Skip Navigation



JXB Advance Access published online on February 5, 2008

Journal of Experimental Botany, doi:10.1093/jxb/erm337
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
59/3/609    most recent
erm337v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Dexter, R. J.
Right arrow Articles by Clark, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dexter, R. J.
Right arrow Articles by Clark, D. G.
Agricola
Right arrow Articles by Dexter, R. J.
Right arrow Articles by Clark, D. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author [2008]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

RESEARCH PAPER

Tissue-specific PhBPBT expression is differentially regulated in response to endogenous ethylene

Richard J. Dexter1 *, Julian C. Verdonk1 *, Beverly A. Underwood1, Kenichi Shibuya1 {dagger}, Eric A. Schmeltz2 and David G. Clark1,{ddagger}

1Department of Environmental Horticulture, University of Florida, Gainesville, FL 32611, USA
2Center of Medical, Agricultural, and Veterinary Entomology, United States Department of Agriculture, Agricultural Research Service, Chemistry Research Unit, Gainesville, FL 32608, USA

{ddagger} To whom correspondence should be addressed. E-mail: geranium{at}ufl.edu

Received 15 October 2007; Revised 30 November 2007 Accepted 3 December 2007


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Ethylene is a gaseous plant hormone involved in many physiological processes including senescence, fruit ripening, and defence. Here the effects of pollination and wound-induced ethylene signals on transcript accumulation of benzoyl CoA:benzyl alcohol/phenylethanol benzoyltransferase (PhBPBT) are shown in Petuniaxhybrida cv. Mitchell ‘Diploid’ (MD). In petunia, PhBPBT is responsible for the biosynthesis of both benzyl benzoate and phenylethyl benzoate from benzyl alcohol and phenylethanol, respectively. RNAi-silenced lines, with reduced PhBPBT transcript, displayed reduced benzyl benzoate emission, and increased benzyl alcohol levels. Detailed expression analysis showed that PhBPBT is regulated by both light and an endogenous circadian rhythm, while it is also differentially regulated in response to ethylene in a tissue-specific manner. Twenty-four hours following pollination of MD flowers, expression of PhBPBT decreases in the corolla, while it increases in the ovary after 48 h. This is caused by ethylene that is emitted from the flower coinciding with fertilization as this is not observed in transgenic ethylene-insensitive plants (CaMV35S::etr1-1; 44568). Ethylene is also emitted from vegetative tissue of petunia following mechanical wounding, resulting in an increase in PhBPBT expression in the leaves where expression is normally below detection levels. Indicative of this pattern of expression, we hypothesize that PhBPBT and subsequent benzyl benzoate production is involved in defence-related processes in the corolla prior to pollination, in the ovary immediately following fertilization, and in vegetative tissue in response to wounding.

Key words: Benzenoids, benzyl benzoate, ethylene, floral volatiles, Petunia hybrida, wounding


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Floral scent is composed of a wide variety of volatile organic compounds emitted at ratios that are unique to individual species. They can be divided into four major classes depending on their structure: fatty-acid derivatives, benzenoids and phenylpropanoids, terpenoids, and nitrogen-containing or sulphur-containing compounds (Knudsen et al., 1993; Schuurink et al., 2006). Petuniaxhybrida cv. ‘Mitchell Diploid’ (MD) has become an excellent model system for the study of floral volatile synthesis because of a well-established transformation protocol (Jorgensen et al., 1996), short life cycle, strong floral aroma, the availability of ethylene-insensitive transgenic plants (35S::etr1-1) (Wilkinson et al., 1997), and a collection of more than 10 000 ESTs made from randomly sequenced flower cDNA libraries (Underwood, 2003). MD floral aroma is primarily composed of 13 benzenoid/phenylpropanoid compounds. Using GC–MS analysis these compounds were identified as benzaldehyde, benzyl alcohol, phenylacetaldehyde, benzyl acetate, methyl benzoate, 2-phenylethanol, methyl salicylate, 2-phenylethyl acetate, vanillin, eugenol, isoeugenol, benzyl benzoate, and phenylethyl benzoate, with methyl benzoate being the most abundant volatile in the group (Negre et al., 2003; Verdonk et al., 2003, 2005; Underwood et al., 2005; Verdonk, 2006). Emission of these volatiles is circadian with highest emission levels at night (20.00 h to 02.00 h), while the petal limb is the tissue primarily responsible for their emission (Kolosova et al., 2001; Verdonk et al., 2003).

The phytohormone ethylene is a volatile molecule necessary for co-ordinating a wide range of physiological processes throughout the plant, including wound responses, herbivore attack, and floral senescence (Abeles et al., 1992; Bleecker and Kende, 2000; von Dahl and Baldwin, 2007). In MD flowers, pollination-induced ethylene is synthesized sequentially throughout the flower, ultimately resulting in corolla senescence (Tang and Woodson, 1996; Wilkinson et al., 1997; Holden et al., 2003; Jones et al., 2003). Exposure to both exogenous and pollination-induced ethylene also results in a rapid decrease in emission of all petunia floral volatiles (Underwood et al., 2005). This is likely to be caused by a decrease in transcript levels of the biosynthetic genes that are responsible for their biosynthesis as has been shown for BENZOIC ACID/SALICYLIC ACID CARBOXYL METHYLTRANSFERASE1 and 2 (PhBSMT1 and 2) which are responsible for the synthesis of methyl benzoate (Negre et al., 2003; Underwood et al., 2005).

