Skip Navigation



JXB Advance Access published online on February 13, 2008

Journal of Experimental Botany, doi:10.1093/jxb/erm364
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
59/4/839    most recent
erm364v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Zhang, X.
Right arrow Articles by Zhao, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, X.
Right arrow Articles by Zhao, J.
Agricola
Right arrow Articles by Zhang, X.
Right arrow Articles by Zhao, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2008 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. This paper is available online free of all access charges (see
http://jxb.oxfordjournals.org/open_access.html for further details)


RESEARCH PAPER

Water deficits and heat shock effects on photosynthesis of a transgenic Arabidopsis thaliana constitutively expressing ABP9, a bZIP transcription factor

Xia Zhang1,2, Bernd Wollenweber2,*, Dong Jiang2,3, Fulai Liu4 and Jun Zhao1,*

1Biotechnology Research Institute, National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing100081, China
2Department of Genetics and Biotechnology, Faculty of Agricultural Sciences, University of Aarhus, Forsøgsvej 1, DK-4200 Slagelse, Denmark
3Key Laboratory of Crop Growth Regulation of Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China
4Department of Agricultural Sciences, Faculty of Life Sciences, University of Copenhagen, DK-2630 Taastrup, Denmark

* To whom correspondence should be addressed. E-mail: Bernd.Wollenweber{at}agrsci.dk; E-mail: junzhao{at}caas.net.cn

Received 1 September 2007; Revised 19 December 2007 Accepted 21 December 2007


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The effects of water deficits (WD), heat shock (HS), and both (HSWD) on photosynthetic carbon- and light-use efficiencies together with leaf ABA content, pigment composition and expressions of stress- and light harvesting-responsive genes were investigated in ABP9 [ABA-responsive-element (ABRE) binding protein 9] transgenic Arabidopsis (5P2). WD, HS, and HSWD significantly decreased photosynthetic rate (A) and stomatal conductance (gs) in wild-type plants (WT). A and gs of 5P2 transgenic plants were slightly reduced by a single stress and were hardly modified by HSWD. Although A and electron transport rate (ETR) in 5P2 plants were depressed under optimal growth conditions (control) in relation to WT, they were enhanced under HS and HSWD. These results indicate that ABP9 transgenic plants are less susceptible to stress than the WT. In addition, the increased ABA contents in both WT and 5P2 plants in response to WD and/or HS stresses suggest that declines in A and gs might have been due to ABA-induced stomatal closure. Moreover, compared with WT, 5P2 plants exhibited higher ABA content, instantaneous water use efficiency (IWUE), Chl a/b, NPQ, and lower Chl/carotenoid ratios. Finally, altered expression of stress-regulated or light harvesting-responsive genes was observed. Collectively, our results indicate that constitutive expression of ABP9 improves the photosynthetic capacity of plants under stress by adjusting photosynthetic pigment composition, dissipating excess light energy, and elevating carbon-use efficiency as well as increasing ABA content, IWUE, and expression of stress-defensive genes, suggesting an important role of ABP9 in the regulation of plant photosynthesis under stress.

Key words: ABP9, ABA, heat shock, photosynthesis, stress tolerance, water deficits


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Increased climatic variability leading to more frequent extreme conditions may result in plants being exposed to more than one extreme event in a single growing season. As with temperature, variability in drought occurs via variation in its timing, intensity, and duration. Water deficits and high temperature are major abiotic stress factors restricting plant growth and productivity in many regions, and they often occur simultaneously (Boyer, 1982; Wollenweber et al., 2003, 2005).

Stomatal limitation is generally accepted to be the main cause of reduced photosynthesis under water deficits (Cornic, 2000). Water deficits can also limit photosynthesis through metabolic impairment [(e.g. reduction in the content and activity of photosynthetic carbon reduction cycle enzymes, such as ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco)] (Tezara et al., 1999; Parry et al., 2002). Extreme heat episodes are expected both to decrease the rate of carbon gain and assimilation per unit leaf area and to impair cell anapleurotic carbon metablism, carbon partitioning and redistribution within and between organs (Jones, 1993). Heat shock stress also alters photosynthetic activity via suppression of chloroplast electron transport (Pastenes and Horton, 1996; Feller et al., 1998). However, most of the studies done to date have focused on the impact of one single environmental stress event, for example, either water deficits or heat shock (Reddy et al., 2004; Camejo et al., 2005), the combined effect of more than one type of stress (e.g. water deficits+heat shock) on plant metabolism has received less attention (Rizhsky et al., 2004).

It is known that the phytohormone abscisic acid (ABA) is a key component of the signalling system integrating the adaptive response of the plant to stressful conditions including water deficits and high temperature (Finkelstein et al., 2002). Studies have shown that accumulation of ABA occurs in response to various stresses that cause a decrease in tissue water content, such as dehydration induced by high temperature and water deficits, which in turn causes stomatal closure and induces expression of stress-related genes (Davies and Zhang, 1991). ABA-induced partial stomatal closure is believed to be the main reason for the decrease in photosynthesis in response to environmental stresses (Daie and Campbell, 1981; Xu et al., 1995; Wilkinson and Davies, 2002; Reddy et al., 2004; Liu et al., 2005). However, it has also been reported that ABA may protect the photosynthetic apparatus against photoinhibition by enhancing the xanthophyll cycle and accelerating the recovery of the photosystem II (PSII) complex from the photo-inactivated state (Ivanov et al., 1995; Saradhi et al., 2000). In such a context, genotypes with a putative high ABA level may be more tolerant to stressful conditions (Xiong and Zhu, 2003).

