related sequences, but no homologues of AtGWD2. A search of the rice genome revealed two sequences similar to AtGWD1 and AtGWD3/PWD from Arabidopsis. No sequence with significant homology to AtGWD2 was present, indicating that the monocot rice does not contain this isoform.

The phylogenetic study of higher plant GWDs previously reported (Baunsgaard et al., 2005) was expanded by including newly identified sequences from higher plants, the apicomplexan parasites Cryptosporidium parvum and Toxoplasma gondii and sequences from the green algae Chlamydomonas reinhardtii and Ostreococcus tauri. The phylogenetic tree showed two groups of GWDs comprising the orthologues of AtGWD1 and AtGWD3/PWD from higher plants (Fig. 1). The two representatives of GWD2 formed a group closely related to the GWD1 sequences, clearly demonstrating their relationship with the GWD1 group.


Figure 1
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. A phylogenetic tree of the nucleotide binding domain of GWD sequences from selected organisms. The tree was constructed on the basis of available protein sequences or translated genome sequences and expressed sequence tags. The alignment was created and visualized using the MEGA3 software (Kumar et al., 2004). Accession numbers are given in the Materials and methods. The scale indicates the average substitutions per site.

 
Expression and purification of AtGWD2
A fusion protein consisting of AtGWD2 and a C-terminal V5 epitope and polyhistidine tag (6xHis) was heterologously expressed in Saccharomyces cerevisiae and purified to apparent homogeneity using affinity chromatography. The identity of the fusion protein was confirmed by SDS-PAGE and immunoblotting using an anti-V5 antibody. Enzyme activity was verified by autophosphorylation of the purified protein following incubation with [ß-33P]ATP. Autophosphorylation is the first step in the dikinase reaction mechanism. It results in a stable phosphorylated intermediate and the step can be completed in the absence of a glucan substrate (Ritte et al., 2002; Mikkelsen et al., 2004). Separation of the labelled products by SDS-PAGE and visualization by autoradiography revealed that AtGWD2 was significantly labelled by this procedure (Fig. 2).


Figure 2
View larger version (92K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Autophosphorylation of purified AtGWD2. (1) Marker. (2) Purified AtGWD2 incubated with [ß-33P]ATP, separated by SDS-PAGE and stained with Coomassie Brilliant Blue. (3) Autoradiogram of lane 2.

 
Substrate specificity of AtGWD2
The in vitro substrate specificity of purified AtGWD2 was investigated using a series of enzymatically modified substrates previously used to characterize the AtGWD3 enzyme (Baunsgaard et al., 2005). These substrates were based on waxy maize amylopectin, which has a very low natural level of covalently linked phosphate-groups. Three modified substrates were generated: (i) waxy maize amylopectin elongated by phosphorylase a, (ii) waxy maize amylopectin pre-phosphorylated with purified potato GWD, and (iii) elongated and pre-phosphorylated waxy maize amylopectin. Purified AtGWD2 was incubated with [ß-33P]ATP and the maize glucan substrates and the efficiency of glucan phosphorylation was determined by measuring the amount of incorporated label (Table 1). Minimal activity was detected on glycogen (data not shown), the unmodified amylopectin, and the pre-phosphorylated amylopectin. Elongating the amylopectin substrate led to a large increase in specific activity and pre-phosphorylation further increased this activity. Maximum activity was obtained on a soluble starch from potato. Soluble potato starch has previously been used as a substrate for determining starch-phosphorylating enzyme activity in plant extracts (Ritte et al., 2003). The substrate specificity of AtGWD2 thus resembles the results obtained for potato GWD (Ritte et al., 2002; Mikkelsen et al., 2004) and the activity is not dependent on previous phosphorylation, as has been reported for AtGWD3/PWD (Baunsgaard et al., 2005; Kötting et al., 2005).


View this table:
[in this window]
[in a new window]

 
Table 1. Activity of purified AtGWD2 on various glucan substrates

 
The ratio between C-6 and C-3 phosphorylation was determined by acid hydrolysis of labelled soluble starch and separation by high-performance anion-exchange chromatography (HPAEC). Fractions collected from the peaks corresponding to glucose-6-phosphate and glucose-3-phosphate were labelled at a ratio of 86:14. It has recently been determined that phosphorylation of the C-6 and C-3 position is selectively catalysed by the GWD1 and GWD3/PWD isoforms, respectively (Ritte et al., 2006). The obtained ratio shows that AtGWD2 primarily phosphorylates the C-6 position. Since maltose-6-phosphate, which is formed as a result of incomplete hydrolysis, has been shown to co-elute with glucose-3-phosphate under the conditions used, it is likely that AtGWD2 exclusively phosphorylates the C-6 position as has been observed for both AtGWD1 and potato GWD (Ritte et al., 2006).