BENZOYLCOA:BENZYL ALCOHOL/PHENYLETHANOL BENZOYLTRANSFERASE (PhBPBT) catalyses the conversion of benzoyl-CoA and benzyl alcohol to benzyl benzoate and also of benzoyl-CoA and 2-phenylethanol to phenylethyl benzoate (Boatright et al., 2004). A flower-specific RNAi approach showed that when the transcription of PhBPBT is lowered, the direct products benzyl benzoate and phenylethyl benzoate are almost completely absent, while levels of benzyl alcohol and benzaldehyde have increased (Orlova et al., 2006). Benzyl benzoate is a volatile produced by several plant species including Clarkia breweri (Raguso and Pichersky, 1995), Gymnadenia conopsea (Huber et al., 2005), Petunia axillaris (Hoballah et al., 2005), Dianthus caryophyllus (Schade et al., 2001), and Petunia x hybrida (Verdonk et al., 2003; Boatright et al., 2004; Underwood et al., 2005). Past in vitro experiments have indicated that benzyl benzoate could play a role in pollinator attraction (Shields and Hildebrand, 2000; Hoballah et al., 2005; Huber et al., 2005; Omura and Honda, 2005) or plant defence (miticide) (Dimri and Sharma, 2004; Harju et al., 2004), two common physiological roles attributed to floral volatiles.

To date, research involving PhBPBT has focused predominately on its role in biochemistry and floral volatile biosynthesis in petunia, but a role in vegetative tissue has not been shown. Following mechanical wounding of leaf tissue, transcript levels of CbBEBT accumulate rapidly 4–6 h after wounding (D'Auria et al., 2002). Additionally, HRS201, encoded by a gene rapidly induced following Pseudomonas solanacearum infection in tobacco leaves, has been shown to catalyse the conversion of benzyl alcohol and benzoyl-CoA to benzyl benzoate in vitro (Czernic et al., 1996). The primary goal of this study was to determine the effects of ethylene on PhBPBT transcript levels in the corolla following pollination, and in the leaves following mechanical wounding. Here it is shown that PhBPBT is a single copy gene with multiple forms of regulation. Ethylene differentially regulates PhBPBT transcript levels in corolla, ovary, and leaf tissue of MD. Additionally, an increase in PhBPBT transcript in the leaves resulted in an ethylene-dependent increase in internal benzyl benzoate pools following repeated wounding.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Plant material
Petuniaxhybrida cv. MD, 35S::etr1-1 line 44568 (Wilkinson et al., 1997) and PhBPBT RNAi transgenic petunias were grown as described previously (Underwood et al., 2005).

Selection and identification of PhBPBT
In cDNA libraries (Underwood, 2003) that were selected for cDNAs that were highly expressed in the flower, a 1.7 kb cDNA was identified coding for a 460 amino acid protein (PhBEBT1; Accession no. AAT68601 [GenBank] ) with 100% homology to BENZOYLCOENZYME A (CoA):BENZYL ALCOHOLPHENYLETHANOL BENZOYLTRANSFERASE (BPBT; Accession no. AAU06226 [GenBank] .1) from Petuniaxhybrida, and subsequently named PhBPBT.

Generation of the RNAi silencing construct
Two fragments of PhBPBT (295–638 and 295–1139) were amplified via PCR, ligated end-to-end in a sense/antisense orientation, ligated downstream of the FMV constitutive promoter, and transformed into MD as described previously (Dexter et al., 2007) Thirty-five primary transformants were recovered and grown to maturity under previously described greenhouse conditions, and plants showing reduced PhBPBT expression and benzyl benzoate emission were identified. Flowers from these plants were then self-pollinated and T1 progeny were grown. Positive lines were then screened for 3:1 segregation of the transgene via PCR (verifying the presence of the nptII gene), PhBPBT expression, and benzyl benzoate emission. Flowers from PCR-positive plants from lines demonstrating 3:1 segregation were again selfed, the progeny sown, and homozygous lines identified via PCR (nptII).

PhBPBT expression analysis
Tissue was collected to determine PhBPBT expression levels for the following experiments: circadian/light-dependent regulation, PhBPBT RNAi plants, ethylene treatment (whole flowers and leaves), post-pollination, and wounding. To test circadian/light-dependent regulation, whole flower tissue was collected at 6 h intervals beginning at 10.00 h in the morning as described previously (Underwood et al., 2005). For PhBPBT expression analysis in the BPBT RNAi transgenic lines versus MD, whole flowers were collected at 20.00 h. For expression after ethylene treatment, MD and 44568 (etr1-1) (Wilkinson et al., 1997) whole flowers were treated with ethylene and dissected into the petal limb, petal tube, ovary, and stigma/style as described previously (Underwood et al. 2005). MD and 44568 leaves were collected at 10.00 h, placed in 1% water agar blocks and treated with ethylene or air as described previously (Underwood et al., 2005). For post-pollination expression analysis, MD and 44568 flowers 1 d before anthesis were either self-pollinated of set aside as a non-pollinated control. Beginning at 10.00 h, both pollinated and non-pollinated flowers from MD and 44568 plants were collected and immediately dissected into petal limb, petal tube, ovary, and stigma/style tissue. This process was then repeated at 12 h intervals up to 60 h after pollination. For leaf wounding experiments, MD and 44568 leaves were wounded by scraping 25% of the adaxial epidermis, starting at the leaf tip and working toward the petiole. Tissue was wounded 0x, 1x (initial wound at 0 h), 2x (0 and 6 h after initial wounding), or 3x (0, 6, and 12 h after initial wounding) times beginning at 10.00 h. Both wounded and unwounded leaves were then excised from the plants at the predetermined time points. In all cases, total RNA was extracted from collected tissues as described previously (Underwood et al., 2005). Quantitative RT-PCR using Taqman One-Step RT-PCR reagents (Applied Biosystems, Foster City, CA, USA), the following primers and probe (PhBPBT reverse primer: 5'-GAAATAAGAAAGGTGAGAATGGGATT-3’; PhBPBT forward primer: 5'-AGCTCCTTGACGAATTTTTCCA-3’; PhBPBT probe: 5'-/56FAM/TGGTCCCTATATGTTTGCCTGGCTTTGC/3BHQ_1/-3’), a series of in vitro transcribed PhBPBT standards, and 1 µl of 100 ng µl–1 RNA were then used to quantify mean PhBPBT levels as described previously (Underwood et al., 2005). All data with the exception of 24 h and 48 h wounded tissue were then reported as a percentage of total mRNA ±standard error. For 24 h and 48 h wounded tissue, results were reported as a fold-increase in PhBPBT transcript levels as compared with respective unwounded controls ±standard error.