A basic region/leucine zipper (bZIP) transcription factor has previously been cloned from maize, and designated ABP9 (for ABRE Binding Protein 9), which specifically binds to the ABRE2 (ABA responsive element) motif of the maize catalase1 gene and which is involved in the ABA-dependent signalling pathway (Guan et al., 2000; Wang et al., 2002). In plants, bZIP transcription factors regulate many processes including ABA and stress signalling, seed maturation, and flower development (Jakoby et al., 2002) and are involved in contributing to plant stress tolerance (Fujita et al., 2005). Our recent study showed that constitutive expression of ABP9 driven by the 35S CaMV promoter in transgenic Arabidopsis causes growth retardation under optimal growth condition. Downstream targets of ABP9 identified by microarray analysis (X Zhang, unpublished data) revealed that expression of many stress-defensive genes and ABA-responsive genes were significantly enhanced. Among the down-regulated genes, those related to photosynthesis process were found to be the most responsive ones. However, it remains unknown whether ABP9 transgenic plants are more tolerant to environmental stresses in terms of maintaining photosynthetic activity than the wild-type plants. The objective of the present study was, therefore, to elucidate the function of ABP9 in terms of light- and carbon-use efficiencies during water deficits (WD), heat shock (HS), and both stresses (HSWD). Several independent lines of transgenic Arabidopsis plants with different expression levels of ABP9 have been generated in our laboratory and these lines show consistent stress-related phenotypes in ABA sensitivity, cellular levels of reactive oxygen species (ROS), expression of stress-related genes, and stress performance (X Zhang, unpublished data). In the present study, one of the transgenic lines with a relatively moderate expression level of ABP9 (5P2) was used to analyse the role of ABP9 in affecting photosynthesis under certain stresses.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Plant material and experimental conditions
The experimental work was done at the Research Centre Flakkebjerg, University of Aarhus, Denmark. Arabidopsis thaliana ecotype Columbia (WT) and ABP9 transgenic homozygous line (5P2) were used in this study. The seeds were sown in pots filled with a mixture of vermiculite, perlite, and peat moss (1:1:1 by vol.) and placed at 4 °C for 4 d in the dark to break residual dormancy. After emerging, plants were grown in the greenhouse at 20 °C under a 16/8 h light/dark photoperiod with 60±20% humidity and 100±20 µmol photons m–2 s–1.

Stress treatments and sampling of plant material
At the onset of the treatments (at about the eight true leaf stage), the plants were transferred to growth chambers (PGV36, Conviron, Montreal, Canada) with controlled environmental conditions. The plants in one chamber were imposed to water-deficit stress (WD), where the temperature was set at 20 °C under 16/8 light/dark, 120 µmol photons m–2 s–1, and 60% humidity; and the well-watered plants served as controls. The plants in the other chamber were assigned to heat shock (HS) and heat shock+water deficit (HSWD) stresses, where the temperature was set at 42 °C and with the same light intensity, photoperiod, and humidity as in the first chamber. WD was induced before transferring the plants into the growth chamber by withholding water for 10–12 d until the soil relative water content (SRWC) decreased to 45–50%. SRWC was calculated by using the formula: SRWC (%) = ((FWDW)/(SWDW))x100, where FW is the actual pot weight at the day of measurement, DW is the pot weight with dry weight of soil, and SW is the pot weight with fully saturated soil. Plant weight was considered to be negligible. HS was applied by raising the temperature in the growth chamber to 42 °C for 5 h. HSWD was imposed by subjecting WD-stressed plants to the HS treatment. The plants were harvested immediately after the treatments and samples were stored at –80 °C for further ABA and pigment analysis.

Gas exchange measurements
Gas exchange measurements were taken on three rosette leaves (6th, 7th, and 8th) of each plant using a portable differential CO2/H2O infrared gas-analyser (IRGA) system with a leaf cuvette (CIRAS-1, PP Systems, Hitchin, UK). All measurements were taken at a constant airflow rate of 200 ml min–1 under the artificial light condition of 120 µmol m–2 s–1. The reference concentration of ambient CO2 was about 360 µmol mol–1 and the temperature was either 20 °C (for control and WD) or 42 °C (for HS and HSWD). Leaf area was determined with the leaf area meter (Li-Cor 3100, Lincoln, NB, USA).

Chlorophyll fluorescence measurements
Chlorophyll fluorescence measurements were made with a pulse-amplitude-modulation portable chlorophyll fluorometer (MINI-PAM, Walz, Effeltrich, Germany). Light response curves (LRCs) with eight consecutive illumination periods were started after dark adaptation of the plants for 30 min. The effective PSII photochemical efficiency ({Phi}PSII), and non-photochemical quenching (NPQ) were calculated as (F'mFt)/F'm) and Fm/F'm–1 respectively, and electron transport rate (ETR) was obtained as {Phi}PSIIxPPFDx0.5x0.84 (Genty et al., 1989; Maxwell and Johnson, 2000). Data points were fitted using non-linear regression equations (Rascher et al., 2000).

Determination of leaf ABA content
Leaf ABA content was measured by indirect enzyme-linked immunosorbent assay (ELISA) using a monoclonal antibody for ABA (AFRC MAC 252) according to (Asch, 2000; Liu et al., 2003). Leaf samples were ground finely under liquid nitrogen, shaken, and extracted in glass-distilled water using 1.5 ml per 50 mg fresh weight on a shaker at 4 °C overnight. Extractions were centrifuged at 12 000 rpm for 10 min at 4 °C, and the supernatant diluted with distilled water was used for the ELISA assay.

Determination of pigment content
The procedure was carried out at 4 °C in the dark. Leaf samples (50 mg) were mashed with a mortar and pestle and extracted with 80% acetone (v/v). The extract was centrifuged at 12 000 rpm for 5 min. The supernatant was collected and read at 663 nm and 647 nm for chlorophyll a and chlorophyll b, respectively, and at 470 nm for carotenoid content using the spectrophotometer (Unicam Helios Beta, Spectronic Unicam, Cambridge, UK). The contents for chlorophyll a, chlorophyll b, and the sum of leaf carotenoids (xanthophylls and carotenes) were calculated according to the equations proposed by Lichtenthaler and Buschmann (2001).