Characterization of AtGWD2 mutants
Three T-DNA insertion mutants in the AtGWD2 gene were isolated from two different ecotype backgrounds. An insertion in the ecotype Wassilewskija was obtained by screening a T-DNA transformed Arabidopsis population from the University of Wisconsin Arabidopsis knockout facility (Krysan et al., 1999). The insertion was mapped to exon 9 and the mutant line called gwd2-1. Two mutants in the Columbia (Col-0) background were identified from flanking sequence tags (FSTs). A mutant with the insert mapped to exon 15 was obtained from the GABI-Kat collection (Rosso et al., 2003) and a mutant with an insertion in exon 23 was obtained from the SALK collection (Alonso et al., 2003). These lines were named Atgwd2-2 and Atgwd2-3, respectively. Homozygous lines were selected by PCR screening of genomic DNA and insertions were verified by PCR using primers matching the borders of the T-DNA insert and the AtGWD2 gene. Reverse transcription (RT)-PCR analysis confirmed that none of the mutants produced a functional AtGWD2 transcript. Plants were grown for at least three generations with no visible phenotype from an observation of growth and development when compared with the wild type. Iodine staining of leaves after the dark period did not reveal any accumulation of starch in the mutants. Enzymatic determination of starch and sugar content (glucose, fructose, and sucrose) in leaves after both the light and dark periods did not reveal any differences when compared with the wild type. In contrast to the results obtained with null mutants of AtGWD1 and AtGWD3/PWD (Yu et al., 2001; Baunsgaard et al., 2005; Kötting et al., 2005), null mutants of AtGWD2 do not appear to be affected in degradation of transient starch under standard growth conditions.

AtGWD2 is expressed in the companion cells of the phloem in an age-dependent manner
Studies on the frequency and distribution of ESTs in tissues of Arabidopsis suggested that AtGWD2 is expressed late in the plant life cycle. Two ESTs were isolated from a leaf senescence library (GenBank accession nos CD529796 and CD529114) and a further two were isolated from flower or silique libraries (GenBank accession nos AV564246 and AU227674). In order to investigate the precise expression pattern of AtGWD2, a 1207 bp promoter fragment, corresponding to the entire genomic region from the end of the upstream ORF (At4g24440) to the start codon of AtGWD2, was cloned in front of an enhanced green fluorescent protein-ß-glucoronidase fusion (GFP-GUS). This promoter region included the 5’ untranslated region, containing exon 1 and part of exon 2. The promoter construct was transformed into Arabidopsis wild type and the T3 and T4 generations were analysed by X-Gluc staining for GUS activity. A highly restricted pattern of expression was observed with strong expression in the vascular tissues of leaves, stem, roots, flowers, and siliques (Fig. 3). This vascular expression pattern was highly age-dependent in all tissues, appearing just before the onset of senescence. The first signs of GUS activity in developing Arabidopsis plants were seen in the cotyledons of approximately 3-week-old plants (grown in 8 h light) immediately prior to the first visible signs of senescence (i.e. yellowing). The appearance of GUS activity during development of the rosette followed this pattern, with activity appearing in the lower leaf-pairs before visible senescence symptoms were observed (Fig. 3B). At the time of emergence of the inflorescence, GUS activity could be detected in the majority of mature leaves. This age-related pattern was repeated in developing flowers and siliques (Fig. 3C–F). Activity in flowers was observed in the sepals and stamens after flower opening (Fig. 3D) and strong activity was detected in the floral organ abscission zone (Fig. 3F). The emerging siliques retained the staining in the abscission zone during development. During silique maturation, activity appeared in the dehiscence zone between the silique walls (Fig. 3E) and in the vascular tissues of the silique walls. Cross-sections of mature leaves localized the GUS signal to the abaxial (lower) side of the primary vascular bundle, coincident with the location of the phloem (data not shown). The tissue specificity and developmental pattern of AtGWD2 promoter activity were compared to the microarray data collected in Genevestigator (www.genevestigator.ethz.ch; Zimmermann et al., 2004). The analysis revealed high levels of AtGWD2 expression in senescent leaves, cauline leaves, siliques, and mature flower parts, in good agreement with the observed GUS activity pattern.


Figure 3
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. GUS staining of Arabidopsis plants expressing a GFP-GUS fusion from the AtGWD2 promoter. (A) A mature rosette leaf showing the vascular expression pattern. (B) A 7-week-old Arabidopsis plant showing expression in the lower leaf pairs. (C) Immature flower bud. (D) Mature flower with emerging silique. GUS activity can be observed in the sepals. (E) Maturing silique showing activity in the dehiscence zone between the silique walls. (F) Activity in the floral organ abscission zone after senescence of the flower and formation of the silique.

 
The GFP-GUS fusion expressed from the AtGWD2 promoter was used to locate the specific cell types in which the AtGWD2 promoter was active. Mature leaves of bolting plants were investigated by confocal laser scanning microscopy (CLSM). GFP fluorescence was observed in long narrow cells in the vascular bundles (Fig. 4A). These cells contained both vacuoles and chloroplasts (Fig. 4B). The presence of chloroplasts indicated that these cells were either phloem parenchyma cells or companion cells. To verify their identity, phloem sieve-plates were stained with aniline blue and their location was investigated by CLSM. Sieve-plates were observed adjacent to the GFP-labelled cells in optical cross-sections and were close to the junction between two labelled cells (Fig. 4B, inset). This confirmed the identity of the GFP-labelled cells as phloem companion cells.