Volatile analysis
Emitted volatiles and internal volatile pools were quantified every 6 h for a period of 1 h as described previously (Dexter et al., 2007).

Internal benzyl benzoate analysis
To determine internal benzyl benzoate pools following mechanical wounding, MD and 44568 leaf tissue was wounded by scraping 25% of the adaxial epidermis starting at the leaf tip and working toward the petiole. Tissue was wounded 0x, 1x (initial wound at 0 h), 2x (0 and 6 h after initial wounding), or 3x (0, 6, and 12 h after initial wounding) times beginning at 09.00 h. Two leaves were then collected from unwounded and wounded 1x, 2x, and 3x MD and 44568 leaves at 24 h and 48 h after initial wounding. This experiment was repeated twice (three times for 3x 24 h wounded MD and 44568 tissue), resulting in four sets of two leaves (10 sets of two leaves for 3x 24 h MD and 44568 wounded tissue). Pools of volatiles were then extracted and quantified via isobutane chemical–ionization gas chromatography–mass spectrometry as described previously (Schmelz et al., 2004). The resulting data were reported as a fold-increase in benzyl benzoate levels over unwounded controls for 1x, 2x, and 3x wounded MD and 44568 tissue ±standard error.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Circadian or light-dependent expression of PhBPBT
Both expression of PhBPBT and emission of benzyl benzoate are rhythmic with highest expression at 14.30 h and highest emission 6 h later (20.30 h) (Fig. 1A, B). When the plants were moved to complete darkness, one additional 24 h cycle of expression was observed, followed by a complete loss of rhythmicity (Fig. 1A). Additionally, benzyl benzoate emission decreased with reduced emission following the first 24 h cycle in the dark, while no emission was measured thereafter (Fig. 1B).


Figure 1
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Transcripts of PhBPBT follow a dampened light-dependent circadian trend which is reflected in the emission of benzyl benzoate. (A) Real time (Taqman) PhBPBT transcript levels of whole flowers collected at 6 h increments for 5 d. (B) Whole flower emission (±SE) of benzyl benzoate at 6 h increments. Plants were grown in standard greenhouse conditions for 2 d and then transferred to complete darkness.

 
PhBPBT RNAi
To examine the function of PhBPBT in vivo, its expression was suppressed through RNAi. Orlova et al. (2006) showed a morphological phenotype in lines with reduced expression, reporting larger flowers and leaves, thicker stems, and longer internodes. However, 31 lines with reduced expression and benzyl benzoate emission were produced and examined and the RNAi lines were found morphologically indistinguishable from MD. Three lines with reduced PhBPBT1 expression (Fig. 2) were selected for further analysis. In these lines the volatile phenotype was dramatically affected. The lines showed an approximate decrease of 90% in benzyl benzoate emission, a 5-fold increase in the direct precursor, benzyl alcohol, a 3-fold increase in benzaldehyde, and a 2-fold increase in 2-phenylethanol. Phenylacetaldehyde, methyl benzoate, and isoeugenol emission levels from both RNAi and MD were not significantly different (Fig. 2). Together these results show that, in vivo, PhBPBT is critical for the synthesis of benzyl benzoate.


Figure 2
View larger version (13K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Reduced emission of benzyl benzoate and increased levels of benzyl alcohol correlate with reduced expression levels of PhBPBT are reduced in transgenic PhBPBT RNAi lines. Volatiles (±SE) were collected from PhBPBT RNAi and MD whole flowers for 1 h at 20.00 h. Three samples were collected from three plants of each line, and averaged to determine average emission. Levels of PhBPBT expression (±SE) in RNAi knockdown and wild-type (MD) lines were quantified from whole-flower RNA collected at 20.00 h via Taqman real-time RT-PCR.

 
PhBPBT transcript levels following exogenous ethylene treatment
Benzyl benzoate emission is down-regulated in petunia corollas following exposure to exogenous or pollination-induced ethylene production (Underwood et al., 2005). MD and 44568 petunia flowers were treated with exogenous ethylene and analysed for differences in PhBPBT transcript accumulation in separate floral organs (Fig. 3). In MD ovary tissue, exposure to exogenous ethylene resulted in a marginal decrease in transcript at 2 h after treatment compared with 44568 (Fig. 3A). At 10 h after ethylene treatment, PhBPBT transcript levels in MD ovary tissue increased, peaking at 24 h (where levels were twice that of 44568), then remained elevated for the remainder of the experiment. In the corolla limb and tube tissue, a marginal decrease in PhBPBT transcript levels was observed 2 h after ethylene treatment while they were not detectable at 24 h after ethylene treatment compared with 44568 (Fig. 3B, C).