Relative quantification of gene expression using real-time PCR assay
Total RNAs were isolated from 150 mg samples using Trizol reagent (T-9424, Sigma-Aldrich). The first-strand cDNA syntheses of all RNA samples were performed using 5 µg of total RNA and SuperScript TM II Reverse Transcriptase (18064–014, Invitrogen). Real-time quantitative PCR was performed using 25 ng of cDNA in a 10 µl reaction volume using Power SYBR Green PCR Master Mix (P/N-4367660, Applied Biosystem, Foster City, CA) on an ABI PRISM 7900HT system. PRIMER EXPRESS software (PE-Applied Biosystems) was used to design gene-specific primers: Lhca6 (At1G19150) forward primer: TCCTCCGGACCGTCCTTTAT; Lhca6 (At1G19150) reverse primer: CGAAACCGAAATCACCAGGTA. Lhcb2.4 (At3G27690) forward primer: CAACGATCTCCTCCGCAAA; Lhcb2.4 (At3G27690) reverse primer: CTTGACGGTACGACGCATGAT. PsbW (At4G28660) forward primer: CGAACAGCTCTAAGACCGATGAA; PsbW (At4G28660) reverse primer: CTCATCCGTCCCTTGGATGA. DREB2H (At2G40350) forward primer: CAGTCTGCCCGACTCAATCTT; DREB2H (At2G40350) reverse primer: TGTATCCTCACGTGCACAAACTT. HIS1-3 (At2G18050) forward primer: TCCGGCGGCGAAGAA; HIS1-3 (At2G18050) reverse primer: GGACCATCAAAGCCTCTTTTATCA. HSF (At5g43840) forward primer: AAGGAATCAAGAATCGAGAGCAA; HSF (At5g43840) reverse primer: CCATAATCAAACACACCTCCACAT. HSP17.4 (At3g46230) forward primer: CGTGGCAGCGTTCACAAA; HSP17.4 (At3g46230) reverse primer: CGTCCGCCTTGAACACATG. Actin2 (At3g18780) forward primer: CCAACAGAGAGAAGATGACT; Actin2 (At3g18780) reverse primer: ATGTCTCTTACAATTTCCCG. Cycling conditions were as follows: 2 min at 50 °C, 10 min at 95 °C, 40 cycles of 15 s at 95 °C, 60 s at 60 °C. Samples were also subjected to the dissociation curve analysis to screen for non-specific products (60 °C to 95 °C, with a 15 s hold at each temperature). Samples were run in triplicate on each 384-well plate and were repeated at least three times for each experiment. Relative fold differences were calculated based on the comparative CT (threshold cycle) method using the actin2 as an endogenous control and the validation experiment for the valid comparative CT method was performed to ensure that the target and the endogenous control have a similar amplification efficiency. To determine relative fold differences for each target gene in 5P2 in each treatment, the CT value for the target gene was normalized to the CT value for the actin2 and was calculated relative to a calibrator (WT) using the formula 2{Delta}{Delta}CT.

Statistical analysis
The results are reported as mean ±standard error. Means of treatments and plants were analysed using a linear mixed model and separated by pairwise comparison at the 5% level of significance using PROC MIXED within the Statistical Analysis System (SAS 8.02, Cary, NC, USA).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Leaf gas exchange and ABA content
Compared with the control, WD, HS and HSWD significantly reduced net photosynthetic rate (A) in WT by 8%, 43%, and 52% (P < 0.05), respectively (Fig. 1A). In 5P2 transgenic plants, compared with the control, WD and HS had less effect on A with a decline of 7% and 16%, respectively, while HSWD had no effect on the A (Fig. 1A). These results indicate that ABP9 transgenic plants are not as susceptible to these stresses as the wild type. In both 5P2 and WT, stomatal conductance (gs) showed a similar response as for A to the three treatments (Fig. 1B). Thus, the reduction of A was probably due mainly to lowered gs under stress conditions. Transpiration rate (E) was slightly decreased by WD in both WT and 5P2 plants; however, it was significantly increased by HS and HSWD (P < 0.001) (Fig. 1C). Instantaneous water use efficiency (IWUE) significantly decreased after HS and HSWD treatments in both WT and 5P2 (P < 0.01). In the WD treatment, IWUE showed a slight increase in WT plants (P < 0.01), but no significant variation in 5P2 plants as compared with the controls (Fig. 1D). Figure 1 also shows differences between WT and 5P2 plants in response to the stresses. 5P2 plants had lower A under control and WD (P < 0.001), but upon the HS and HSWD treatments, A of 5P2 was significantly higher than that in WT (P < 0.05) (Fig. 1A). gs of 5P2 was significantly lower than that of WT under the control, WD, and HS treatments (P < 0.001), but higher under HSWD (P < 0.001) (Fig. 1B). Compared with WT, E of 5P2 remained lower under the control, WD and HS treatments, but was higher under HSWD treatment. The largest difference in E between WT and 5P2 was found under HS treatment (Fig. 1C). IWUE was always higher in 5P2 than in WT for all treatments (P < 0.05) (Fig. 1D).


Figure 1
View larger version (26K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Effects of water deficits (WD), heat shock (HS), and combination of HS and WD (HSWD) on net photosynthetic rate, A (A), stomatal conductance, gs (B), transpiration rate, E (C) and instantaneous water use efficiency, IWUE (D) calculated as A/E in the leaves of wild-type plants (WT) and ABP9 transgenic plants (5P2). Control, well-watered plants; WD, withhold watering until soil relative water content (SRWC) reached 45–50%; HS, control plants subject to heat stress at 42 °C for 5 h; HSWD, WD-stressed plants subject to heat stress at 42 °C for 5 h. Measurements were conducted at 20 °C (control and WD) or 42 °C (HS and HSWD). Each point represents the mean ±SE (n=3).

 
Figure 2 shows the leaf ABA content in WT and 5P2 plants under control, WD, HS, and HSWD treatments. Under WD, HS, and HSWD, leaf ABA content in both WT and 5P2 plants was significantly increased, and with WD stress having the most prominent effect. 5P2 transgenic plants had significantly higher leaf ABA content than WT in all treatments.