Figure 4
View larger version (40K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. Localization of the GFP-GUS fusion expressed from the AtGWD2 promoter. (A) GFP fluorescence (green) in long narrow cells of a vascular bundle. Scale bar 40 µm. (B) Closer view of the fluorescent cells, showing chloroplasts (red) and putative vacuoles (dark ‘holes’). (B, inset) Aniline blue staining of a sieve-plate (light blue) in an adjacent sieve element. Scale bar 10 µm.

 
AtGWD2 is not targeted to the chloroplast
As mentioned above, analysis of putative transit peptide sequences in AtGWD2 indicated that the enzyme is an extra-plastidial isoform of GWD. To determine the subcellular localization of AtGWD2, two fusions to GFP were constructed. The first construct contained the full-length AtGWD2 protein, while the second construct included the 158 N-terminal amino acids. Expression of the fusion proteins was driven by the 35S promoter. The full-length fusion was analysed by transient expression in onion epidermis and stable transformation of Arabidopsis. None of these approaches gave any visible GFP signal by either conventional fluorescence microscopy or CLSM. However, the AtGWD2 (aa1–158)-GFP fusion protein gave rise to clear fluorescence in several transgenic Arabidopsis lines when viewed with CLSM. The fluorescence was primarily restricted to the epidermal cell layer and the GFP signal was present in the nucleus and in a narrow band along the cell wall (Fig. 5A). This pattern coincides with that of free GFP (Haseloff et al., 1997) and suggests a cytoplasmic localization of the fusion protein. Analysis of guard cells showed clear GFP activity outside the chloroplasts (Fig. 5B), supporting the results of the transit peptide predictions.


Figure 5
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. Localization of fusion proteins between AtGWD2 and GFP/YFP. (A) Arabidopsis expressing the AtGWD2 (aa1–158)-GFP fusion in epidermal cells. GFP fluorescence (green) can be observed along the cell walls and in the nuclei. (B) An Arabidopsis guard cell pair. The fusion protein does not co-localize with the chloroplasts (red). (C, D) Tobacco mesophyll cells transiently expressing the AtGWD2 (aa1–158)-YFP fusion with (C) or without (D) the AtGWD1 transit peptide. Scale bars: (A) 50 µm; (B, C, D) 10 µm. (E) Western blot of the fusion proteins expressed in tobacco using a GFP antibody. Expression controls with free GFP (1) and a GFP-GUS fusion (2) driven by the 35S promoter. C-terminal YFP fusion proteins containing 61 amino acids (3) or 158 amino acids (4) of the AtGWD2 N-terminal end.

 
As a second approach, full-length AtGWD2 and a series of three C-terminally truncated versions (carrying N-terminal fragments including 610, 158, and 61 amino acids, respectively) were fused to YFP and examined using a tobacco transient expression system. The two fusions containing the full-length AtGWD2 and 610 N-terminal amino acids did not give rise to any visible fluorescence, similar to what was observed for the full-length fusion in Arabidopsis. The 158 and 61 amino acids fusions showed identical localization patterns with clear fluorescence in both epidermal and mesophyll cells. In epidermal cells the YFP signal was similar to the GFP signal observed in Arabidopsis, with fluorescence along the cell wall and in the nucleus (data not shown). In mesophyll cells the signal was clearly located outside the chloroplasts (Fig. 5D). N-terminal addition of the 78 amino acids predicted transit peptide from AtGWD1 targeted both fusions to the chloroplasts in tobacco cells. The chloroplast targeted fusion protein carrying the 158 N-terminal amino acids of AtGWD2 was located at the surface of rounded structures, presumed to be starch granules, inside the chloroplasts (Fig. 5C). This fusion protein contains one of the N-terminal starch binding domains of AtGWD2 and the binding indicates that this domain is functional in vivo. To verify that the cytoplasmic localization was not simply due to the loss of N-terminal targeting information caused by proteolytic breakdown of the fusion protein, western blotting was performed using a GFP-antibody. Both fusions gave a strong band of the correct size, with only a minor breakdown product in the AtGWD2 (aa1–158)-GFP fusion (Fig. 5E).