Figure 3
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Ethylene treatment induces PhBPBT expression levels in ovary but reduces them in petal tissue. Mean PhBPBT transcript levels following treatment with exogenous ethylene. (A) Mean real-time RT-PCR PhBPBT transcript levels (n=3, ±SE) were measured in MD (filled diamonds) and line 44568 (open diamonds; CaMV 35S::etr1-1). (A) Ovary, (B) petal tube, (C) petal limb tissues collected at 2, 10, 24, 36, and 48 h after exogenous ethylene treatment.

 
Post-pollination PhBPBT expression
Following the pollination of MD flowers, ethylene is first synthesized from the stigma/style 2–4 h after pollination coinciding with pollen tube growth (Tang and Woodson, 1996; Wilkinson et al., 1997; Holden et al., 2003; Jones et al., 2003). A second period of ethylene synthesis coinciding with fertilization occurs in the stigma/style and ovary 24 h after pollination, followed by ethylene synthesis in the corolla (petal tube and petal limb) from 24 h to 36 h after pollination (Tang and Woodson, 1996; Jones et al., 2003). In ovary tissue, PhBPBT transcript levels were equivalent through 24 h after pollination among all treatments (Fig. 4A). At 36 h after pollination, both 44568 and MD pollinated ovary tissue contained slightly elevated PhBPBT transcript levels compared with their respective non-pollinated controls. By 48–60 h, transcript levels in MD pollinated ovary tissue were 3-fold higher than pollinated 44568 ovary tissue, and 10-fold higher than levels observed in both non-pollinated controls (Fig. 4A). In the petal tube, PhBPBT levels were equivalent among all treatments through 12 h after pollination (Fig. 4B). At 24 h after pollination, PhBPBT levels in both MD treatments were lower than both 44568 treatments, with MD pollinated transcript levels being slightly higher than MD non-pollinated transcript levels. By 48 h after pollination, PhBPBT transcript levels were substantially lower in MD pollinated petal tube tissue compared with the other three treatments. Prior to pollination, PhBPBT transcript abundance in the petal limb tissue was >75-fold higher than levels measured in ovary and petal tube tissue (Fig. 4). After pollination, petal limb transcript levels remained equivalent among all treatments through 36 h after pollination (Fig. 4). At 48 h after pollination, a 2-fold decrease in PhBPBT was observed in MD pollinated petal limb tissue compared with the 44568 and both non-pollinated controls. However, PhBPBT transcript levels were still 10-fold higher than transcript levels quantified in MD pollinated ovary and 44568 pollinated and non-pollinated petal tube tissue. This coincides with the previous observation of decreased benzyl benzoate emission 36–48 h after pollination (Underwood et al., 2005).


Figure 4
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. The effect of pollination-induced ethylene on PhBPBT transcript and internal benzyl benzoate levels. (A) PhBPBT transcript levels (n=3, ±SE) in pollinated and non-pollinated MD and 44568 (CaMV 35S::etr1-1) ovary tissue. (B) PhBPBT transcript levels (n=3, ±SE) in pollinated and non-pollinated MD and 44568 petal tube tissue. (C) PhBPBT transcript levels (n=3, ±SE) in pollinated and non-pollinated MD and 44568 petal limb tissue. (D) Mean PhBPBT transcript levels (n=3, ±SE) in both MD and 44568 pollinated or non-pollinated ovary tissue.

 
PhBPBT transcript levels in the ovary were measured during a 5 d period after pollination to investigate if increased transcript levels in ovary tissue continued beyond the range of the original time-course (60 h). The effects of ethylene on PhBPBT transcript levels were transient, with peak transcript levels measured 2–3 d after pollination in MD ovaries compared with 44568 and non-pollinated controls (Fig. 4D). By 4–5 d after pollination, PhBPBT transcript levels in pollinated MD ovary tissue were no different from those measured in the other three treatments. To determine if this increase in PhBPBT transcript resulted in increased benzyl benzoate biosynthesis, internal volatiles were extracted from MD ovary tissue collected at 3 d and 6 d after pollination. However, benzyl benzoate pools in these extracts were below detection limits (data not shown).

PhBPBT transcript levels in petunia leaves treated with ethylene
Two hours after exogenous ethylene or air treatment of excised 44568 and MD leaves, an induction of PhBPBT transcript levels was observed in MD leaves treated with ethylene compared with all other treatments (Fig. 5). By 6 h after treatment, PhBPBT levels further increased in ethylene-treated MD leaves compared with 44568 leaves, with peak transcript levels comparable to peak levels observed in MD flower tissue. Therefore, unlike in the corolla tissue but similar to that in ovary tissue, treatment with ethylene results in increased levels of PhBPBT in the leaves.


Figure 5
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. Induction of transcript levels in leaf tissue is ethylene dependent. Mean PhBPBT transcript levels (n=3, ±SE) in petunia leaf tissue following exogenous ethylene treatment. Total RNA was extracted from MD and 44568 (CaMV 35S::etr1-1) leaf tissue following treatment with exogenous ethylene or air, and analysed via Tagman real-time RT-PCR.