Figure 2
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Leaf ABA content of wild-type (WT) and ABP9 transgenic plants (5P2) under well-watered (control), water deficits (WD), heat shock (HS), and a combination of HS and WD (HSWD) conditions. Vertical bars represent SE of the mean (n=3).

 
Chlorophyll fluorescence
Light response curves (LRCs) of electron transport rate (ETR), effective quantum yield ({Phi}PSII), and non-photochemical quenching (NPQ) against light intensity (PPFD) were constructed to estimate the photosynthetic light-use efficiency in response to different stresses. As shown in Fig. 3, WD had no distinct effects on ETR (Fig. 3A, B), while the values of ETR under HS and HSWD stresses tended to be higher than that under the control and WD in both WT and 5P2 plants (Fig. 3C, D). With respect to {Phi}PSII, the responses of WD plants were similar to the controls. In contrast, HS- and HSWD-stressed plants showed a much less steeper decline of {Phi}PSIII (Fig. 3A–D), indicating light-use efficiency was increased by HS. Compared with WT, the maximum ETR (ETRmax) value of 5P2 under the control condition was reduced, while under HSWD treatment 5P2 plants showed significantly higher ETRmax values (Fig. 3A, D). After WD treatment, no remarkable difference was observed in ETRmax between WT and 5P2 plants (Fig. 3B). Under HS treatment, although 5P2 plants did not differ significantly from WT in ETRmax, the ETR value was higher before reaching the maximal point. These results reflected improved ability of 5P2 to utilize light under HS and HSWD treatments, which is in accordance with the higher A of 5P2 plants in relation to WT under HS and HSWD treatments. With respect to {Phi}PSII, both curves of WT and 5P2 were almost identical under control, WD, and HSWD conditions. However, when the plants were exposed to HS treatment, {Phi}PSII of 5P2 showed higher value than that of WT at low light intensities (Fig. 3A–D).


Figure 3
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Light response curves (LRCs) for electron transport rate (ETR), effective quantum yield ({Phi}PSII) and non-photochemical quenching (NPQ) of WT (broken line) and 5P2 (solid line) under well-watered (control), water deficits (WD), heat shock (HS), and a combination of HS and WD (HSWD) stress conditions. Left panel: LRCs of ETR and {Phi}PSII were plotted together under control (A), WD (B), HS (C), and HSWD (D) treatments. Right panel: LRC of NPQ under control (E), WD (F), HS (G), and HSWD (H) treatments.

 
The analysis of non-photochemical quenching of chlorophyll fluorescence showed that 5P2 plants had an increased NPQ under control as compared with the WT (Fig. 3E). When exposed to HS and HSWD, NPQ remained significantly higher in 5P2 than that of the WT (Fig. 3G, H). However, there was no significant difference in NPQ between WT and 5P2 plants under WD treatment (Fig. 3F).

Chlorophyll (Chl) and carotenoid contents
WD, HS, and HSWD stresses altered chlorophyll and carotenoid content in WT and 5P2 (Fig. 4). Both Chl a/b and Chl/carotenoid ratio decreased upon the exposure of WD, HS, and HSWD stresses in comparison with the controls. A higher ratio of Chl a/b was found in 5P2 plants in all treatments (P < 0.05), which was mainly due to a lower amount of Chl b in 5P2 plants than in WT plants (data not shown). The carotenoid content in 5P2 plants was higher than that in WT plants, thus the chlorophyll to carotenoid ratio was lower for 5P2 than for WT in all treatments (P < 0.05).


Figure 4
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. Chlorophyll a/b ratio (A) and chlorophyll/carotenoid ratio (B) in the leaves of wild type (WT) and ABP9 transgenic plants (5P2) under well-watered (control), water deficits (WD), heat shock (HS), and a combination of HS and WD (HSWD) conditions. Bars represent the means ±SE (n=5).

 
Gene expression
The expressions of stress-regulated and light-harvesting-responsive genes were determined by using Relative Quantification Real-Time PCR. As shown in Fig. 5, compared with WT, transcript levels of PsbW (Shi et al., 2000; Peltier et al., 2004), Lhca6 (Ganeteg et al., 2004), and Lhcb2.4 (Jansson, 1999; Peltier et al., 2004) were reduced under control in 5P2 plants. Under WD and HS stresses, 5P2 plants showed an increase in Lhca6 and Lhcb2.4 RNA levels, while expression of PsbW was decreased under WD, yet increased under HS. Under HSWD, all the three genes were down-regulated.


Figure 5
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. Genes regulated in ABP9 transgenic plants (5P2) identified by real-time quantitative PCR in response to water deficits (WD), heat shock (HS), and a combination of HS and WD (HSWD). The amount of target gene, normalized to the endogenous (actin2) relative to the calibrator (WT), is given by 2{Delta}{Delta}CT. The figure was plotted by LN amount of target genes versus different treatments. Bars represent the means ±SE of three replicates, and the experiments were repeated at least three times.

 
Transcript levels of the stress-responsive genes were enhanced in the 5P2 transgenic line under control, WD, and HS conditions. These included DREB2H (Liu et al., 1998; Nakano et al., 2006) and HIS1-3 (Ascenzi and Gantt, 1997), HSFa6a (Nover et al., 2001), and HSP17.4 (Takahashi and Komeda, 1989; Krause and Weis, 1991; Scharf et al., 2001). Nevertheless, under HSWD, the expressions of HSFa6a and HSP17.4 were depressed, but DREB2H and HIS1-3 were still enhanced.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The objective of this study was to explore the potential function of ABP9 in stress adaptation in terms of photosynthesis performance of 5P2 transgenic Arabidopsis plants. To achieve this, gas exchange, chlorophyll fluorescence, leaf ABA content, photosynthetic pigments composition, and expression of stress- and light harvesting- responsive genes in both WT and 5P2 plants were determined and compared in response to WD, HS, and HSWD stress conditions. The results demonstrate that although 5P2 plants possess lower A and higher leaf ABA content under well-watered condition, they were more tolerant to the applied stresses as compared with the WT plants, indicating an important role of ABP9 in the regulation of plant photosynthesis under stress.