To corroborate the results of the AtGWD2-GFP/YFP fusion experiments, chloroplast import studies were performed to examine the localization of AtGWD2. Full-length AtGWD2 was transcribed and translated in the presence of radiolabelled [3H]leucine in vitro and incubated with intact chloroplasts (C) isolated from pea seedlings. After incubation, the chloroplasts were treated with thermolysine (C+) which degrades the non-imported precursor proteins leaving the chloroplast structure intact. Chloroplasts were then fractionated into a stromal fraction (S) and a thylakoid membrane fraction (T). Fractions were loaded onto a SDS-PAGE gel and subjected to autoradiography. The resulting autoradiogram showed that the AtGWD2 protein (Fig. 6; GWD2 panel, lane C) was completely degraded by thermolysine treatment after incubation with intact chloroplasts (Fig. 6; GWD2 panel, lane C+) suggesting that AtGWD2 does not contain an in vitro functional transit peptide allowing import into the chloroplast. In contrast to these results, a control construct with the AtGWD1 transit peptide fused to the N-terminus of AtGWD2 was in vitro imported and gave a labelled double band around the correct size (~150 kDa) in the intact chloroplast preparations (Fig. 6; TP-GWD2 panel, lanes C and C+) and in the stroma (Fig. 6; TP-GWD2 panel, lane S). The double band may be due to a plastidic proteolytic activity acting on the imported translation product or alternatively, a post-translational modification of the protein. Compared with the unmodified AtGWD2, the fusion products were protected from thermolysine digestion after incubation with intact chloroplasts (Fig. 6; TP-GWD2 panel, lane C+) indicating that TP-AtGWD2 was translocated into the chloroplast. The nuclear-encoded LHCB1 protein (light-harvesting chlorophyll b binding protein), which is targeted to the thylakoid membranes, was used as a control of the chloroplast import assay (Fig. 6; LHCB1 panel, lanes T and T+).


Figure 6
View larger version (60K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. Chloroplast import assays on native AtGWD2 and AtGWD2 fused to the transit peptide of AtGWD1 (TP-GWD2). Constructs were transcribed and translated in vitro in the presence of [3H]leucine and subsequently incubated with isolated intact pea chloroplasts. The LHCB1 protein (light-harvesting chlorophyll b binding protein, thylakoid membrane protein) was used as an import control. The lanes correspond to in vitro-translated precursor (Tr), thermolysine-treated precursor (Tr+), total, washed chloroplasts immediately after import (C), thermolysine-treated chloroplasts (C+), stromal extract (S), isolated thylakoids (T), trypsin-treated thylakoids (T+).

 
Sieve element starch in Arabidopsis
The specific expression of AtGWD2 in the companion cells of the phloem prompted an investigation of the presence of starch in sieve element plastids of Arabidopsis. Plastids are a universal feature of sieve elements and are characterized by various types of inclusions, including starch granules (van Bel et al., 2002). The function of the sieve element plastids in phloem translocation is not known, but it has been suggested that they might serve as storage units, provided that the enzymes needed for biosynthesis and degradation of the included macromolecules are present (van Bel et al., 2002). Sieve element starch has previously been observed in the root protophloem of Arabidopsis (Wu and Zheng, 2003).

Electron microscopy (EM) was used to investigate the appearance of sieve element starch granules in Arabidopsis wild-type Columbia-0 and the mutant Atgwd2-2. Sections of the inflorescence stem showed sieve element plastids containing round starch granules with a diameter of approximately 200–300 nm (Fig. 7). Most plastids were surrounded by a seemingly intact double membrane. No differences were observed between wild type and mutant, with respect to size and morphology of starch granules (data not shown). However, the EM micrographs were not generally suitable for total quantification of sieve element starch.


Figure 7
View larger version (127K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7. Electron microscopy image of a sieve element plastid from the inflorescence of Arabidopsis. M, mitochondrion. P, plastid. Arrows indicate starch granules. Scale bar 500 nm.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
A search of available sequence data from higher plants revealed homologues of AtGWD2 in three Brassica species and in a collection of Citrus sequences. This restricted pattern of appearance is intriguing as homologues of both AtGWD1 and AtGWD3/PWD can be readily identified in most higher plants (Baunsgaard et al., 2005). The apparent lack of homologues of AtGWD2 among the abundance of ESTs and genomic sequences from monocot species, suggests that AtGWD2 evolved after the divergence of the monocots and dicots. The phylogenetic tree shows that the GWD2 sequences form a group separate from the GWD1 orthologues of both monocots and dicots. This suggests a duplication of GWD before the divergence of monocots and dicots, although this does not take into account differences in evolutionary rate caused by varying selective pressure. Another, perhaps more unlikely, explanation is that the monocots have lost the gene corresponding to AtGWD2 during the course of evolution. The continuous release of new sequence data from many plants species is likely to shed more light on this question in the future.

In vitro analysis of purified enzyme demonstrated that AtGWD2 was active on elongated glucan chains and did not require previous phosphorylation of the substrate. This substrate preference resembles that of potato GWD (Ritte et al., 2002; Mikkelsen et al., 2004). Furthermore, AtGWD2 primarily phosphorylated the C-6 position of the glycosyl residues. These results, along with the data that indicate that AtGWD2 is an extra-plastidial enzyme, support the idea that AtGWD2 is an active cytosolic isoform of AtGWD1. Analysis of Arabidopsis mutants demonstrated that the enzyme is not required for the degradation of transient starch, suggesting that AtGWD2 is active on an, as yet unidentified, glucan substrate.