 
Ethylene-dependent regulation of PhBPBT transcript levels following multiple wounding events
Petunia leaves were wounded three times at 6 h intervals (0, 6, and 12 h after initial wounding) to determine the effect of wound-induced ethylene on PhBPBT transcript levels (Fig. 6A). During the period after the first wounding event (0–6 h after initial wounding), no change in PhBPBT transcript levels was observed in MD or 44568 wounded leaves compared with unwounded controls (Fig. 6B). After the second wounding event, PhBPBT transcript levels in 44568 wounded leaf tissue were slightly elevated compared with the other three treatments. By 12 h after wounding, PhBPBT transcript levels in both MD and 44568 wounded leaf tissues were elevated compared with unwounded controls. Following a third wounding event, PhBPBT transcript levels in both controls and wounded MD leaves remained static, while levels in wounded 44568 leaves rapidly increased (Fig. 6B, C). After 48 h, levels of PhBPBT transcript in both MD and 44568 had almost returned to their original level. Levels of benzyl benzoate were slightly increased in both MD and 44568 wounded tissue compared with their respective controls (Fig. 6D). In MD leaf tissue wounded 2x or 3x times, internal benzyl benzoate pools were elevated compared with 1x and unwounded MD treatments. In 44568 wounded leaf tissue, no significant increase in benzyl benzoate pools was observed following 2x wounding events; however, following a third wounding event, a substantial increase in benzyl benzoate was observed over 44568 leaf tissue wounded 1x and 2x (Fig. 6D). While a >50-fold increase in PhBPBT transcript was observed in 44568 3x wounded tissue compared with MD 3x wounded leaf tissue (Fig. 6C), there was little difference in internal benzyl benzoate levels in MD or 44568 wounded leaf tissue (Fig. 6D). These results indicate that in MD leaves PhBPBT transcript and benzyl benzoate levels are transiently elevated in response to mechanical wounding yet transcripts do not result in quantitative relationships with product pools, suggesting additional levels of regulation.


Figure 6
View larger version (46K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. PhBPBT transcript and internal volatile levels in petunia leaves following repeated wounding events. (A) MD petunia leaves wounded 1x, 2x, and 3x times. (B) Wounded and unwounded MD and 44568 (CaMV 35s::etr1-1) leaves were collected at 2 h increments for 16 h plus an additional 24 h collection. Tissue was wounded three times (0, 6, 12 h indicated by black arrows). Mean PhBPBT transcript levels (n=3, ±SE) were quantified via real-time RT-PCR. (C) Fold increases in PhBPBT transcript (n=3, ±SE) in MD and 44568 wounded leaves as compared with respective unwounded controls. Leaves were wounded 1x (0 h), 2x (0, 6 h), or 3x (0, 6, 12 h) times, and total RNA was extracted at 24 h and 48 h after initial wounding. (D) Fold increases in benzyl benzoate levels (n=4, ±SE) in MD and 44568 wounded leaves as compared with respective unwounded controls. Leaves were wounded 1x (0 h), 2x (0, 6 h), or 3x (0, 6, 12 h) times and volatiles were extracted at 24 h and 48 h after initial wounding.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Circadian expression of PhBPBT is light dependent
All genes involved in floral benzenoid biosynthesis that have been characterized in petunia (PhBSMT1 and 2, PhBPBT, PhCFAT, PhIGS1, PhPAAS, and PhODO1) follow a rhythm, with a maximum expression preceding the nocturnal peak of scent emission by ~2–4 h (Negre et al., 2003; Boatright et al., 2004; Underwood et al., 2005; Verdonk et al., 2005; Kaminaga et al., 2006; Koeduka et al., 2006; Orlova et al., 2006; Dexter et al., 2007). Here it is shown that, because the rhythm is dampened after the plants have been placed in complete darkness, the regulation of PhBPBT transcription is both light dependent and circadian in origin. A similar pattern of expression has previously been described for PhBSMT; when moved into complete darkness, PhBSMT transcript abundance was no longer rhythmic, with a total loss of rhythmicity observed after 1 d in constant dark conditions (Underwood et al., 2005).

PhBPBT RNAi lines show altered volatile production but no morphological phenotype
A decrease in PhBPBT function results in an accumulation of its substrates, benzyl alcohol and 2-phenylethanol (Fig. 2), as was seen before in MD plants with a flower-specific RNAi approach (Orlova et al., 2006). Acetyl-CoA is also a possible substrate for PhBPBT (Boatright et al., 2004), and when this is used instead of benzoyl-CoA, benzyl acetate and 2-phenylethyl acetate are formed. These substances were present at levels below the limits of detection yet we speculate that the trace pools present may be further reduced. Benzyl alcohol is not only converted to benzyl benzoate but also reversibly to benzaldehyde and to methyl benzoate in petunia petal tissue (Boatright et al., 2004). In agreement with this, a 3-fold accumulation of benzaldehyde is observed in RNAi plants as compared with wild type (Fig. 2), but no change in methyl benzoate emission or internal accumulation was observed.