Inhibition of A under water deficit and high temperature can be attributed to stomatal- or non-stomatal limitations (Von Caemmerer and Farquhar, 1981; Cornic, 2000). In the present study, decreases or no changes in A showed the same pattern of changes in gs (Fig. 1A, B) under WD, HS, and HSWD stress treatments, suggesting that stomatal limitation was prominent in reducing A in both WT and 5P2 plants. It is well known that leaf ABA content increases under water-deficit stress and it is well correlated with decreasing gs in many plant species (Liu et al., 2005). Consistent with this, leaf ABA in both WT and 5P2 plants were significantly increased under all stress conditions (Fig. 2). However, the relationship between gs and leaf ABA content seems to be related to different type of plants and different stress treatments. For WT treated by WD, HS, and HSWD and 5P2 treated by WD and HS, gs was well correlated with leaf ABA content; while in 5P2 plants treated by HSWD stress, gs was not associated with the increased leaf ABA content. This result probably indicated that ABP9 could induce different regulatory mechanism under HSWD stress from that under single stress, which changed stomatal sensitivity to ABA.

E in both WT and 5P2 plants was decreased by WD, but significantly increased by HS and HSWD. The enhanced E by HS and HSWD might be due to high vapour pressure deficit (VPD) in the air which increased the evaportranspirative demand (although the gs was also lowered under HS as well). While under WD, E was mainly controlled by gs, thus the lower gs was, the lower E was.

It was also observed that 5P2 plants exhibited lower A and ETR under optimal growth condition, these features are generally accepted as indicative of occurrence of photoinhibition (Demmig-Adams et al., 2004). Several studies have demonstrated that species with stronger photoinhibition are more tolerant to stress (Demmig-Adams et al., 1999; Adams III et al., 2002). This seems to be the case, as observed in the present study, that 5P2 plants showed a small decrease and no significant change in A in response to WD, HS, and HSWD, and in comparison with WT, 5P2 had higher A and ETR under HS and/or HSWD treatments. These results seemingly indicate that ABP9 might function in improving the stability and adaptability of photosynthetic apparatus to the imposed environmental stress, and could potentiate the expression of a novel mechanism that can only be activated under the presence of both WD and HS.

Leaf photosynthetic pigment content (chlorophylls and carotenoids) and pigment ratios, such as Chl a/b and chlorophylls/carotenoids are good indicators for stress detection and tolerance (Babani et al., 2003). Both ratios decreased in the stressed plants as compared with the controls (Fig. 4). This is in accordance with the decreased A under stress conditions. 5P2 retained a significantly higher Chl a/b ratio and lower chlorophyll/carotenoid ratio than did WT under both control and stress conditions. The increase of Chl a/b in 5P2 indicates a preferential decrease in light-harvesting chlorophyll a/b-binding proteins (LHC) associated with PSII (LHCII) to transfer excitation energy to the PSII core complex (Xu et al., 1995). The decrease in LHCII due to reduction in light absorption cross-section of photosystems is an essential protection mechanism, which allows plants to survive unfavourable conditions (Lichtenthaler, 1987; Spundová et al., 2003). In addition, it is well documented that functions of carotenoids other than to light harvesting include photoprotection by either protecting photosynthetic systems against ROS or singlet energy dissipation by NPQ (Young, 1991; Loggini et al., 1999; Caffarri et al., 2001). The results of the present study also showed higher NPQ in 5P2 relative to WT under control, HS, and HSWD, suggesting ABP9 enhanced the non-photochemical quenching capacity termed as dissipating excess excitation energy absorbed by PSII as heat. Localization of NPQ in the antenna system is thought to be an efficient means of protective reactions from overstimulation that could result in the formation of reactive oxygen species (ROS) (Melis, 1999) and the photoprotective mechanism involves carotenoids (Niyogi et al., 1997, 1998). Therefore, higher NPQ associated with a lower Chl/carotenoid ratio resulting from the increase in carotenoid content in 5P2 probably indicates that ABP9 could function in protecting photosynthesis apparatus through improving photoprotective thermal dissipation and enhancing antioxidative ability under optimal and stress conditions.

In order to dissect the possible molecular mechanism by which ABP9 regulates photosynthetic capacity in response to stress, the expression of several photosynthesis-responsive and stress-defensive genes were analysed. Results showed that under WD and HS stress ABP9 enhanced the expression of drought/heat stress-responsive transcription factors (DREB2H and HSF) and functional genes (HIS1-3 and HSP17.4) together with light-harvesting complex Lhca6 and Lhcb2.4. These results are in accordance with the photosynthesis performance of 5P2 plants in response to stress. Although under the combined stress condition (HSWD), PsbW, Lhca6, and Lhcb2.4 together with HSF and HSP17.4 were down-regulated, expressions of DREB2H and HIS1-3 were still enhanced in 5P2 plants. Studies suggest that DREB2 subfamily genes like DREB2H and DREB2A functioned in cross-talk between the signalling pathways for heat and water deficits, thereby improving stress tolerance (Lim et al., 2006; Sakuma et al., 2006), and increasing evidences indicate sHSP protects PSII under some stress conditions (Neta-Sharir et al., 2005; Guo et al., 2007). Thus, the transcriptional induction of these genes indicates that ABP9 could play a role in protecting PSII and improving photosynthesis in response to stress. In addition, under control and HSWD condition, down-regulation of PsbW, Lhca6, and Lhcb2.4 in 5P2 could partially protect the photosynthetic apparatus from absorbing excess energy especially in response to extreme stress, although the redox state of the photosynthetic electron carriers is not strictly correlated with LHCII gene expression (Baker, 1991; Gray et al., 1996).