AtGWD2 promoter activity was restricted to the companion cells of the phloem and was highly age-dependent. The expression followed the development of senescence in leaves, flowers, and siliques and was usually observed just before the appearance of visible senescence symptoms. The link with senescence suggests that the AtGWD2 enzyme might be involved in the breakdown of starch or starch-like structures during the withdrawal of nutrients from the senescing leaf. The specific expression in companion cells could implicate AtGWD2 in either the transport of carbohydrates through the phloem or in the degradation of phloem-specific structures. Presently, there is no specific evidence for the existence of large {alpha}-linked polysaccharides, other than starch, in phloem tissues. It is possible that the cytosolic soluble heteroglycan that has been identified in Arabidopsis (Fettke et al., 2005) is also present in companion cells and phloem parenchyma cells, but there is no evidence to suggest that {alpha}-glucan, water dikinase activity would be required for its metabolism.

The observation that the major form of ß-amylase in Arabidopsis is localized in the phloem sieve elements lead to the idea that ß-amylase activity might play a role in preventing build-up of polymerized polysaccharides that would impede flow through the sieve-plates (Wang et al., 1995). Given the location of AtGWD2 and the RAM1 ß-amylase in Arabidopsis it is tempting to speculate that they might function in the metabolism of larger polysaccharides in the phloem sieve elements, either as a way of preventing their build-up or as a way of regulating the transport and availability of sugars. Proteins present in sieve elements are synthesized in companion cells and transferred via plasmodesmata. The size of the AtGWD2 protein would most likely prevent non-specific (passive) trafficking between these two cell types (Lough and Lucas, 2006), but experiments with Cucurbita maxima have shown that phloem exudate contains proteins ranging in molecular weight from 10–200 kDa (Balachandran et al., 1997). How this specific (selective) trafficking of proteins destined for the sieve element is accomplished is unknown. Many phloem proteins can modify the size exclusion limit of mesophyll plasmodesmata enabling transport of larger proteins and compounds (Balachandran et al., 1997). There is also good evidence to suggest that selective trafficking can be mediated by chaperones or shuttle-proteins that target the selected proteins to the plasmodesmal channel (Lee et al., 2003). Furthermore, transport of the encoding mRNA to the sieve element has been described for a number of proteins, among them the sucrose transporter SUT1 from potato (Lough and Lucas, 2006). The SUT1 protein is present in sieve elements, but transcription occurs in companion cells and the mRNA is found in both cell types (Kühn et al., 1997). Whether the transported mRNA gives rise to any protein in the sieve element is still unresolved. Although these data show that the AtGWD2 promoter is active in companion cells, a sensitive anti-AtGWD2 antibody would be required to analyse whether or not the protein itself resides in sieve elements where RAM1 has been localized (Wang et al., 1995). The lack of any clear phenotype in null mutants of AtGWD2 and RAM1 (Laby et al., 2001) suggests that their contribution to sugar metabolism under normal circumstances is minor. The expression of RAM1 is heavily up-regulated in response to sucrose, indicating that sucrose affects the amount of RAM1 substrate (Mita et al., 1995). Induction of AtGWD2 promoter activity has been observed in seedlings germinated on sucrose-containing media, suggesting a similar response of AtGWD2 (data not shown).

Both GWD and isoamylase sequences have been proposed to be a prerequisite for the appearance of semi-crystalline starch-like polymers (Coppin et al., 2005), since these enzymes distinguish plant starch metabolism from the glycogen metabolism of animals, fungi, and bacteria. The presence of GWDs appears to be a ubiquitous feature of all organisms accumulating semi-crystalline storage polysaccharides. Homologues of GWD can be found in plants, the green and red algae, and in apicomplexan parasites (Mikkelsen et al., 2004; Ral et al., 2004; Coppin et al., 2005). If the existence of GWDs is a prerequisite for the successful metabolism of semi-crystalline polysaccharides, it is tempting to assume that AtGWD2 acts on such a substrate in vivo. The starch granules in the plastids of Arabidopsis phloem sieve elements present an appealing target for the action of AtGWD2. It has been determined that sieve element starch in bean hypocotyls contains a high proportion of {alpha}-1,6 linkages and is structurally distinct from ordinary starch (Palevitz and Newcomb, 1970). The sieve element plastid membrane degrades during development of root protophloem in Arabidopsis leaving starch granules free in the lumen (Wu and Zheng, 2003). Older sieve elements in bean also contain starch granules free in the lumen, but the authors could not conclude whether they were released naturally during ageing or the result of cutting and fixing the tissue (Palevitz and Newcomb, 1970). Pressure release in fava bean sieve elements leads to immediate rupture of the plastids. It was speculated that the liberated contents of the sieve element plastids, including the starch granules, might aid in plugging the sieve pore in response to wounding (Knoblauch and van Bel, 1998). The apparent lack of a chloroplast transit peptide and the late expression in the plant life cycle could suggest that AtGWD2 acts on starch granules released from degrading plastids in ageing plants. The structure of sieve element plastids in the inflorescence stem of Arabidopsis was investigated. Although the plastids were still surrounded by an apparently intact double membrane, the nature and integrity of this membrane is unknown. Starch granules were present in both wild type and an Atgwd2 mutant, but because the plane of sectioning in EM does not necessarily pass through the centre of the granule, quantification of the results can be difficult. Detecting any differences in the number or size distribution of sieve element starch granules in wild type and mutant would require a more comprehensive quantitative survey. It is worth noting that many plant species, particularly among the monocots, do not contain starch in the sieve element plastids (Behnke, 2003).