Flower-specific silencing of the PhBPBT gene has been reported to affect the morphology of MD plants dramatically (Orlova et al., 2006). In short, Orlova et al. (2006) reported larger flowers, longer internodes, larger leaves, and thicker stems. The 31 RNAi lines created in this study using the constitutive FMV promoter (Richins et al., 1987) were morphologically indistinguishable from MD plants (RJ Dexter, JC Verdonk, DG Clark, personal observation). The phenotype described by Orlova et al. (2006) was similar to a polyploid phenotype that is routinely observed when MD plants come out of tissue culture. These polyploid plants produce large flowers, with larger organs that are delayed in blooming, while the plants have significantly thicker stems and large leaves. To investigate this the RNAi lines were requested from Dr Natalia Dudareva's group and the amount of genetic material determined by flow cytometry. These plants showed a higher content of genetic material (data not shown), so subsequently the number of amyloplasts of stomatal guard cells in epidermal peels was analysed (Qin and Rotino, 1995). It was clear that the number of amyloplasts in the stomatal guard cells of these transgenic lines was doubled as compared with MD, and therefore we suggest that the morphological phenotype described in Orlova et al. (2006) is caused by a ploidy change rather than the silencing of the PhBPBT gene.

Ethylene differentially regulates PhBPBT transcription in petunia floral tissue
Both pollination and exogenous ethylene treatment cause a down-regulation of PhBSMT and PhCFAT transcript levels (Negre et al., 2003; Underwood et al., 2005; Dexter et al., 2007), resulting in a decrease of methyl benzoate and isoeugenol emission. The same treatment also causes a decrease in benzyl benzoate emission (Underwood et al., 2005). While ethylene treatment causes a down-regulation of floral PhBPBT expression (Fig. 4), transcript levels in 44568 and MD pollinated and non-pollinated ovary and corolla tissue remained equivalent, unaffected by the initial period (<24 h after pollination) of rapid ethylene synthesis by the stigma/style (Jones et al., 2003). Following successful fertilization (>24 h after pollination), ethylene synthesized both in the ovary and corolla then differentially regulates PhBPBT transcript levels, resulting in an increase of transcript levels in the ovary and decreased transcript levels in the corolla (Fig. 4). The down-regulation of PhBPBT in the corolla does not coincide with the decrease in benzyl benzoate emission (Fig. 1); therefore, this decrease is likely to be caused by an absence in substrates, probably caused by down-regulation of genes upstream in the pathway, like PHENYLALANINE AMMONIA LYASE, 5-ENOL- PYRUVYL SHIKIMATE-3-PHOSPHATE SYNTHASE, or ODORANT1 after ethylene treatment.

Ethylene-dependent regulation of PhBPBT transcript and benzyl benzoate biosynthesis in petunia vegetative tissue after wounding
In the flower, PhBPBT transcript levels and subsequent benzyl benzoate biosynthesis are down-regulated by ethylene. Because in Clarkia wounding was shown to up-regulate CbBEBT expression levels in leaves (D'Auria et al., 2002) and because ethylene was shown to be synthesized in Petuniaxhybrida leaves following mechanical wounding (Gomez, 1996; Boatright, 2000), it is possible that this ethylene is necessary for the up-regulation of PhBPBT transcript levels in leaves after wounding. Treatment of petunia leaves with exogenous ethylene resulted in increased levels of PhBPBT transcript in MD leaves but not 44568, initially indicating that ethylene could up-regulate PhBPBT transcription in the leaves (Fig. 5). Interestingly, while exogenous ethylene treatment resulted in increased PhBPBT transcript levels in MD tissue compared with 44568, transcript levels in 44568 leaf tissue wounded 2x or 3x times were substantially (>50-fold) higher than MD (Fig. 6). This suggests that ethylene instead plays an inhibitory role in the regulation of PhBPBT transcript levels following wounding in leaves. Because there was no difference between MD and 44568 benzyl benzoate levels, while wounding of 44568 leaves resulted in a substantial increase in transcript compared with MD it is likely that the benzyl benzoate levels are regulated by the availability of their precursors rather than by a signal dependent on ethylene.

Possible physiological role of benzyl benzoate in petunia
While little is known about the physiological role of benzyl benzoate in vivo, some in vitro research has provided evidence to support a role for benzyl benzoate in either pollinator attraction or plant defence. Benzyl benzoate is a volatile, with little perceived odour to humans, that has been isolated from many plant species including petunia MD (Knudsen et al., 1993; Verdonk et al., 2003). For moth pollinators, however, it is likely that benzyl benzoate is attractive, because exposure to benzyl benzoate excites receptor cells in the antenna of Mythimna conigera (Huber et al., 2005) and Manduca sexta (Shields and Hildebrand, 2000; Hoballah et al., 2005). By contrast, benzyl benzoate has also been reported to be a repellent involved in defence; it is an effective treatment against common mites such as Tyrophagus putrescentiae (Schrank) and sheep mange (Dimri and Sharma, 2004; Harju et al., 2004).

It is possible that PhBPBT and subsequent benzyl benzoate production play a physiological role in the protection of the ovary tissue from pathogens immediately following senescence of the corolla tissue (days 2–3), a potentially vulnerable time in ovary development (Fig. 4D). The wound-induced induction of PhBPBT transcript levels and benzyl benzoate pools is indicative of a defence role for benzyl benzoate within the leaves. While a physiological role for PhBPBT and subsequent benzyl benzoate in petunia leaf tissue (after repeated wounding) cannot be ruled out; even at its highest levels, PhBPBT transcript levels within MD and 44568 leaf tissue are substantially lower than those observed in the petal limb (Fig. 4D). The relatively lower levels of both the wound- and fertilization-induced PhBPBT transcription in the leaves and ovary (both long-term regenerative tissues, while petals are terminal) as compared with the petals suggests that the primary function of PhBPBT and subsequent benzyl benzoate is in the petal limb prior to fertilization. The availability of the present PhBPBT RNAi lines will be ideal in determining the importance of PhBPBT and subsequent benzyl benzoate production in defence against pathogens.