ABA plays an important role in the adaptive response of plants to a variety of environmental stress (Finkelstein et al., 2002). Mutant plants defective in ABA biosynthesis are found to be more susceptible to environmental stress, and manipulating ABA levels by changing the expression of key ABA biosynthetic genes improves plant stress tolerance (Xiong et al., 2002). Water use efficiency (WUE) is an important trait of plants in a water-deficit environment, where plants tend to conserve water by promoting WUE to improve drought resistance (Karaba et al., 2007). In this study, findings of elevated ABA level, improved IWUE and enhanced expression of stress-defensive genes in 5P2 plants indicate that ABP9 might function in regulating ABA metabolism and drought stress signalling. The simplest explanation for the elevated ABA level in 5P2 plants is that the constitutive expression of ABP9 enhances the expression of genes encoding key enzymes in ABA biosynthesis through interacting with ABREs in their promoters, given that ABP9 protein is capable of activating the expression of downstream reporter gene via specific interaction with ABREs (Wang et al., 2002), and that stress-inducible ABA biosynthetic genes contain ABRE-like element in their promoters (Xiong et al., 2001; Bray, 2002).

In summary, our results indicate that constitutive expression of ABP9 improves the photosynthetic capacity of plants under stress by adjusting the photosynthetic pigment composition, dissipating excess light energy, and elevating carbon-use efficiency as well as increasing the ABA content, IWUE, and expression of stress-defensive genes, suggesting an important role of ABP9 in the regulation of plant photosynthesis under stress.


    Acknowledgements
 
This work was supported by both the National Basic Research Program of China (No. 2006CB100102) and the Sino-Danish Scientific and Technological Cooperation Project between the Chinese Academy of Agricultural Sciences (CAAS) and the Danish Institute of Agricultural Sciences at Arhus University. We thank Dr Rene Gislum for statistic assistance, Drs Jeppe Reitan Anderson and Birte Boelt for the collaborative work. We are grateful to the grant support from Danida Fellowship.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Adams WW III, Demmig-Adams B, Rosenstiel TN, Brightwell AK, Ebbert V. Photosynthesis and photoprotection in overwintering plants. Plant Biology (2002) 4:545–557.[CrossRef]

Ascenzi R, Gantt JS. A drought-stress-inducible histone gene in Arabidopsis thaliana is a member of a distinct class of plant linker histone variants. Plant Molecular Biology (1997) 34:629–641.[CrossRef][Web of Science][Medline]

Asch F. Determination of abscisic acid by indirect enzyme-linked immunosorbent assay (ELISA). Technical Report. Laboratory for Agrohydrology and Bioclimatology, Department of Agricultural Sciences, The Royal Veterinary and Agricultural University, Tastrup, Denmark (2000).

Babani F, Ylli A, Lichtenthaler HK. (2003) Optical properties of leaves on some wheat genotypes. In: Fifth general conference of the Balkan Physical Union, 25–29 August, 2003. Vrnjacka Banja, Serbia and Montenegro, SP15–037.

Baker NR. A possible role for photosystem II in enviromental perturbations of photosynthesis. Physiologia Plantarum (1991) 81:563–570.[CrossRef]

Bray EA. Abscisic acid regulation of gene expression during water-deficit stress in the era of the Arabidopsis genome. Plant, Cell and Environment (2002) 25:153–161.[CrossRef][Medline]

Boyer J. Plant productivity and environment. Science (1982) 218:443–448.[Abstract/Free Full Text]

Caffarri S, Croce R, Breton J, Bassi R. The major antenna complex of photosystem II has a xanthophyll binding site not involved in light harvesting. Journal of Biological Chemistry (2001) 276:35924–35933.[Abstract/Free Full Text]

Camejo D, Rodriguez P, Angeles Morales M, Miguel Dell'Amico J, Torrecillas A, Alarcon JJ. High temperature effects on photosynthetic activity of two tomato cultivars with different heat susceptibility. Journal of Plant Physiology (2005) 162:281–289.[CrossRef][Web of Science][Medline]

Cornic G. Drought stress inhibits photosynthesis by decreasing stomatal aperture: not by affecting ATP synthesis. Trends in Plant Science (2000) 5:187–188.[CrossRef][Web of Science]

Daie J, Campbell WF. Response of tomato plants to stressful temperatures: increase in abscisic acid concentrations. Plant Physiology (1981) 67:26–29.[Abstract/Free Full Text]

Davies WJ, Zhang J. Root signals and the regulation of growth and development of plants in drying soil. Annual Review of Plant Physiology and Plant Molecular Biology (1991) 42:55–76.[CrossRef][Web of Science]

Demmig-Adams B, Adams WW III, Ebbert V, Logan BA. Ecophysiology of the xanthophyll cycle. In: The photochemistry of carotenoids Advances in photosynthesis and respiration—Frank HA, Young HA, Britton G, Cogdell RJ, eds. (1999) Vol. 8. Dordrecht: Kluwer Academic Publishers. 245–269.

Demmig-Adams B, Ebbert V, Adams WW III. Photosynthesis and stress. In: Encyclopedia of plant and crop science—Goodman RM, ed. (2004) New York: Marcel Dekker. 901–905.

Feller U, Crafts-Brandner SJ, Salvucci ME. Moderately high temperatures inhibit ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) activase-mediated activation of Rubisco. Plant Physiology (1998) 116:539–546.[Abstract/Free Full Text]

Finkelstein RR, Gampala SSL, Rock CD. Abscisic acid signaling in seeds and seedlings. The Plant Cell (2002) 14:S15–S45.[Free Full Text]

Fujita Y, Fujita M, Satoh R, Maruyama K, Parvez MM, Seki M, Hiratsu K, Ohme-Takagi M, Shinozaki K, Yamaguchi-Shinozaki K. AREB1 is a transcription activator of novel ABRE-dependent ABA signaling that enhances drought stress tolerance in Arabidopsis. The Plant Cell (2005) 17:3470–3488.[Abstract/Free Full Text]

Ganeteg U, Klimmek F, Jansson S. Lhca5, an LHC-type protein associated with photosystem I. Plant Molecular Biology (2004) 54:641–651.[CrossRef][Web of Science][Medline]

Genty B, Briantais J-M, Baker N. The relationship between the quantum yield of photosynthetic electron transport and quenching of chlorophyll fluorescence. Biochimica et Biophysica Acta (1989) 990:87–92.