    Acknowledgements
 
We thank Lis B Møller, Per Lassen Nielsen, and Lise Girsel for technical assistance and René Mikkelsen for valuable advice and discussions. RIKEN Genomic Sciences Center is gratefully acknowledged for providing the AtGWD2 full-length cDNA clone. This project was supported by a grant from The Danish Research Council for Technology and Production Sciences (Grant no. 23-04-0239).


    Footnotes
 
{dagger} Present address: Aresa A/S, Symbion Science Park, 3 Fruebjergvej, 2100 Copenhagen Ø, Denmark. Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Alonso JM, Stepanova AN, Leisse TJ, et al. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science (2003) 301:653–657.[Abstract/Free Full Text]

Balachandran S, Xiang Y, Schobert C, Thompsom GA, Lucas WJ. Phloem sap proteins from Cucurbita maxima and Ricinus communis have the capacity to traffic cell to cell through plasmodesmata. Proceedings of the National Academy of Sciences, USA (1997) 94:14150–14155.[Abstract/Free Full Text]

Baunsgaard L, Lütken H, Mikkelsen R, Glaring MA, Pham TT, Blennow A. A novel isoform of glucan, water dikinase phosphorylates pre-phosphorylated {alpha}-glucans and is involved in starch degradation in Arabidopsis. The Plant Journal (2005) 41:595–605.[CrossRef][Web of Science][Medline]

Behnke HD. Sieve-element plastids and evolution of monocotyledons, with emphasis on Melanthiaceae sensu lato and Aristolochiaceae-Asaroideae, a putative dicotyledon sister group. Botanical Reviews (2003) 68:524–544.[CrossRef]

Blennow A, Bay-Smidt AM, Olsen CE, Møller BL. Analysis of starch bound glucose 3-phosphate and glucose 6-phosphate using controlled acid treatment combined with high-performance anion-exchange chromatography. Journal of Chromatography A (1998) 829:385–391.[CrossRef][Web of Science]

Blennow A, Nielsen TH, Baunsgaard L, Mikkelsen R, Engelsen SB. Starch phosphorylation: a new front line in starch research. Trends in Plant Science (2002) 7:445–450.[CrossRef][Web of Science][Medline]

Chia T, Thorneycroft D, Chapple A, Messerli G, Chen J, Zeeman SC, Smith SM, Smith AM. A cytosolic glucosyltransferase is required for conversion of starch to sucrose in Arabidopsis leaves at night. The Plant Journal (2004) 37:853–863.[CrossRef][Web of Science][Medline]

Coppin A, Varré JS, Lienard L, Dauvillée D, Guérardel Y, Soyer-Gobillard MO, Buléon A, Ball S, Tomavo S. Evolution of plant-like crystalline storage polysaccharides in the protozoan parasite Toxoplasma gondii argues for a red alga ancestry. Journal of Molecular Evolution (2005) 60:257–267.[CrossRef][Web of Science][Medline]

Delatte T, Umhang M, Trevisan M, Eicke S, Thorneycroft D, Smith SM, Zeeman SC. Evidence for distinct mechanisms of starch granule breakdown in plants. Journal of Biological Chemistry (2006) 281:12050–12059.[Abstract/Free Full Text]

Edner C, Li J, Albrecht T, et al. Glucan, water dikinase activity stimulates breakdown of starch granules by plastidial ß-amylases. Plant Physiology (2007) 145:17–28.[Abstract/Free Full Text]

Emanuelsson O, Nielsen H, Brunak S, von Heijne G. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. Journal of Molecular Biology (2000) 300:1005–1016.[CrossRef][Web of Science][Medline]

Fettke J, Chia T, Eckermann N, Smith A, Steup M. A transglucosidase necessary for starch degradation and maltose metabolism in leaves at night acts on cytosolic heteroglycans (SHG). The Plant Journal (2006) 46:668–684.[CrossRef][Web of Science][Medline]

Fettke J, Eckermann N, Tiessen A, Geigenberger P, Steup M. Identification, subcellular localization and biochemical characterization of water-soluble heteroglycans (SHG) in leaves of Arabidopsis thaliana L.: distinct SHG reside in the cytosol and in the apoplast. The Plant Journal (2005) 43:568–585.[CrossRef][Web of Science][Medline]