In conclusion, it has been shown that PhBPBT is differentially regulated in response to ethylene perception, depending on the plant organ. The specificity of this expression pattern is consistent with the hypothesis that PhBPBT and subsequent benzyl benzoate production is involved in both pollinator attraction and also defence against biotic attack. Diploid transgenic plants created in this work that exhibit modified benzyl benzoate production will be invaluable in future studies aimed at identifying further the physiological and multitrophic roles of this floral benzenoid.


    Acknowledgements
 
The authors wish to thank Harry Klee (Department of Horticultural Sciences, University of Florida, USA) for critically reviewing the manuscript. Becky Hamilton is acknowledged for her excellent care of the petunia plants. This work was supported by the USDA Nursery and Floral Crops Initiative, the Florida Nursery Growers and Landscape Association, the Florida Agricultural Experiment Station, and the Fred Gloeckner Foundation.


    Footnotes
 
* These authors have contributed equally to this work. Back

{dagger} Present address: National Institute of Floricultural Sciences, 2-1 Fujimoto, Tsukuba 305-8519, Japan. Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Abeles F, Morgan P, Saltveit M. Ethylene in plant biology (1992) 2nd edn. New York, NY: Academic Press.

Bleecker AB, Kende H. Ethylene: a gaseous signal molecule in plants. Annual Review of Cell and Developmental Biology (2000) 16:1–18.[CrossRef][Web of Science][Medline]

Boatright J. (2000) Transcriptional regulation of PhACO1 in Petunia hybrida. PhD thesis, Purdue University, West Lafayette, Indiana, USA.

Boatright J, Negre F, Chen X, Kish CM, Wood B, Peel G, Orlova I, Gang D, Rhodes D, Dudareva N. Understanding in vivo benzenoid metabolism in petunia petal tissue. Plant Physiology (2004) 135:1993–2011.[Abstract/Free Full Text]

Czernic P, Huang HC, Marco Y. Characterization of hsr201 and hsr515, two tobacco genes preferentially expressed during the hypersensitive reaction provoked by phytopathogenic bacteria. Plant Molecular Biology (1996) 31:255–265.[CrossRef][Web of Science][Medline]

D'Auria JC. Acyltransferases in plants: a good time to be BAHD. Current Opinion in Plant Biology (2006) 9:331–340.[CrossRef][Web of Science][Medline]

D'Auria JC, Chen F, Pichersky E. Characterization of an acyltransferase capable of synthesizing benzylbenzoate and other volatile esters in flowers and damaged leaves of Clarkia breweri. Plant Physiology (2002) 130:466–476.[Abstract/Free Full Text]

Dexter R, Qualley A, Kish CM, Ma CJ, Koeduka T, Nagegowda DA, Dudareva N, Pichersky E, Clark D. Characterization of a petunia acetyltransferase involved in the biosynthesis of the floral volatile isoeugenol. The Plant Journal (2007) 49:265–275.[CrossRef][Web of Science][Medline]

Dimri U, Sharma MC. Effects of sarcoptic mange and its control with oil of Cedrus deodara, Pongamia glabra, Jatropha curcas and benzyl benzoate, both with and without ascorbic acid on growing sheep: assessment of weight gain, liver function, nutrient digestibility, wool production and meat quality. Journal of Veterinary Medicine, Series A (2004) 51:79–84.[CrossRef][Medline]

Gomez AM. (1996) Regulation and function of 1-aminocyclopropane-1-carboxylate oxidase in Petunia hybrida. PhD thesis, Purdue University, West Lafayette, IN, USA.

Harju AT, Pennanen SM, Liesivuori J. The efficacy of benzyl benzoate sprays in killing the storage mite Tyrophagus putrescentiae (Acari: Acaridae). Annals of Agricultural and Environmental Medicine (2004) 11:115–119.[Web of Science][Medline]

Hoballah ME Stuurman J, Turlings TC, Guerin PM, Connetable S, Kuhlemeier C. The composition and timing of flower odour emission by wild Petunia axillaris coincide with the antennal perception and nocturnal activity of the pollinator Manduca sexta. Planta (2005) 222:141–150.[CrossRef][Web of Science][Medline]

Holden MJ, Marty JA, Singh-Cundy A. Pollination-induced ethylene promotes the early phase of pollen tube growth in Petunia inflata. Journal of Plant Physiology (2003) 160:261–269.[CrossRef][Web of Science][Medline]

Huber FK, Kaiser R, Sauter W, Schiestl FP. Floral scent emission and pollinator attraction in two species of Gymnadenia (Orchidaceae). Oecologia (2005) 142:564–575.[CrossRef][Web of Science][Medline]

Jones MB, Langston BJ, Johnson F. Pollination-induced senescence of ethylene sensitive and insensitive petunias (2003) Amsterdam, The Netherlands: IOS Press.