Gray GR, Savitch LV, Ivanov AG, Huner NPA. Photosystem II excitation pressure and development of resistance to photoinhibition. II. Adjustment of photosynthetic capacity in winter wheat and winter rye. Plant Physiology (1996) 110:61–71.[Abstract]

Guan LM, Zhao J, Scandalios JG. Cis-elements and trans-factors that regulate expression of the maize Cat1 antioxidant gene in response to ABA and osmotic stress: H2O2 is the likely intermediary signalling molecule for the response. The Plant Journal (2000) 22:87–95.[CrossRef][Web of Science][Medline]

Guo SJ, Zhou HY, Zhang XS, Li XG, Meng QW. Overexpression of CaHSP26 in transgenic tobacco alleviates photoinhibition of PSII and PSI during chilling stress under low irradiance. Journal of Plant Physiology (2007) 164:126–136.[CrossRef][Web of Science][Medline]

Ivanov AG, Krol M, Maxwell D, Huner NPA. Abscisic acid induced protection against photoinhibition of PSII correlates with enhanced activity of the xanthophyll cycle. FEBS Letters (1995) 371:61–64.[CrossRef][Web of Science][Medline]

Jakoby M, Weisshaar B, Droge-Laser W, Vicente-Carbajosa J, Tiedemann J, Kroj T, Parcy F. bZIP transcription factors in Arabidopsis. Trends in Plant Science (2002) 7:106–111.[CrossRef][Web of Science][Medline]

Jansson S. A guide to the Lhc genes and their relatives in Arabidopsis. Trends in Plant Science (1999) 4:236–240.[CrossRef][Web of Science][Medline]

Jones HG. Drought tolerance and water-use efficiency. In: Water deficits: plant responses from cell to community—Smith JAC, Griffiths H, eds. (1993) Oxford: Bios Scientific Publishers. 193–204.

Karaba A, Dixit S, Greco R, Aharoni A, Trijatmiko KR, Marsch-Martinez N, Krishnan A, Nataraja KN, Udayakumar M, Pereira A. Improvement of water use efficiency in rice by expression of HARDY, an Arabidopsis drought and salt tolerance gene. Proceedings of the National Academy of Sciences, USA (2007) 104:15270–15275.[Abstract/Free Full Text]

Krause GH, Weis E. Chlorophyll fluorescence and photosynthesis: the basics. Annual Review of Plant Biology (1991) 42:313–349.[CrossRef][Web of Science]

Lichtenthaler HK. Chlorophyll and carotenoids: pigments of photosynthetic biomembranes. Methods in Enzymology (1987) 148:350–382.[Web of Science]

Lichtenthaler HK, Buschmann C. Chlorophylls and carotenoids: measurement and characterization by UV-VIS spectroscopy. In: Current protocols in food analytical chemistry (CPFA)—Wrolstad RE, Acree TE, An H, Decker EA, Penner MH, Reid DS, Schwartz SJ, Shoemaker CF, Sporns P, eds. (2001) New York: John Wiley & Sons. F4.3.1–F4.3.8.

Lim CJ, Yang KA, Hong JK, Choi JS, Yun DJ, Hong JC, Chung WS, Lee SY, Cho MJ, Lim CO. Gene expression profiles during heat acclimation in Arabidopsis thaliana suspension-culture cells. Journal of Plant Research (2006) 119:373–383.[CrossRef][Web of Science][Medline]

Liu FL, Jensen CR, Andersen MN. Hydraulic and chemical signals in the control of leaf expansion and stomatal conductance in soybean exposed to drought stress. Functional Plant Biology (2003) 30:65–73.[CrossRef][Web of Science]

Liu FL, Jensen CR, Shahanzari A, Andersen MN, Jacobsen SE. ABA regulated stomatal control and photosynthetic water use efficiency of potato (Solanum tuberosum L.) during progressive soil drying. Plant Science (2005) 168:831–836.

Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. The Plant Cell (1998) 10:1391–1406.[Abstract/Free Full Text]

Loggini B, Scartazza A, Brugnoli E, Navari-Izzo F. Antioxidative defense system, pigment composition, and photosynthetic efficiency in two wheat cultivars subjected to drought. Plant Physiology (1999) 119:1091–1100.[Abstract/Free Full Text]

Maxwell K, Johnson GN. Chlorophyll fluorescence: a practical guide. Journal of Experimental Botany (2000) 51:659–668.[Abstract/Free Full Text]

Melis A. Photosystem-II damage and repair cycle in chloroplasts: what modulates the rate of photodamage in vivo? Trends in Plant Science (1999) 4:130–135.[CrossRef][Web of Science][Medline]

Nakano T, Suzuki K, Fujimura T, Shinshi H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiology (2006) 140:411–432.[Abstract/Free Full Text]

Neta-Sharir I, Isaacson T, Lurie S, Weiss D. Dual role for tomato heat shock protein 21: protecting photosystem II from oxidative stress and promoting color changes during fruit maturation. The Plant Cell (2005) 17:1829–1838.[Abstract/Free Full Text]

Niyogi KK, Bjorkman O, Grossman AR. Chlamydomonas xanthophyll cycle mutants identified by video imaging of chlorophyll fluorescence quenching. The Plant Cell (1997) 9:1369–1380.[Abstract]

Niyogi KK, Grossman AR, Björkman O. Arabidopsis mutants define a central role for the xanthophyll cycle in the regulation of photosynthetic energy conversion. The Plant Cell (1998) 10:1121–1134.[Abstract/Free Full Text]

Nover L, Bharti K, Döring P, Mishra SK, Ganguli A, Scharf KD. Arabidopsis and the heat stress transcription factor world: how many heat stress transcription factors do we need? Cell Stress and Chaperones (2001) 6:177–189.[Web of Science][Medline]