Haseloff J, Siemering KR, Prasher DC, Hodge S. Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proceedings of the National Academy of Sciences, USA (1997) 94:2122–2127.[Abstract/Free Full Text]

Kaplan F, Guy CL. RNA interference of Arabidopsis beta-amylase8 prevents maltose accumulation upon cold shock and increases sensitivity of PSII photochemical efficiency to freezing stress. The Plant Journal (2005) 44:730–743.[Web of Science][Medline]

Karimi M, Inzé D, Depicker A. GATEWAYTM vectors for Agrobacterium-mediated plant transformation. Trends in Plant Science (2002) 7:193–195.[CrossRef][Web of Science][Medline]

Knoblauch M, van Bel AJE. Sieve tubes in action. The Plant Cell (1998) 10:35–50.[Abstract/Free Full Text]

Kötting O, Pusch K, Tiessen A, Geigenberger P, Steup M, Ritte G. Identification of a novel enzyme required for starch metabolism in Arabidopsis leaves. The phosphoglucan, water dikinase. Plant Physiology (2005) 137:242–252.[Abstract/Free Full Text]

Kühn C, Franceschi VR, Schulz A, Lemoine R, Frommer WB. Macromolecular trafficking indicated by localization and turnover of sucrose transporters in enucleate sieve elements. Science (1997) 275:1298–1300.[Abstract/Free Full Text]

Kumar S, Tamura K, Nei M. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings in Bioinformatics (2004) 5:150–163.[Abstract/Free Full Text]

Krysan PJ, Young JK, Sussman MR. T-DNA as an insertional mutagen in Arabidopsis. The Plant Cell (1999) 11:2283–2290.[Free Full Text]

Laby RJ, Kim D, Gibson SI. The ram1 mutant of Arabidopsis exhibits severely decreased ß-amylase activity. Plant Physiology (2001) 127:1798–1807.[Abstract/Free Full Text]

Lee JY, Yoo BC, Rojas MR, Gomez-Ospina N, Staehelin LA, Lucas WJ. Selective trafficking of non-cell-autonomous proteins mediated by NtNCAPP1. Science (2003) 299:392–396.[Abstract/Free Full Text]

Lloyd JR, Kossman J, Ritte G. Leaf starch degradation comes out of the shadows. Trends in Plant Science (2005) 10:130–137.[Web of Science][Medline]

Lorberth R, Ritte G, Willmitzer L, Kossman J. Inhibition of a starch-granule-bound protein leads to modified starch and repression of cold sweetening. Nature Biotechnology (1998) 16:473–477.[CrossRef][Web of Science][Medline]

Lough TJ, Lucas WJ. Integrative plant biology: role of phloem long-distance macromolecular trafficking. Annual Review of Plant Biology (2006) 57:203–232.[CrossRef][Medline]

Lu Y, Sharkey TD. The role of amylomaltase in maltose metabolism in the cytosol of photosynthetic cells. Planta (2004) 218:466–473.[CrossRef][Web of Science][Medline]

Mikkelsen R, Baunsgaard L, Blennow A. Functional characterization of {alpha}-glucan, water dikinase, the starch phosphorylating enzyme. Biochemical Journal (2004) 377:525–532.[CrossRef][Web of Science][Medline]

Mikkelsen R, Suszkiewicz K, Blennow A. A novel type carbohydrate-binding module identified in {alpha}-glucan, water dikinase is specific for regulated plastidial starch metabolism. Biochemistry (2006) 45:4674–4682.[CrossRef][Medline]

Mita S, Suzuki-Fujii K, Nakamura K. Sugar-inducible expression of a gene for ß-amylase in Arabidopsis thaliana. Plant Physiology (1995) 107:895–904.[Abstract]

Nielsen TH, Wischmann B, Enevoldsen K, Møller BL. Starch phosphorylation in potato tubers proceeds concurrently with de novo biosynthesis of starch. Plant Physiology (1994) 105:111–117.[Abstract]

Niittylä T, Messerli G, Trevisan M, Chen J, Smith AM, Zeeman SC. A previously unknown maltose transporter essential for starch degradation in leaves. Science (2004) 303:87–89.[Abstract/Free Full Text]

Nour-Eldin HH, Hansen BG, Nørholm MHH, Jensen JK, Halkier BA. Advancing uracil-excision based cloning towards an ideal technique for cloning PCR fragments. Nucleic Acids Research (2006) 34:e122.[Abstract/Free Full Text]

Palevitz BA, Newcomb EH. A study of sieve element starch using sequential enzymatic digestion and electron microscopy. Journal of Cell Biology (1970) 45:383–398.[Abstract/Free Full Text]

Ral JP, Derelle E, Ferraz C, et al. Starch division and partitioning. A mechanism for granule propagation and maintenance in the picophytoplanktonic green alga Ostreococcus tauri. Plant Physiology (2004) 136:1–8.