Jorgensen RA, Cluster PD, English J, Que Q, Napoli CA. Chalcone synthase cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense constructs and single-copy vs. complex T-DNA sequences. Plant Molecular Biology (1996) 31:957–973.[CrossRef][Web of Science][Medline]

Kaminaga Y, Schnepp J, Peel G, et al. Plant phenylacetaldehyde synthase is a bifunctional homotetrameric enzyme that catalyzes phenylalanine decarboxylation and oxidation. Journal of Biological Chemistry (2006) 281:23357–23366.[Abstract/Free Full Text]

Knudsen J, Tollsten L, Berstrom L. Floral scents – a checklist of volatile compounds isolated by headspace techniques. Phytochemistry (1993) 33:253–280.[CrossRef][Web of Science]

Koeduka T, Fridman E, Gang DR, et al. Eugenol and isoeugenol, characteristic aromatic constituents of spices, are biosynthesized via reduction of a coniferyl alcohol ester. Proceedings of the National Academy of Sciences, USA (2006) 103:10128–10133.[Abstract/Free Full Text]

Kolosova N, Gorenstein N, Kish CM, Dudareva N. Regulation of circadian methyl benzoate emission in diurnally and nocturnally emitting plants. The Plant Cell (2001) 13:2333–2347.[Abstract/Free Full Text]

Negre F, Kish CM, Boatright J, Underwood B, Shibuya K, Wagner C, Clark DG, Dudareva N. Regulation of methylbenzoate emission after pollination in snapdragon and petunia flowers. The Plant Cell (2003) 15:2992–3006.[Abstract/Free Full Text]

Omura H, Honda K. Priority of color over scent during flower visitation by adult Vanessa indica butterflies. Oecologia (2005) 142:588–596.[CrossRef][Web of Science][Medline]

Orlova I, Marshall-Colon A, Schnepp J, et al. Reduction of benzenoid synthesis in petunia flowers reveals multiple pathways to benzoic acid and enhancement in auxin transport. The Plant Cell (2006) 18:3458–3475.[Abstract/Free Full Text]

Qin X, Rotino GL. Chloroplast number in guard cells as ploidy indicator of in vitro-grown androgenic pepper plantlets. Plant Cell, Tissue and Organ Culture (1995) 41:145.[CrossRef][Web of Science]

Raguso RA Pichersky E. Floral volatiles from Clarkia breweri and C. concinna (Ongraceae): recent evolution of floral scent and moth pollination. Plant Systematics and Evolution (1995) 194:55–67.[CrossRef][Web of Science]

Richins RD, Scholthof HB, Shepherd RJ. Sequence of figwort mosaic virus DNA (caulimovirus group). Nucleic Acids Research (1987) 15:8451–8466.[Abstract/Free Full Text]

Schade F, Legge RL, Thompson JE. Fragrance volatiles of developing and senescing carnation flowers. Phytochemistry (2001) 56:703–710.[CrossRef][Web of Science][Medline]

Schmelz EA, Engelberth J, Tumlinson JH, Block A, Alborn HT. The use of vapor phase extraction in metabolic profiling of phytohormones and other metabolites. The Plant Journal (2004) 39:790–808.[CrossRef][Web of Science][Medline]

Schuurink RC, Haring MA, Clark DG. Regulation of volatile benzenoid biosynthesis in petunia flowers. Trends in Plant Science (2006) 11:20–25.[CrossRef][Web of Science][Medline]

Shields VD, Hildebrand JG. Responses of a population of antennal olfactory receptor cells in the female moth Manduca sexta to plant-associated volatile organic compounds. Journal of Comparative Physiology A: Neuroethology, Sensory, Neural, and Behavioral Physiology (2000) 186:1135–1151.[Web of Science]

Tang X, Woodson WR. Temporal and spatial expression of 1-aminocyclopropane-1-carboxylate oxidase mRNA following pollination of immature and mature petunia flowers. Plant Physiology (1996) 112:503–511.[Abstract]

Underwood BA. Effects of ethylene on floral fragrance of Petuniaxhybrida ‘Mitchell Diploid’. (2003) PhD dissertation, University of Florida, Gainesville, FL, USA.

Underwood BA, Tieman DM, Shibuya K, Dexter RJ, Loucas HM, Simkin AJ, Sims CA, Schmelz EA, Klee HJ, Clark DG. Ethylene-regulated floral volatile synthesis in petunia corollas. Plant Physiology (2005) 138:255–266.[Abstract/Free Full Text]

Verdonk JC. (2006) Floral scent production in Petunia hybrida. PhD thesis, Universiteit van Amsterdam, Amsterdam, The Netherlands.

Verdonk JC, Haring MA, van Tunen AJ, Schuurink RC. ODORANT1 regulates fragrance biosynthesis in petunia flowers. The Plant Cell (2005) 17:1612–1624.[Abstract/Free Full Text]

Verdonk JC, Ric de Vos CH, Verhoeven HA, Haring MA, van Tunen AJ, Schuurink RC. Regulation of floral scent production in petunia revealed by targeted metabolomics. Phytochemistry (2003) 62:997–1008.[CrossRef][Web of Science][Medline]

von Dahl C, Baldwin I. Deciphering the role of ethylene in plant–herbivore interactions. Journal of Plant Growth Regulation (2007) 26:201.

Wilkinson JQ, Lanahan MB, Clark DG, Bleecker AB, Chang C, Meyerowitz EM, Klee HJ. A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants. Nature Biotechnology (1997) 15:444–447.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
59/3/609    most recent
erm337v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Dexter, R. J.
Right arrow Articles by Clark, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dexter, R. J.
Right arrow Articles by Clark, D. G.
Agricola
Right arrow Articles by Dexter, R. J.
Right arrow Articles by Clark, D. G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?