Parry MAJ, Andralojc PJ, Khan S, Lea PJ, Keys AJ. Rubisco activity: effects of drought stress. Annals of Botany (2002) 89:833–839.[Abstract/Free Full Text]

Pastenes C, Horton P. Effect of high temperature on photosynthesis in beans. I. oxygen evolution and chlorophyll fluorescence. Plant Physiology (1996) 112:1245–1251.[Abstract]

Peltier JB, Ytterberg AJ, Sun Q, van Wijk KJ. New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and versatile fractionation strategy. Journal Biological Chemistry (2004) 279:49367–49383.[Abstract/Free Full Text]

Rascher U, Liebig M, Lüttge U. Evaluation of instant light-response curves of chlorophyll fluorescence parameters obtained with a portable chlorophyll fluorometer on site in the field. Plant, Cell and Environment (2000) 23:1397–1405.[CrossRef]

Reddy AR, Chaitanya KV, Vivekanandan M. Drought-induced responses of photosynthesis and antioxidant metabolism in higher plants. Journal of Plant Physiology (2004) 161:1189–1202.[CrossRef][Web of Science][Medline]

Rizhsky L, Liang H, Shuman J, Shulaev V, Davletova S, Mittler R. When defense pathways collide. The response of Arabidopsis to a combination of drought and heat stress. Plant Physiology (2004) 134:1683–1696.[Abstract/Free Full Text]

Sakuma Y, Maruyama K, Qin F, Osakabe Y, Shinozaki K, Yamaguchi-Shinozaki K. Colloquium paper: dual function of an Arabidopsis transcription factor DREB2H in water-stress-responsive and heat-stress-responsive gene expression. Proceedings of the National Academy of Sciences, USA (2006) 103:18822–18827.[Abstract/Free Full Text]

Saradhi PP, Suzuki I, Katoh A, Sakamoto A, Sharmila P, Shi DJ, Murata N. Protection against the photo-induced inactivation of the photosystem II complex by abscisic acid. Plant, Cell and Environment (2000) 23:711–718.[Medline]

Scharf KD, Siddique M, Vierling E. The expanding family of Arabidopsis thaliana small heat stress proteins and a new family of proteins containing {alpha}-crystallin domains (acd proteins). Cell Stress and Chaperones (2001) 6:225–237.[Web of Science][Medline]

Shi LX, Lorkovic ZJ, Oelmuller R, Schroder WP. The low molecular mass PsbW protein is involved in the stabilization of the dimeric photosystem II complex in Arabidopsis thaliana. Journal of Biological Chemistry (2000) 275:37945–37950.[Abstract/Free Full Text]

Spundová M, Popelková H, llík P, Skotnica J, Novotny R, Naus J. Untra-structural and functional changes in the chloroplasts of deteched barley leaves senesing under dark and light conditions. Journal of Plant Physiology (2003) 160:1051–1058.[CrossRef][Web of Science][Medline]

Takahashi Tk, Komeda Y. Characterization of two genes encoding small heat-shock proteins in Arabidopsis thaliana. Molecular and General Genetics (1989) 219:365–372.[CrossRef]

Tezara W, Mitchell VJ, Driscoll SD, Lawlor DW. Water stress inhibits plant photosynthesis by decreasing coupling factor and ATP. Nature (1999) 401:914–917.[CrossRef]

Von Caemmerer S, Farquhar GD. Some relationships between the biochemistry of photosynthesis and the gas exchange of leaves. Planta (1981) 153:376–387.[CrossRef][Web of Science]

Wang L, Zhao J, Fan YL. Gene cloning and function analysis of ABP9 protein which specifically binds to ABRE2 motif of maize Cat1 gene. Chinese Science Bulletin (2002) 47:1871–1875.[CrossRef][Web of Science]

Wilkinson S, Davies WJ. ABA-based chemical signalling: the co-ordination of responses to stress in plants. Plant, Cell and Environment (2002) 25:195–210.[CrossRef][Medline]

Wollenweber B, Porter JR, Lübberstedt T. Need for multidisciplinary research towards a second green revolution. Current Opinion in Plant Biology (2005) 8:337–341.[CrossRef][Web of Science][Medline]

Wollenweber B, Porter JR, Schellberg J. Lack of interaction between extreme high-temperature events at vegetative and reproductive growth stages in Wheat. Journal of Agronomy and Crop Science (2003) 189:142–150.[CrossRef][Web of Science]

Xiong L, Ishitani M, Lee H, Zhu JK. The Arabidopsis LOS5/ABA3 locus encodes a molybdenum cofactor sulfurase and modulates cold stress- and osmotic stress-responsive gene expression. The Plant Cell (2001) 13:2063–2083.[Abstract/Free Full Text]

Xiong L, Schumaker KS, Zhu JK. Cell signaling during cold, drought and salt stress. The Plant Cell (2002) 14:S165–S183.[Free Full Text]

Xiong LM, Zhu JK. Regulation of abscisic acid biosynthesis. Plant Physiology (2003) 133:29–36.[Free Full Text]

Xu Q, Henry RL, Guikema JA, Paulsen GM. Association of high-temperature injury with increased sensitivity of photosynthesis to abscisic acid in wheat. Environmental and Experimental Botany (1995) 35:441–449.[CrossRef][Web of Science]

Young AJ. The photoprotective role of carotenoids in higher plants. Physiologia Plantarum (1991) 83:702–708.[CrossRef]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
ANN BOT (LOND)Home page
N. J. M. Saibo, T. Lourenco, and M. M. Oliveira
Transcription factors and regulation of photosynthetic and related metabolism under environmental stresses
Ann. Bot., February 1, 2009; 103(4): 609 - 623.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
59/4/839    most recent
erm364v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Zhang, X.
Right arrow Articles by Zhao, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, X.
Right arrow Articles by Zhao, J.
Agricola
Right arrow Articles by Zhang, X.
Right arrow Articles by Zhao, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?