Ritte G, Heydenreich M, Mahlow S, Haebel S, Kötting O, Steup M. Phosphorylation of C6- and C3-positions of glycosyl residues in starch is catalysed by distinct dikinases. FEBS Letters (2006) 580:4872–4876.[CrossRef][Web of Science][Medline]

Ritte G, Lloyd JR, Eckermann N, Rottmann A, Kossman J, Steup M. The starch-related R1 protein is an {alpha}-glucan, water dikinase. Proceedings of the National Academy of Sciences, USA (2002) 99:7166–7171.[Abstract/Free Full Text]

Ritte G, Scharf A, Eckermann N, Haebel S, Steup M. Phosphorylation of transitory starch is increased during degradation. Plant Physiology (2004) 135:1–10.[Free Full Text]

Ritte G, Steup M, Kossman J, Lloyd JR. Determination of the starch-phosphorylating enzyme activity in plant extracts. Planta (2003) 216:798–801.[Web of Science][Medline]

Robinson C, Mant A. Import of proteins into isolated chloroplasts and thylakoid membranes. In: Molecular plant biology: a practical approach—Gilmartin PM, Bowler C, eds. (2002) Vol. 2. Oxford, UK: Oxford University Press. 123–146.

Rosso MG, Li Y, Strizhov N, Reiss B, Dekker K, Weisshaar B. An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking sequence tag-based reverse genetics. Plant Molecular Biology (2003) 53:247–259.[CrossRef][Web of Science][Medline]

Small I, Peeters N, Legeai F, Lurin C. Predotar: a tool for rapidly screening proteomes for N-terminal targeting sequences. Proteomics (2004) 4:1581–1590.[CrossRef][Web of Science][Medline]

Scheidig A, Fröhlich A, Schulze S, Lloyd JR, Kossman J. Downregulation of a chloroplast-targeted ß-amylase leads to a starch-excess phenotype in leaves. The Plant Journal (2002) 30:581–591.[CrossRef][Web of Science][Medline]

Schulz A, Kühn C, Riesmeier JW, Frommer WB. Ultrastructural effects in potato leaves due to antisense-inhibition of the sucrose transporter indicate an apoplasmic mode of phloem loading. Planta (1998) 206:533–543.[CrossRef][Web of Science]

Smith AM, Zeeman SC, Smith SM. Starch degradation. Annual Review of Plant Biology (2005) 56:73–98.[CrossRef][Medline]

van Bel AJE, Ehlers K, Knoblauch M. Sieve elements caught in the act. Trends in Plant Science (2002) 7:126–132.[CrossRef][Web of Science][Medline]

Voinnet O, Rivas S, Mestre P, Baulcombe D. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. The Plant Journal (2003) 33:949–956.[CrossRef][Web of Science][Medline]

Wang Q, Monroe J, Sjölund RD. Identification and characterization of a phloem-specific ß-amylase. Plant Physiology (1995) 109:743–750.[Abstract]

Weise SE, Weber APM, Sharkey TD. Maltose is the major form of carbon exported from the chloroplast at night. Planta (2004) 218:474–482.[CrossRef][Web of Science][Medline]

Wu H, Zheng XF. Ultrastructural studies on the sieve elements in root protophloem of Arabidopsis thaliana. Acta Botanica Sinica (2003) 45:322–330.

Yu TS, Kofler H, Häusler RE, et al. The Arabidopsis sex1 mutant is defective in the R1 protein, a general regulator of starch degradation in plants, and not in the chloroplast hexose transporter. The Plant Cell (2001) 13:1907–1918.[Abstract/Free Full Text]

Yu TS, Zeeman SC, Thorneycroft D, et al. {alpha}-amylase is not required for breakdown of transitory starch in Arabidopsis leaves. Journal of Biological Chemistry (2005) 280:9773–9779.[Abstract/Free Full Text]

Zeeman SC, Smith SM, Smith AM. The diurnal metabolism of leaf starch. Biochemical Journal (2007) 401:13–28.[CrossRef][Web of Science][Medline]

Zeeman SC, Thorneycroft D, Schupp N, Chapple A, Weck M, Dunstan H, Haldimann P, Bechtold N, Smith AM, Smith SM. Plastidial {alpha}-glucan phosphorylase is not required for starch degradation in Arabidopsis leaves but has a role in the tolerance of abiotic stress. Plant Physiology (2004) 135:1–10.[Free Full Text]

Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W. GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiology (2004) 136:2621–2632.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Exp BotHome page
J. Fettke, M. Hejazi, J. Smirnova, E. Hochel, M. Stage, and M. Steup
Eukaryotic starch degradation: integration of plastidial and cytosolic pathways
J. Exp. Bot., July 1, 2009; 60(10): 2907 - 2922.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
58/14/3949    most recent
erm249v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Glaring, M. A.
Right arrow Articles by Baunsgaard, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glaring, M. A.
Right arrow Articles by Baunsgaard, L.
Agricola
Right arrow Articles by Glaring, M. A.
Right arrow Articles by Baunsgaard, L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?